Selective and Sensitive Probe Based in Oligonucleotide-Capped

Apr 25, 2019 - A robust, sensitive, and time-competitive system to detect Candida albicans in less than 30 min in clinical samples based in capped ...
0 downloads 0 Views 410KB Size
Download PDF
Subscriber access provided by UNIV AUTONOMA DE COAHUILA UADEC

Article

Selective and sensitive probe based in oligonucleotide-capped nanoporous alumina for the rapid screening of infection produced by Candida albicans Angela Ribes, Elena Aznar, Sara Santiago-Felipe, Elisabet Xifré-Pérez, María Ángeles Tormo-Mas, Javier Peman, Lluis F. Marsal, and Ramon Martinez-Manez ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.9b00169 • Publication Date (Web): 25 Apr 2019 Downloaded from http://pubs.acs.org on April 25, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Selective and sensitive probe based in oligonucleotide-capped nanoporous alumina for the rapid screening of infection produced by Candida albicans. Àngela Ribes†,⊥,∥, Elena Aznar⊥, †,∥ ,*, Sara Santiago-Felipe†,⊥,∥, Elisabet Xifre-Perez#, María Angeles Tormo-Más‡,*, Javier Pemán‡,§, Lluis F. Marsal#,* and Ramón Martínez-Máñez†,⊥,∥,* Instituto Interuniversitario de Investigación de Reconocimiento Molecular y Desarrollo Tecnológico, Universitat Politècnica de València, Universitat de València, Camino de Vera s/n, 46022, Valencia, Spain †

⊥

CIBER de Bioingeniería, Biomateriales y Nanomedicina (CIBER-BBN)

∥Unidad

Mixta de Investigación en Nanomedicina y Sensores. Universitat Politècnica de València, Instituto de Investigación Sanitaria La Fe, Valencia, Spain Departamento de Ingeniería Electrónica, Eléctrica y Automática, Universidad Rovira i Virgili, Avda. Països Catalans 26, 43007, Tarragona, Spain #

Grupo acreditado de investigación Infección Grave, IIS La Fe, Avenida Fernando Abril Martorell, 126, 46026 Valencia, Spain. ‡

Servicio de Microbiología, Hospital Politècnic i Universitari La Fe, Avenida Fernando Abril Martorell, 126, 46026,Valencia, Spain. §

KEYWORDS. Gated materials, Candida albicans, infection detection, oligonucleotides, nanoporous anodic alumina, rapid screening. ABSTRACT: A robust, sensitive and time-competitive system to detect Candida albicans in less than 30 min in clinical samples based in capped nanoporous anodic alumina (NAA) is developed. In the proposed design, NAA pores are loaded with rhodamine B and then blocked with an oligonucleotide able to recognize C. albicans DNA. The capped material shows negligible cargo release, whereas dye delivery is selectively accomplished when genomic DNA from C. albicans is present. This procedure has been successfully applied to detect C. albicans in clinical samples from patients infected with this yeast. When compared with classical C. albicans detection methods, the proposed probe has a short assay time, high sensitivity and selectivity, demonstrating the high potential of this simple design for the diagnosis of infection produced by C. albicans.

Invasive candidiasis (IC), with or without associated candidemia, is the most common invasive fungal disease which affects specially to developed countries. Approximately 95% of IC episodes are caused by Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata and Candida krusei.1 In the intensive care units, the most prevalent IC is the intra-abdominal presentation, including peritonitis and intra-abdominal abscesses.2 Intra-abdominal candidiasis occurs in approximately 40% of patients after gastrointestinal surgery, gastrointestinal perforation, or necrotizing pancreatitis, and it is associated with high mortality rates (45–60%).3

Early antifungal therapy is crucial on patients’ survival in IC. Species identification is a valuable tool to decide the appropriate targeted treatment based on prediction of the species-specific primary resistance and the variable antifungal susceptibility. Long delays associated with conventional methods for the detection and identification of organisms, force clinicians to empirically treat patients with unnecessary broadspectrum agents, which increase costs and adverse side effects, and potentially contributes to the emergence of antifungal resistances.4 In this scenario, it is crucial to identify the etiological agent due to the different treatments that should be followed for each case.5

