Secretion from Enteroendocrine L Cells ... - ACS Publications

Subscriber access provided by University of Otago Library

Article

A mechanistic study on nanoparticle-mediated glucagonlike peptide-1 (GLP-1) secretion from enteroendocrine L cells Ana Beloqui, Mireille Alhouayek, Dario Carradori, Kevin Vanvarenberg, Giulio G. Muccioli, Patrice D. Cani, and Veronique Preat Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.6b00871 • Publication Date (Web): 08 Nov 2016 Downloaded from http://pubs.acs.org on November 9, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

A mechanistic study on nanoparticle-mediated glucagon-like peptide-1 (GLP-1) secretion from enteroendocrine L cells

Ana Beloqui1, Mireille Alhouayek2, Dario Carradori1, Kevin Vanvarenberg1, Giulio G. Muccioli2, Patrice D. Cani3,*, Véronique Préat1,*

1

Université catholique de Louvain, Louvain Drug Research Institute, Advanced Drug Delivery and Biomaterials, 1200 Brussels, Belgium 2

Université catholique de Louvain, Louvain Drug Research Institute, Bioanalysis and Pharmacology of Bioactive Lipids Research Group, 1200 Brussels, Belgium 3

Université catholique de Louvain, WELBIO (Walloon Excellence in Life sciences and BIOtechnology), Louvain Drug Research Institute, Metabolism and Nutrition Group, 1200 Brussels, Belgium The authors declare no conflict of interests.

*Corresponding authors : Prof. Véronique Préat Université catholique de Louvain Louvain Drug Research Institute Advanced Drug Delivery and Biomaterials Avenue Mounier 73 box B1 73.12 B-1200 Brussels, Belgium Phone:+32 2 7647320;Fax:+32 2 7647398 E-mail : [email protected]

Prof. Patrice D. Cani Université catholique de Louvain Louvain Drug Research Institute Metabolism and Nutrition Avenue Mounier 73 box B1 73.11 B-1200 Brussels, Belgium Phone:+32 2 7647397 E-mail : [email protected]

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 17

Lipid-based nanoparticles activate GLP-1 secretion from enteroendocrine L cells Abstract L cells have attracted particular interest because of the pleiotropic effects of their secreted peptides (i.e. glucagon-like peptide (GLP) 1 and 2, peptide YY (PYY)). L cells express different G-proteincoupled receptors (GPCRs) that can be activated by endogenous ligands found in the gut lumen. We herein hypothesized that lipid-based nanoparticles could mimic endogenous ligands and thus, activate GLP-1 secretion in type 2 diabetes mellitus treatment. To assess this hypothesis, that lipid but not polymeric nanoparticles could activate GLP-1 secretion from L cells, lipid-based nanoparticles (nanostructured lipid carriers (NLC), lipid nanocapsules (LNC) and liposomes), and the PLGA nanoparticles were added to the L cells and GLP-1 secretion was quantified. Among these nanoparticles, only NLC resulted effective at inducing GLP-1 secretion in both murine and human L cells in vitro. The mRNA expression of proglucagon showed that this effect was due to an increased GLP-1 secretion, and not to an increased GLP-1 synthesis. The mechanism by which NLC triggered GLP-1 secretion by L cells revealed an extracellular interaction of NLC, exerting a physiological GLP-1 secretion. We herein demonstrate that nanomedicine can be used to induce GLP-1 secretion from murine and human L cells. Keywords: L cells; type 2 diabetes mellitus; enteroendocrine system; GLP-1; incretin Introduction The enteroendocrine system constitutes the largest endocrine organ. L cells are enteroendocrine cells present from the duodenum to the rectum; however, the colon harbors the highest L cell density. These cells have attracted particular interest because of the pleiotropic effects of their secreted peptides (i.e. glucagon-like peptide (GLP)-1 and -2, peptide YY (PYY)).1 GLP-1 and PYY are known to reduce food intake and to decrease gastric emptying and pancreatic and gastric secretions. The cosecretion of GLP-2 by L cells helps maintaining the physiological gut barrier function and regulates the stimulation of intestinal epithelial cell proliferation.2-4 Changes in the secretion of these peptides