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Regardless of its low sensitivity (50-75%) and long turnaround (19-75 hours), blood culture remains the most used technique for IC diagnosis. Alternative diagnosis techniques based on fungal biomarkers and metabolites detection and quantification, such as mannan antigen and anti-mannan antibodies, anti-gem tube antibodies or β-1,3-D-glucan, have been proven to outperform conventional techniques, but they are not accessible to all laboratories due their complexity in the clinical practice.6 In response to this situation, molecular techniques based on fungal DNA amplification assays are under development and could replace culture-based tests performed in the clinical laboratory in a near future. However, the clinical usefulness of PCR-based methodologies to detect Candida DNA has not been established due to the inconsistent performance, in terms of sensitivities and specificities, and lack of standardization of these techniques.7 As a consequence, it is essential the design of sensitive, easy-to-use and prompt new diagnostic tools for Candida to guide early antifungal therapy with the most appropriate antifungal drugs. A promising alternative to current technologies could be the design of smart devices evolving from nanoscale. In the last years, nanodevices have arisen as potential tools to develop ultra-rapid, sensitive and simple sensing systems for multiple target analytes.8 Specifically, gated materials have been broadly employed in new recognition and sensing platforms based on stimuli-responsive protocols.9 In these systems, a porous support is loaded with a reporter and pore outlets are decorated with functional molecules. This molecules block the pore entrances in the absence of the target analyte, whereas cargo delivery is triggered only when the target is present.10-12 Excellent candidates to cap the pores are oligonucleotides, which have demonstrated high degree of specificity in sensing applications.13-18,19-21 However, although oligonucleotidegated mesoporous supports have been used in sensing protocols of some analytes, as far as we know, there are not examples of their use for the detection of pathogens in real samples. Recently, nanoporous anodic alumina (NAA) has merged in nanotechnology as an alternative support with extraordinary features. NAA has found application in different fields such as energy, nanofabrication or biotechnology.22 Preparation of this scaffold is wellknown and does not represent significant complications. Moreover, it is cost-effective and easily up-scalable, what coupled to its high thermal stability contributes to the development of robust and reproducible sensing devices.23-25 Additionally NAA has demonstrated outstanding properties for the development of sensing materials such as large load capacity and the ability of being calcined and reused several times. Moreover, NAA can be easily modified thanks to reactive Al-OH groups present in its structure.26-29

Page 2 of 10

Taking into account these concepts, we have combined the use of NAA supports with oligonucleotides as gated ensembles to obtain a selective sensing system, which is able to diagnose infection caused by C. albicans. Beyond a proof of concept, this detection system has been tested in real samples of infected patients, providing fast results (less than 30 min) that agree with those obtained following standard clinical techniques, which take several days to obtain the same results.

EXPERIMENTAL SECTION General techniques, chemicals, organisms and growth conditions and DNA extraction protocol can be found in Supporting Information. Synthesis of nanoporous anodic alumina (NAA) films. To obtain porous alumina substrates, electrochemical anodization of aluminum sheets (high purity, 99.999% ) was performed. Sulfuric acid 0.3 M was employed as electrolyte. Before anodization, aluminum sheets were electropolished at 20 V for 4 min using ethanol and perchloric acid 4:1 (v:v) with the aim to reduce surface roughness. After this step, the material was cleaned thoroughly to remove any acid residue using water and ethanol. Then, electropolished sheets were dried with air. Samples were then anodized using H2SO4 as electrolyte and following a two-step anodization protocol. The procedure starts with a first anodization step conducted at 10 V during 24 h. This low applied voltage was selected in order to obtain small nanopores.30 Temperature of the electrolyte was settled in 2 °C. The resulting nanostructure is a layer of porous alumina with disordered pores. Dissolution of the porous alumina layer using wet chemical etching (70 °C for 3 h, in a mixture of phosphoric acid 0.4 M and chromic acid 0.2 M) yield a pre-patterned aluminum surface. The second anodization step was conducted using also conditions of the first step. An average pore diameter of 7.5 ± 1.7 nm was obtained. In this case, anodization time was adjusted to obtain a final nanoporous anodic alumina film of 8 µm thickness. Synthesis of solid S1. A circular piece of NAA was immersed in a solution of rhodamine B in CH3CN (18.6 mg, 0.04 mmol, 8 mL). To facilitate the loading process, the mixture was stirred for 24 h. Then support functionalization was performed by the addition of 328 µL of (3-isocyanatopropyl)triethoxysilane (1.32 mmol). The final mixture was allowed to stir during 6 h. To obtain the final functionalized support S1, the material was slightly washed with acetonitrile and allowed to dry for 2 h at 37°C. Synthesis of solid S2. Solid S1 was put in a Petri dish and covered with a solution of rhodamine B 1 mM in CH3CN (700 μL). In a subsequent step, 100 μL of

ACS Paragon Plus Environment

Page 3 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

oligonucleotide O1 (10 μM) were added. Also, 2 μL of TEA were included in the mixture as catalyst. The experiment was stirred during 3 h, washed with hybridization buffer dropwised onto the film and allowed to dry in a desiccator. Synthesis of solid S3. The functionalized material S2 was deposited in a Petri dish and covered with 1975 μL of hybridization buffer. Then 25 μL of O2 (100 μM) were added. After 2 h under stirring, the material was washed with hybridization buffer. Recognition assay protocol. To study the gating properties of the synthetized material S3, we studied the amount of rhodamine B which was able to diffuse to the solution. The experiment was performed with genomic DNA from C. albicans and without genomic DNA as control. For that, two independent S3 solids were immersed in 1980 μL of hybridization buffer. Commercial genomic DNA was dehybridized by exposing the DNA to 95 °C during 5 min and immediate cooling step in an ice bath (3 min). To perform the release experiment, 20 μL of dehybridized DNA solution (0.1 μg mL-1) was added to one portion of solid S3 whereas the other piece was completed with 20 μL of water. Both experiments were allowed to stir at 25 °C and at selected times, supernatant aliquots were analysed. Rhodamine B monitorization was performed by fluorescence (λexc = 555 nm, λem = 585 nm) to assess the diffusion of the reporter. Selectivity studies. In order to carry out selectivity studies, 8 portions of S3 were suspended with 100 μL of hybridization buffer each. Then, 7 portions were spiked until 10-3 μg mL-1 of extracted genomic DNA from C. albicans, C. glabrata, C. parapsilosis, Klebsiela pneumoniae, Staphylococus epidermidis, Staphylococcus aureus and Pseudomonas aeruginosa, respectively. Remaining portion was used as control. Volume of all experiments was completed to 1000 μL with hybridization buffer and stirred for 30 min at 25 °C. Finally, rhodamine B delivery was quantified by fluorescence (λexc = 555 nm, λem = 585 nm). Detection of C. albicans. The performance of solid S3 and its ability to detect C. albicans was also studied. C. albicans cells were growth at 37 °C in BHI agar medium. Then a 0.5 McFarland solution (105 CFU mL-1) was prepared in phosphate buffer saline (PBS). Two independent S3 supports were put in separated petri dishes and covered with 1980 μL of hybridization buffer each. In this experiment, 20 μL of the C. albicans aqueous solution were added to one of the samples, whereas the other was completed with 20 μL of water. All samples were stirred at 25 °C. Scheduled supernatant

aliquots were analyzed to monitor rhodamine B diffusion by fluorescence (λexc = 555 nm, λem = 585 nm). Quantification curve. The performance of solid S3 when exposed to different concentration C. albicans cells was studied. For that, C. albicans cells were growth at 37 °C in BHI agar medium. Then a 0.5 McFarland solution (105 CFU mL-1) was prepared and ten-fold dilutions were obtained. Ten supports of solid S3 were immersed in 100 μL of hybridization buffer. Then different dilution of C. albicans CFU were added to each sample. Then, the volume of the experiment was adjusted to 1000 μL using hybridization buffer. The microtubes were maintained under stirring for 30 min at 25ºC. Rhodamine B monitorization was performed by fluorescence (λexc = 555 nm, λem = 585 nm). Amplification assay. To study signal amplification, 2 supports of S3 were immersed in 990 μL of hybridization buffer. Genomic DNA from C. albicans (3.32 x 10-3 μg mL-1) was dehybridized as described previously. Then 10 µL of commercial genomic DNA were added to one support. The control experiment was completed only with 10 µL of water. Both samples were stirred at 25 °C for 30 min. Rhodamine B monitorization in the solution was performed by fluorescence (λexc = 555 nm, λem = 585 nm). Released rhodamine B amount was quantified using a calibration curve performed at the same time of the experiment. Then, rhodamine B was directly correlated with the amount of DNA used in the experiment. Assays in real competitive media. The performance of the sensory material S3 was tested in different organic body fluids (i.e cerebrospinal fluid, plasma and peritoneal fluid). For that, C. albicans cells were growth at 37 °C in BHI agar medium. Two independent S3 samples were deposited in a Petri dish and covered with 500 μL of the corresponding medium. To one of them 20 μL of a 103 CFU mL-1 C. albicans aqueous solution were added, whereas the volume of the control was completed with 20 μL of water. Final experiment volume was adjusted by adding 1480 µL of hybridization buffer. All experiments were allowed to stir at 25 °C and at selected times, supernatant aliquots were analysed. Rhodamine B monitorization was performed by fluorescence (λexc = 555 nm, λem = 585 nm). Clinical samples characterization. For microbiological diagnosis, blood cultures were processed using an automated BacT/ALERT® VIRTUOTM system (bioMerieux). Any isolate corresponding to Candida spp in sterile sample was considered as significative. Identification of all Candida isolates was performed by biochemical and phenotypic features and using proteomic profiling technology. In

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

particular, biochemical analysis was performed using an API ID20C (bioMérieux) and an AuxaColorTM 2 (BioRad-Laboratories). The proteomic profiles were evaluated using VITEK MS (bioMérieux). Assays with clinical samples. S3 was immersed in 700 μL of hybridization buffer and 300 μL of a sample from a non-infected patient (confirmed by microbiologic culture) was added. In the same way, other sample of solid S3 was immersed in 700 μL of hybridization buffer and, in this case, 300 μL of a sample from an infected patient (confirmed by microbiologic culture) were added. As a secondary control, other S3 portion was immersed in 1000 μL of hybridization buffer. Each experiment was allowed to stir for 30 min at 25 °C. Rhodamine B monitorization was carried out by fluorescence (λexc = 555 nm, λem = 585 nm). All determinations were carried out by triplicate.