2

Page 3 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


have been observed in diseases such as obesity, type 2 diabetes mellitus (T2DM) and inflammatory bowel diseases (IBD). Drugs based on GLP-1 have proved to be highly successful for treating T2DM: GLP-1 secreted from intestinal L cells, stimulates postprandial insulin secretion and is quickly hydrolized by the dipeptidyl peptidase-IV (DPP-IV). Therefore, this has led to the development of GLP-1 analogs or DPP-IV inhibitors with improved plasma half-life now widely used in the treatment of diabetes. Lately, researchers have turned their attention toward the enteroendocrine L cells themselves as targets for the treatment of obesity, T2DM and IBD.5 Indeed, the enhancement of endogenous GLP-1 secretion would represent a more physiological and novel alternative in incretin-based diabetes therapy.6-8 L cells express various G-protein-coupled receptors (GPCRs) that can be activated by nutrients (including lipids) found in the gut lumen.9 For example, short chain fatty acids (SCFA) are byproducts of the microbial activity and are ligands for GPR43, GPR41 and GPR109A.10, 11 Longchain fatty acids (LCFA) are ligands for GPR40 and GPR12012, 13 whereas medium-chain fatty acids (MCFA) are ligands for GPR84.14 N-oleoylethanolamine and 2-oleoylglycerol (2-OG) are both ligands for GPR11915, 16 and finally, TGR5 can be activated by bile salts.17 Thus, targeting GPCRs may lead to the production of GLP-1, GLP-2 and PYY, representing putative therapeutic targets18, 19, and we and others hypothesized that nanoparticles could represent a valuable strategy to target these receptors.20, 21 The present study is based on the hypothesis that lipid-based nanoparticles, mimicking the endogenous lipid ligands present in the lumen, could induce the secretion of GLP-1 by L cells, thus representing a novel strategy for T2DM treatment. The aim of the present study was to prove the concept that lipid-based nanoparticles could induce GLP-1 secretion from both murine and human enteroendocrine cells. For this purpose, three different lipid-based formulations, nanostructured lipid carriers (NLC)22, lipid nanocapsules (LNC)23 and liposomes24, were tested in vitro. Understanding the mechanisms that underline GLP-1 secretion from enteroendocrine L cells is vital to this approach, and forms the focus of our research. Hence, the second aim of this work was to unravel the mechanisms by which nanoparticles induced GLP-1 secretion from L cells. Experiemental section Materials Chemicals Sodium chloride (NaCl), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT), dimethylsulphoxide (DMSO), Tween® 80 (polyethylene glycol sorbitan monooleate), Triton-X 100, octanoic acid (C8), decanoic acid (C10), palmitic acid (C16), stearic acid (C18), 1-oleoylglycerol (1OG), 2-oleoylglycerol (2-OG), 1-palmitoylglycerol (1-PG), 2-palmitoylglycerol (2-PG), 1-octanoylrac-glycerol (8-MAG), 1-decanoyl-rac-glycerol (10-MAG), 1,2-dipalmitoyl-rac-glycerol (16-DAG), 1,3-distearoylglycerol (18-DAG), polyvinyl alcohol (PVA) (average 13,000–23,000), poly (lactideco-glycolide) acid (PLGA) (L:G 50:50, average Mw 7,000–17,000, acid terminated) and Mowiol® 488 were purchased from Sigma–Aldrich (St. Louis, MO, USA). Egg sphingomyelin (eSM), 1palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) and cholesterol were purchased from Avanti Polar Lipids (Birmingham, AL). Lipoïd® S75-3 was purchased from Lipoid GmbH (Ludwigshafen, DE). Kolliphor® P188 (poloxamer 188) and Solutol® HS15 (PEG 660 12hydroxystearate, MW 870 Da) were kindly provided by BASF (Burgbernheim, DE). Precirol ATO®5 (glyceryl palmitostearate) and Labrafac® WL 1349 (caprylic/capric acid triglycerides) were a kind gift from Gattefossé (Saint-Priest, FR). Miglyol 812N/F was a gift from Cremer Oleo GmbH & Co. KG


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 17

(Hamburg, DE). DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4Chlorobenzenesulfonate Salt) (DiD) was purchased from Molecular Probes® by Life Technologies (Belgium). Matrigel™ was obtained from BD Bioscience (BE). Dipeptidyl peptidase-4 (DPP-IV) inhibitor was purchased from Millipore (St. Charles, MO, USA).