Page 4 of 10

FESEM images of S3 confirmed that the nanoporous structure was preserved in the final device (see Figure S1B). Content of organic matter in the prepared materials was analyzed by thermogravimetry to complete the characterization study. Organic content was 0.26, 0.36 and 0.47 % wt. for solid S1, S2 and S3, respectively. 95º, 5 min

S3 5‘-TTTTGGGGGGTTGAGAAG (O2) GATCTTTCCATTGATGGGGGGGTTTT-3’

Ethical commite. The present study was approved by the Ethics Committees of Hospital Universitario y Politécnico La Fe (2016/0433) and Universitat Politècnica de València (P2_21_01_2017).

O O Si O

RESULTS AND DISCUSSION

O N H

N H

5'-AAA AAA CCC CCC-3' (O1)

Candida albicans genomic DNA

Design, synthesis and characterization of the functional nanodevice. Combination of NAA with gating mechanisms can pave the way to obtain potent probes for the detection of C. albicans. In our work, the NAA support was obtained following reported procedures.31,32 To prepare the sensing material, rhodamine B dye was loaded in the pores of NAA support and then, the organic linker (3isocyanatopropyl)triethoxysilane was anchored to the external surface of the material to yield support S1. Subsequently, oligonucleotide O1 (NH2-(CH2)6-5’AAAAAACCCCCC-3’) was anchored to S1 by means of urea bonds giving S2. In a final step, oligonucleotide O2 (5’ TTTTGGGGGGTTGAGAAGGATCTTTCCATGATGGGG GGGTTTT-3’) containing the sequence 5’TTGAGAAGGATCTTTCCATTGATG-3’ which corresponds to the coding region of the integrin-like alpha Int1p protein (alpha INT1) from C. albicans,33,34 was hybridized with the attached sequence O1, yielding the final sensing gated material (S3) (Scheme 1). In solid S3 the hybridization of O2 with the genomic DNA from C. albicans, is expected to trigger pore opening allowing the selective delivery of the entrapped rhodamine B dye. Intermediate solids S1 and S2 and the C. albicans DNA- sensitive solid (S3) were carefully characterized by field emission scanning electron microscopy (FESEM) and thermogravimetric analysis. Representative FESEM images of S1 showed the presence of disordered pores. From representative images, an average pore diameter of 7.5 ± 1.7 nm was estimated (See Supporting Information). Representative

Rhodamine B

Scheme 1. Representation of the prepared functional nanodevice S3. NAA acts as porous support and a single-stranded oligonucleotide (O2) as capping structure. Rhodamine B delivery is selectively triggered when genomic DNA from C. albicans is present. Controlled delivery studies. Detection of C. albicans using probe S3 is based on the uncapping of the gated support that results in selective rhodamine B release in the presence of C. albicans DNA. This mechanism differs substantially from that used in classic “binding site–signaling subunit” probes. In sensing gated materials, the signaling process (release of a dye) is disconnected from the host–guest interaction that occurs at the surface of the material. This sensing protocol can be the basis for the preparation of new powerful sensing systems with features far from classical signaling probes for instance in terms of signal amplification (vide infra). The response of S3 to C. albicans DNA was first studied employing genomic DNA of this yeast. To perform this experiment, two pieces of the gated materials S3 were immersed in hybridization buffer. Then, 20 μL of a previously dehybridized genomic DNA of C. albicans solution was added (final C. albicans DNA concentration of 1x10-3 μg mL-1) to one of the pieces, while 20 μL of an aqueous buffered solution was added to the other. At selected times, fractions of the supernatant solution were taken and studied by fluorescence to quantify the amount of rhodamine B in the aqueous phase. As depicted in Figure 1 (curve a), rhodamine B release in the absence of C. albicans DNA was negligible, indicating that reporter

ACS Paragon Plus Environment

Page 5 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

diffusion from NAA support is impeded. In contrast, when DNA of C. albicans was added to the solution (curve b), rhodamine B freely diffuses from pores of S3 to the solution. After 30 min, approximately a delivery of 90% of the total rhodamine B released was observed. The particular performance of S3 was attributed to the specific hybridyzation of O2 with C. albicans DNA and the consequent displacement of oligonucleotide O2 from the material surface as depicted in Scheme 1.

b)

In vitro studies. In a further step we also explored the possible use of S3 for C. albicans detection in samples inoculated with C. albicans. For this purpose, a piece of S3 was deposited in a Petri dish, covered with hybridization buffer inoculated with C. albicans to reach a final concentration of 103 CFU mL-1. Another S3 piece was maintained in hybridization buffer as control. Following a similar procedure as before, supernatant fractions were obtained at scheduled times and the amount of rhodamine B measured. These experiments were carried out without any cell lysis pretreatment of the yeast culture. Figure 3 clearly shows that S3 remained tightly capped in buffer, yet a clear payload delivery wass found when C. albicans is present. b)

a)

Figure 1. Solid S3 performance in TRIS buffer at pH 7.5. (a) When genomic C. albicans DNA is absent and (b) when C. albicans DNA (1x10-3 μg mL-1) is present. To study the selectivity of the prepared gated material, the performance of solid S3 was studied in the presence of genomic DNA of C. albicans, C. glabrata, C. parapsilosis, S. epidermidis, S. aureus, K. pneumoniae, and P. aeruginosa at concentrations of 10-3 μg mL-1 (Figure 2). As can be appreciated in the figure, diffusion of the reporter from solid S3 was only triggered by genomic DNA of C. albicans, whereas other species induced negligible cargo delivery.

a)

Figure 3. Solid S3 performance in TRIS buffer at pH 7.5. (a) When C. albicans yeast is absent and (b) when C. albicans (103 CFU mL-1) is present. This observation might be explained taking into account that part of the DNA of C. albicans can be released to the extracellular medium. In fact, it has been described that genomic DNA of C. albicans can be found in clinical samples, such as plasma, in high concentrations. The absence of a pre-treatment (i.e. cell lysis) makes the procedure especially simple. Following a similar approach, the response of the new gated solid S3 as a function of the amount of C. albicans cells was also studied (Figure 4). As depicted in Figure 4, rhodamine B release can be correlated with the different C. albicans CFU added, which is in agreement with the hypothesized protocol that involves the displacement of O2 in the presence of genomic DNA of C. albicans.

Figure 2. Solid S3 response in TRIS buffer at pH 7.5 to different target genomic DNAs (C. albicans, C. parapsilosis, C. glabrata, S. epidermidis, Staphylococcus aureus, Klebsiela pneumonia, and Pseudomonas aeruginosa (10-3 μg mL-1))

In these experimental conditions, a lineal response in the 7-2x102 CFU mL-1 concentration range was observed. Moreover, the limit of detection (LOD) of solid S3 was determined as 8 CFU mL-1. This low LOD is similar to the most innovative commercially available detection systems for Candida in the market such as the T2Candida panel in the T2Dx instrument (LOD = 1 CFU

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

mL-1) fromT2 Biosystems (Lexington, Massachusetts) based in PCR and T2 magnetic resonance detection.

Figure 4. Solid S3 performance in TRIS buffer at pH 7.5 as a function of C. albicans concentration. Having similar LODs, our system is easier, significantly faster (ca. 30 min) compared to the ca. 3-5 hours of the T2Dx instrument. Additionally, in our system the amplified element is the signal not the analyte (vide infra), which is a significative advance in the development of sensing systems for DNA detection. The inherent signal amplification of gated materials when used as sensing systems is clearly an advantage which may potentially increase the sensitivity of the system. As stated before, the recognition protocol (hybridization of O2 with genomic DNA) is a mechanism separated from the signalling event (rhodamine B diffusion from the pores to the solution). This fact implies that the recognition protocol is independent of a stoichiometric relation and therefore the event of O2 hybridization with genomic DNA may be accompanied by the delivery of a large amount of reporter molecules. In our particular case, and for a concentration of genomic DNA of 3.32 x 10-5 μg mL-1, it was found that the number of released reporter molecules is ca. 80,000 higher than the number of DNA molecules, which indicates a relevant signal amplification of the recognition event. The estimation clearly shows the advantage of this gated material that does not need of pre-amplification procedures such as enzymatic signalling methods or PCR technology, to obtain a substantial signal. Validation in a real environment. To give a step forward to the application of the designed system in a real environment, the ability of the sensory material S3 for C. albicans detection in more competitive media was tested. The ability of solid S3 to deliver rhodamine B fluorophore in the presence of C. albicans at