Cell culture The intestinal murine L cell line GLUTag was kindly provided by Dr. Daniel Drucker (University of Toronto, Toronto, Canada). The human NCI-H716 L cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). Dulbecco’s modified Eagle’s medium (DMEM)-GlutaMAX (5.5 mM glucose), Roswell Park Memorial Institute (RPMI) 1640 medium, penicillin-streptomycin (PEST), fetal bovine serum (FBS), phosphate buffered saline (PBS) and trypsin (0.05%) with EDTA were purchased from GibcoTM (Invitrogen, UK). Preparation and characterization of the formulations Preparation of NLC NLC were prepared using the high-pressure homogenization technique, as previously described by Beloqui et al.25-30 Briefly, Precirol ATO®5 (3 g) and Miglyol 812N/F (0.3 mL) were blended and melted above the melting point of Precirol ATO®5 (55°C) to form a uniform oil phase. Tween 80 (2%) (w/v) and Kolliphor® P188 (1%) (w/v) were dispersed in water (30 mL) and heated to the same temperature as the lipid phase. The aqueous phase was then added to the oil phase and the mixture was sonicated for 15 s to form a hot pre-emulsion. This was subsequently homogenized at 80°C and 500 bar using a Stansted nG12500 homogenizer (SFP, Essex, UK) for ten homogenization cycles. To further evaluate the localization of NLC within L cells, NLC were labeled with the fluorescent dye DiD (λex= 644; λem= 665) by incorporating 1 mg of the dye in the lipid phase of the formulation. The release of the dye from the formulation was undetectable by fluorescence measurement (Spectophotometer Spectramax M2e & program SoftMax Pro, Molecular Devices, LLC, USA) after 2 h of incubation in culture media. These results are in agreement with those previously reported by Gartziandia et al.31

Preparation of LNC LNC were prepared as previously reported by Heurtault et al.32 Briefly, 0.846 g Solutol® HS15, 0.075 g Lipoïd® S75-3, 0.089 g NaCl, 1.028 g Labrafac® WL 1349 and 2.962 mL of Milli Q™ water were mixed under magnetic stirring for 5 min at 30°C. A minimum of 3 cycles of progressive heating/cooling were applied between 60°C and 90°C. During the cooling of the last cycle, 12.5 ml of cold water were added, the nanoparticles were then filtered using a 0.2 µm filter and stored at 4 °C. Preparation of liposomes Liposomes were prepared using 3 lipid components: POPC/eSM/Chol (1:1:1, molar), as previously described.33 The amount of lipids necessary for a final concentration of 12 mM was dissolved in chloroform. After drying the lipid mixture with nitrogen, the lipid film was dried overnight in a vacuum desiccator to remove remaining solvent traces. The dry lipid film was hydrated with phosphate-free buffer (10 mM Tris, 0.1 M NaCl at pH 7) and kept at 50°C for 30 min. The suspension was subjected to five cycles of freezing/thawing. This suspension was then extruded through Nucleopore Track-Etch Membrane polycarbonate filters (Whatman®, Brentford, UK) with a pore diameter of 0.1 µm. Liposomes were stored at 4°C and used within a maximum period of 2 days after their preparation.


4

Page 5 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The lipid composition per formulation is disclosed in Table 1S as Supplementary information.

Preparation of PLGA nanoparticles PLGA nanoparticles were prepared by the emulsion-solvent evaporation method.34 Briefly, 50 mg of PLGA were dissolved in 2 ml dichloromethane. The solution was emulsified with 10 ml of 1% (w/v) PVA solution by sonication at 70 W for 1 min. The emulsion was then added dropwise to 100 ml of PVA solution (0.1 % w/v) and stirred at 600 rpm for 1 h on a water bath to evaporate any residual solvent. After 1 h, the resulting suspension was centrifuged for 30 min at 45,000 x g and 4°C to (Avanti-JE centrifuge, Beckman coulter, USA). The nanoparticle pellet was then washed three times in distilled water. Nanoparticles were then lyophilized (Labconco, USA) for 24 h and stored at 4°C until further use. Nanoparticle characterization The nanoparticles were characterized by measuring their particle size and poly dispersity index (PdI) by dynamic light scattering (DLS). The zeta potential was determined by laser doppler velocimetry (LSV) (Malvern Zetasizer Nano ZS, Malvern Instruments Ltd., Worcestershire, UK). Three replicate analyses were performed for each formulation. GLP-1 secretion studies in GLUTag and NCI-H716 cells

Cell cultures: GLUTag and NCI-H716 GLUTag cells were used from passage 17 to 28. Cells were grown in DMEM GlutaMAX supplemented with 10% (v/v) inactivated FBS and 1% (v/v) PEST (complete DMEM medium), at 37 °C in a 5% CO2/95% air atmosphere. NCI-H716 were used between passages x+1 and x+8 and grown in suspension, cultivated in RPMI medium supplemented with 10% (v/v) inactivated FBS and 1% (v/v) PEST, at 37 °C in a 5% CO2/95% air atmosphere.