Page 6 of 10

concentration of 10 CFU mL-1 was studied in typical sterile fluids where Candida can be found such as cerebrospinal fluid (CSF), plasma and peritoneal fluid. As depicted in Figure S4, S3 is able to detect C. albicans in these media; a low cargo release (less than ca. 1020%) in the absence of the yeast was found, whereas a marked delivery (ca. 90%) was observed when the fluids were spiked with 10 CFU mL-1 of C. albicans. These results agree with those obtained in buffered solutions. Encouraged by these results, we were interested in the validation of solid S3 as a possible alternative to the current method for C. albicans detection in clinical samples. Despite its low sensitivity (50-75%), blood culture remains as the gold standard method to diagnose candidemia. Time to positivization of blood cultures varies between different species of Candida from 19 to 75 hours with a mean time of growth of 37.6 hours (data from 258 candidemia episodes at Hospital Universitari i Politècnic La Fe). Once the blood culture is positive, it takes about 15 minutes to learn whether the causing agent of the blood stream infection is yeast with a Gram stain. Additionally, final identification with traditional methods such as AuxaColorTM 2 (Bio-Rad, Marnes-la-Coquette France), Vitek® 2 YST ID card (bioMérieux, Marcy l’Etoile, France) or CHROMagarTM Candida (CHROMagar, Paris, France) takes around 2448 hours. Some novel strategies to shorten this diagnostic period include Peptide Nucleic Acid Fluorescent In-situ Hybrydization (PNA-FISH) that can obtain results from positive blood cultures in 90 minutes; direct MALDI-TOF MS which is able to give results in 30 minutes from the blood culture bottle; multiplex acid nucleic testing like Filmarray platform, which is a high-order multiplex PCR analysis considered as a closed diagnostic system that allows an automated readout of results in one hour from positive blood cultures or after a 12 hours incubation. In our case, for the detection of C. albicans, standard blood culture was performed in a first step to analyze the presence of C. albicans in 18 clinical samples of infected and non infected patients from Hospital Universitari i Politècnic La Fe. For microbiological diagnosis, clinical samples were processed by blood culture using an automated system. C. albicans isolates were identified by biochemical and phenotypic features, and also by proteomic profiling technology. In parallel, the same 18 samples were also analyzed using S3. To test each sample, a piece of S3 was immersed in 700 μL of hybridization buffer and then 300 μL of the target sample (CSF, plasma or peritoneal fluid) was added. A control experiment with S3 immersed in the same volume of hybridization buffer and containing 300 μL of a non-infected fluid (non infected CSF, plasma or peritoneal fluid) was also performed. After 30 minutes at 25 °C, rhodamine B release was measured by fluorescence. Samples were considered positives when the fluorescence intensity at 585 nm was at least 3-fold higher than the fluorescence intensity of the control. As

ACS Paragon Plus Environment

Page 7 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

an example, Figure 5 shows the response (i.e. rhodamine B delivered) obtained for S3 when in contact with a selected sample of CSF infected with C. albicans (positive sample) and non infected (negative sample). Peritoneal fluid

9

-

-

10

+

+

11

+

+

12

+

+

13

-

-

14

-

-

15

-

-

16

+

+

17

+

+

18

+

+

a Samples were considered positives (+) when any C. albicans colony is isolated in body fluids culture. b Samples were considered positives (+) when the fluorescence intensity at 585 nm was at least 3-fold higher than that of the control.

Figure 5. Detection of C. albicans in cerebrospinal fluid samples. Release of rhodamine B from the nanoporous alumina gated material S3 in the presence of cerebrospinal fluid infected with C. albicans (positive sample) and non infected (negative sample). The assay was performed in triplicate. Moreover, Table 1 shows a comparison between the results obtained for the 18 samples using traditional blood culture procedures and S3. In all cases, a complete coincidence was found between the hospital reference method and our procedure using gated mesoporous alumina, revealing the accurate response of solid S3 to detect C. albicans in highly competitive real samples. While blood culture protocols have a typical assay time of ca. 2 to 6 days, the results using S3 can be obtained in ca. 30 min. Table 1. Results of real samples analyzed by the reference and the proposed method (mycological culture and S3 assay, respectively). Type of Sample

# Sample

Reference method (mycological culture)a

Cerebrospinal fluid

Blood

Gated material (S3)b

1

-

-

2

-

-

3

-

-

4

+

+

5

+

+

6

+

+

7

-

-

8

-

-

In literature, other sensory systems based on molecularly imprinted polymers,35 to (1→3)-β-D-glucans aptamers,36 or human-safe bacteria-specific virus37 were described to detect the infection by Candida yeast. However, most of these systems need several hours to detect the pathogen and are not validated with human clinical samples. In contrast, solid S3 has demonstrated its applicability to detect C. albicans infection in clinical samples of different types (CSF, blood and peritoneal fluid) in 30 min, which confers to it great advantage in the development of future accurate, easy-to-use, rapid and low-cost systems to detect the infection produced by C. albicans.

CONCLUSIONS New strategies for C. albicans rapid and sensitive detection are truly desired to improve the treatment and survival in invasive candidiasis infections. We report herein a new sensory system based on the use of a nanoporous film loaded with a reporter (rhodamine B) and capped with a specific oligonucleotide, and its use for the detection of C. albicans in real clinical samples in ca. 30 min from infected patients without previous culture growth or the use of PCR amplification techniques. The oligonucleotide used as cap is a sequence of the coding region of the integrin-like alpha Int1p protein from C. albicans. In the presence of DNA of C. albicans a recognition event takes place and subsequently a displacement of the capping oligonucleotide occurs, inducing the diffusion of the reporter to the solution. Besides S3 shows a selective behavior to C. albicans and is unable to respond to the presence of C. parapsilosis, C. glabrata, S. epidermidis, S. aureus, K. pneumoniae, and P. aeruginosa. Using this simple protocol, the material showed a limit of detection of 8 CFU mL-1. This LOD is very similar to other commercially state-of-the-art available detection systems for Candida. However, showing similar LODs, our system is easier, considerably faster (ca. 30 min

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

compared to ca. 12 hours for PCR-based methods or to ca. 37.6 hours for blood culture), cost-effective and has the advantage that it is not the analyte but the signal that is amplified. Additionally, the sensory material S3 allows an accurate and effective detection of C. albicans in different real samples from infected patients. This suggests that the use of gated materials having specific biochemical recognition caps coupled with a simple delivery of an indicator, is a suitable strategy for the easy and prompt detection of genetic material of pathogens in real samples. The proposed technique is simple, can be easily adjusted to different monitorization techniques and different pathogens and may open up the way for the development of easy-touse simple tests with high potential applicability in clinical samples.