Cytotoxicity studies Cell viability was assessed after the co-incubation of 5x104 GLUTag or NCI-H716 cells/well on a 96well tissue culture plates (Costar® Corning® CellBIND Surface) with increasing nanoparticle concentrations dispersed in culture medium. Cells were co-incubated for 2 h with the nanoparticles. After this incubation time, the supernatants were removed and preserved at 4 °C for the lactate dehydrogenase activity (LDH assay), following the manufacturer’s instructions (Roche Diagnostics Belgium, Vilvoorde, BE). The cells were incubated again for 3 h with 100 µL 0.5 mg/mL MTT. The purple formazan crystals were dissolved in 100 µL of DMSO. The absorbance was measured at 560 nm using a MultiSkan EX plate reader (Thermo Fisher Scientific, MA, USA). Cells with Triton-X 100 (100% dead) and cells with culture medium (100% alive) were considered as positive and negative controls, respectively.30 The measurement of the LDH activity was performed in the supernatants of each experiment, per each sample, to assess the absence of toxicity within the secretion assay. The IC50s were calculated using the GraphPad Prism 5 program (CA, USA). All MTT assays were repeated in triplicate. The LDH release induced by the different nanoparticles did not exceed 25%, unless otherwise stated.

GLP-1 secretion assay GLUTag or NCI-H716 cells (1.8 x 105 cells/well) were seeded into Matrigel™-coated (10 µL/mL of medium) 24-well cell culture plates and allowed to adhere for 24 h. The day after, cells were treated for 2 h with the nanoparticle formulations or nanoparticle lipid components (concentrations described in Table 1). The concentrations of the nanoparticles were based on the cytotoxicity studies (section


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 17

Cytotoxicity studies). Equivalent concentrations of the lipid components present in Mygliol and Precirol to those present in the NLC formulation (taking into account the product information sheet provided by the suppliers Cremer Oleo GmbH & Co and Gattefossé, respectively, Table 1S Supplementary information) were assayed, except for 1-OG, 2-OG, 1-PG and 2-PG due to their insolubility at the required concentrations. In the case of these bioactive lipids, concentrations above the GPR119 activation EC50 values described for these lipids were used (concentrations >17 µM).16 In the case of Precirol, it was not possible to disperse it in culture medium at the concentration used within NLC and thus, it was not assayed (NA). The absence of toxicity was assessed after each experiment by quantifying the LDH release in the supernatants (section Cytotoxicity studies). All experiments were conducted in complete DMEM medium in the presence of DPP-IV inhibitor at 50 µM final concentration (Millipore, St. Charles, MO, USA). Total and active GLP-1 concentrations were determined with the Meso Scale Discovery ELISA kits (MesoScale, Gaithersburg, USA) and expressed as the amount of GLP-1 detected in the supernatant, normalized to the total amount of GLP-1 in the medium plus cells.35 To evaluate the ability of the cells to recover their basal GLP-1 levels (extracellular secretion and intracellular concentration), GLP-1 measurements were also conducted 48 h after nanoparticle treatment. In this case, after 2 h of exposure to NLC, the medium was replaced by complete DMEM with DPP-IV inhibitor, and the measurement of GLP-1 in the supernatants was carried out 48 h later as aforesaid. Table 1. Concentrations of the nanoparticle formulations and lipid components assayed within the GLP-1 secretion in GLUTag or NCI-H716 cells. Nanoparticle or Lipid component

Final concentration in culture medium

NLC

4 mg/mL

Liposomes

4 mg/mL

LNC

4 mg/mL

PLGA

4 mg/mL

Precirol

NA

Mygliol

10 µL/mL

C8

5.26 mM

C10

4.32 mM

C16

9 mM

C18

9 mM

1-OG

0.03 mM

2-OG

0.03 mM

8-MAG

0.05 mM

10-MAG

0.05 mM

1-PG

0.05 mM

2-PG

0.05 mM

16-DAG

4.5 mM

18-DAG

4.2 mM


6

Page 7 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Nanostructured lipid carriers (NLC), lipid nanocapsules (LNC), poly (lactide-co-glycolide) acid nanoparticles (PLGA), octanoic acid (C8), decanoic acid (C10), palmitic acid (C16), stearic acid (C18), 1-oleoylglycerol (1-OG), 2-oleoylglycerol (2-OG), 1-octanoyl-rac-glycerol (8MAG), 1-decanoyl-rac-glycerol (10-MAG), 1-palmitoylglycerol (1-PG), 2-palmitoylglycerol (2-PG), 1,2-dipalmitoyl-rac-glycerol (16DAG), 1,3-distearoylglycerol (18-DAG).