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Details on experimental data, materials characterization by FESEM and release experiments in different biofluids (PDF)

AUTHOR INFORMATION Corresponding Author * [email protected] * [email protected] * [email protected] * [email protected]

Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

ACKNOWLEDGMENT We thank Spanish Government (projects MAT2015-64139-C41-R and TEC2015-71324-R (MINECO/FEDER)), Generalitat Valenciana (project PROMETEO/2018/024), Generalitat de Catalunya (2017 SGR 1527), ICREA Academia, Universitat Politècnica de València – Instituto de Investigación Sanitaria La Fe (CANDIGATE project) and ISCIII-CIBER-BBN (CANDIEYE project) for support. A.R. thanks UPV for her predoctoral fellowship. S.S. thanks the Instituto de Salud Carlos III and the European Social Fund for the financial support “Sara Borrell” (CD16/000237).

REFERENCES 1. Pemán, J.; Salavert, M.; Quindós, G. Invasive fungal disease by Candida and other yeasts. Rev. Iberoam. Micol. 2016, 33 (3), 131-132. 2. Bodey, G.P. Candidiasis: pathogenesis, diagnosis, and treatment, 2nd Ed. Raven Press, New York (USA), 1993.

Page 8 of 10

3. Carneiro, H.A.; Mavrakis, A.; Mylonakis, E. Candida peritonitis: an update on the latest research and treatments. World J. Surg. 2011, 35 (12), 2650-2659. 4. Bacconi, A.; Richmond, G.S:; Baroldi, M.A.; Laffler, T.G.; Blyn, L.B.; Carolan, H.E.; Frinder, M.R.; Toleno, D.M.; Metzgar, D.; Gutierrez, J.R.; Massire, C. Improved sensitivity for molecular detection of bacterial and Candida infections in blood. J. Clin. Microbiol. 2014, 52 (9), 3164-3174. 5. Guinea, J.; Zaragozá, O.; Escribano, P.; Martín–Mazuelos, E.; Pemán, J.; Sánchez–Reus, F.; Cuenca–Estrella, M. Molecular identification and antifungal susceptibility of yeast isolates causing fungemia collected in a population-based study in Spain in 2010 and 2011. Antimicrob. Agents Chemother. 2014, 58 (3), 1529-1537. 6. Cuenca–Estrella, M.; Verweij, P.E.; Arendrup, M.C.; Arikan– Akdagli, S.; Bille, J.; Donnelly, J.P.; Jensen, H.E.; Lass–Flörl, C; Richardson, M. D.; Akova, M.; Bassetti, M.; Calandra, T.; Castagnola, E.; Cornely, O.A.; Garbino, J.; Groll, A. H.; Herbrecht, R.; Hope, W. W.; Kullberg, B.J.; Lortholary, O.; Meersseman, W.; Petrikkos, G.; Roilides, E.; Viscoli, C.; Ullmann, A. ESCMID guideline for the diagnosis and management of Candida diseases 2012: non-neutropenic adult patients. J. Clin. Microbiol. Infect. 2012, 18, 19-37. 7. Prattes, J.; Heldt, S.; Eigl, S.; Hoenigl, M. Point of care testing for the diagnosis of fungal infections: are we there yet? Curr. Fungal Infect. Rep. 2016, 10 (2), 43-50. 8. Willner, I.; Shlyahovsky, B.; Zayats, M.; Willner, B. DNAzymes for sensing, nanobiotechnology and logic gate applications. Chem. Soc. Rev. 2008, 37 (6), 1153-1165. 9. Sancenón, F.; Pascual, L.; Oroval, M.; Aznar, E.; MartínezMáñez, R. Gated silica mesoporous materials in sensing applications. Chemistry Open 2015, 4 (4), 418-437. 10. Aznar, E.; Oroval, M.; Pascual, L.; Murguía, J.R.; MartínezMáñez, R. Sancenón, F. Gated materials for on-command release of guest molecules. Chem. Rev. 2016, 116 (2), 561-718. 11. E. Bringas, E.; Köysüren, Ö.; Quach, D.V.; Mahmoudi, M.; Aznar, E.; Roehling, J.D.; Marcos, M.D.; Martínez-Máñez, R.; Stroeve, P. Triggered release in lipid bilayer-capped mesoporous silica nanoparticles containing SPION using an alternating magnetic field. Chem. Commun. 2012, 48 (45), 5647-5649. 12. a) Zhang, Z.; Yuan, Q.; Chen, T.; Zhang, X.; Chen, Y.; Tan, W. DNA-capped mesoporous silica nanoparticles as an ionresponsive release system to determine the presence of mercury in aqueous solutions. Anal Chem. 2012, 84 (4), 1956-1962; b) Wang, Y.; Jiang, L.; Chu, L.; Liu, W.; Wu, S.; Wu, Y.; He, X.; Wang, K. Electrochemical detection of glutathione by using thymine-rich DNA-gated switch functionalized mesoporous silica nanoparticles. Biosens. Bioelect. 2017, 87, 459–465; c) Tan, S.Y.; Teh, C.; Ang, C.Y.; Li, M.; Li, P.; Korzh, V.; Zhao, Y. Responsive mesoporous silica nanoparticles for sensing of hydrogen peroxide and simultaneous treatment toward heart failure. Nanoscale 2017, 9 (6), 2253-2261; d) Chen, N.T.; Souris, J.S. Cheng, S.H.; Chu, C.H.; Wang, Y.C.; Konda, V.; Dougherty, U.; Bissonnette, M.; Mou, C.Y.; Chen, C.T.; Lo, L.W. Lectinfunctionalized mesoporous silica nanoparticles for endoscopic detection of premalignant colonic lesions. Nanomedicine: NBM 2017, 13 (6), 1941-1952. 13. Bayramoglu, G.; Ozalp, V.C.; Dincbal, U.; Arica, M.Y. Fast and Sensitive Detection of Salmonella in Milk Samples Using Aptamer-Functionalized Magnetic Silica Solid Phase and MCM41-Aptamer Gate System. ACS Biomater. Sci. Eng. 2018, 4 (4), 1437-1444. 14. Dehghani, S.; Danesh, N.M.; Ramezani, M.; Alibolandi, M.; Lavaee,P.; Nejabat, M.; Abnous, K.; Taghdisi, S.M. A label-free fluorescent aptasensor for detection of kanamycin based on