Mechanisms of nanoparticle-mediated GLP-1 secretion by GLUTag cells

Localization of nanoparticles within GLUTag cells The association of nanoparticles with GLUTag cells was studied both quantitatively and qualitatively. For the quantitative analysis, flow cytometry was used (BD FACSVerse, Becton Dickinson Biosciences, San Jose, CA, USA). GLUTag cells were seeded in Matrigel™-coated 24-well cell culture plates at a density of 1.8x105 cells/well and allowed to adhere for 24 h until confluence. As for the secretion studies, cells were co-incubated with 500 µL of DiD-loaded nanoparticles in suspension (4 mg/mL) in complete DMEM medium (5 µL per 100 µL of medium). After 2 h of incubation with fluorescent nanoparticles, cells were washed three times with PBS. Cells were then detached by trypsinization and centrifuged at 1,500 g. The supernatant was then removed and the cells were resuspended in PBS. Cell fluorescence was quantified by measuring the fluorescence of DiD. For each sample, 5,000 events were collected. The FlowJo (version 10) data analysis software package (TreeStar, USA) was used to analyze the data. For qualitative study, the confocal laser scanning microscopy (CLSM) was used, for which DiDloaded nanoparticles were employed. Cells were seeded into Matrigel™-coated cover slips and fixed in PFA 4%. After gentle wash with HBSS, actin was stained with 200 µL of Alexa Fluor 488 phalloidin (1:50) in HBSS for 2 h in the dark to reveal actin. Cell nuclei were stained with DAPI (1:20). Subsequently, the cover slips were washed in HBSS, cut and mounted with Mowiol® mounting medium on glass slides. Images were captured using a Zeiss™ confocal microscope (LSM 150). Data were analyzed with the Axio Vision software (version 4.8) to obtain y–z, x–z and x–y views of the cells.

GPCRs expression in GLUTag cells GLUTag cells (1.8 x 105 cells/well) were seeded into 24-well cell culture plates and allowed to adhere for 24 h. The day after, the cells were treated with NLC for 2 h. At the end of the incubation period, medium was removed and TriPure® reagent (Roche, Basel, Switzerland) was added to the wells to extract total RNA, according to the manufacturer’s instructions. cDNA was synthesized from 1 µg of total RNA using a reverse transcription kit (Promega, GoScript™ Reverse Transcription System). A StepOnePlus instrument and software (Applied Biosystems, Foster City, CA, USA) was used to perform qPCR. PCR reactions were run using a SYBR Green mix (Promega, GoTaq® qPCR Master Mix) as previously described.36 Briefly, the following conditions were used for amplification: an initial holding stage of 10 min at 95°C, then 45 cycles consisting of denaturation at 95°C for 3 s, annealing at 60°C for 26 s, and extension at 72°C for 10 s. Products were analyzed by performing a melting curve at the end of the PCR reaction. Data are normalized to the 60S ribosomal protein L19 (RPL19), used as a reference gene. RPL19 mRNA expression was not affected by incubation of the cells with NLC. Primer sequences used are given in Table 2. Table 2. Primer Sequences Gene Gpr119 Ffar4 Ffar1 Ffar3

Product GPR119 GPR120 GPR40 GPR41

Forward primer (5’ to 3’) TGCAGCTGCCTCTGTCCTCA TGCCGGGACTGGTCATTGT TGCTCTTCTTTCTGCCCTTGGT TTCTTGCAGCCACACTGCTC

Reverse primer (5’ to 3’) GCACAGGAGAGGGTCAGCAC ACTCGGATCTGGTGGCTCTC GCTTCCGTTTGTGGCTCAGG GCCCACCACATGGGACATAT


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Ffar2 Gpr84 Gcg Rpl19

GPR43 GPR84 PROGLUCAGON RPL19

GGGATCTGGGTCACATGCTTAT CTGGGAACCTCAGTCTCCATCA ATGAAGACCATTTACTTTG

ATGTCAGACAGACGGGTACCAA TCGATAGCCCAACACAGACTCA CGGTTCCTCTTGGTGTTCATCAAC

GAAGGTCAAAGGGAATGTGTTCA

CCTTGTCTGCCTTCAGCTTGT

Page 8 of 17

Statistical analysis The GraphPad Prism 5 program (CA, USA) was used to perform the statistical analyses. The Shapiro–Wilk normality test was used to assess the normal distribution. One-way ANOVA followed by Tukey’s post-hoc test was applied according to the result of the Bartlett’s test of homogeneity of variances. All other analyses were performed using a Student’s t-test or a Mann-Whitney test. Differences were considered statistically significant at *p

Secretion from Enteroendocrine L Cells ... - ACS Publications

Recommend Documents