ACS Paragon Plus Environment

Page 9 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

dsDNA-capped mesoporous silica nanoparticles and Rhodamine B. Anal. Chim. Acta 2018, 1030, 142-147. 15. He, X.; Zhao, Y.; He, D.; Wang, K.; Xu, F.; Tang, J. ATPresponsive controlled release system using aptamerfunctionalized mesoporous silica nanoparticles. Langmuir 2012, 28 (35), 12909-12915. 16. a) Ribes, À.; Xifré-Perez. E.; Aznar, E.; Sancenón, F.; Pardo, T.; Marsal, L.F.; Martínez-Máñez, R. Molecular gated nanoporous anodic alumina for the detection of cocaine. Sci. Rep. 2016, 6, 38649-38658. b) Ribes, À.; Aznar, E.; Bernardos, A.; Marcos, M.D.; Amorós, P.; Sancenón, F.; Martínez-Máñez, R. Fluorogenic Sensing of Carcinogenic Bisphenol A using Aptamer-Capped Mesoporous Silica Nanoparticles. Chem. Eur. J. 2017, 23 (36), 8581-8584. 17. Ribes. À.; Santiago-Felipe, S.; Bernardos, A.; Marcos, M.D.; Pardo, T.; Sancenón, F.; Martínez-Máñez, R.; Aznar, E. Two New Fluorogenic Aptasensors Based on Capped Mesoporous Silica Nanoparticles to Detect Ochratoxin A. ChemistryOpen 2017, 6 (5), 653-659. 18. Wang, S.; Liu, F.; Li, X.L. Monitoring of “on-demand” drug release using dual tumor marker mediated DNA-capped versatile mesoporous silica nanoparticles. Chem. Comm. 2017, 53 (62), 8755-8758. 19. Climent, E.; Mondragón, L.; Martínez-Máñez, R.; Sancenón, F.; Marcos, M.D.; Murguia, J.R.; Amorós, P.; Rurack, K.; Pérez-Payá, E. Selective, highly sensitive, and rapid detection of genomic DNA by using gated materials: Mycoplasma detection. Angew. Chem. Int. Ed. 2013, 52 (34), 8938-8942. 20. Pascual, Ll.; Baroja, I.; Aznar, E.; Sancenón, F.; Marcos, M.D.; Murguia, J.R.; Amoros, P.; Rurack, K.; Martínez-Máñez, R. Oligonucleotide-capped mesoporous silica nanoparticles as DNA-responsive dye delivery systems for genomic DNA detection. Chem. Comm. 2015, 51 (8), 1414-1416. 21. a) Rajeev, G.; Prieto Simon, B.; Marsal, L.F. Voelcker, N.H. Advances in Nanoporous Anodic Alumina-Based Biosensors to Detect Biomarkers of Clinical Significance: A Review. Materials 2018, 7 (5), 1700904; b) Xifre-Perez, E.; Guaita-Esteruelas, S.; Baranowska, M.; Pallares, J.; Masana, L.; Marsal, L.F. In vitro biocompatibility of surface-modified porous alumina particles for HepG2 tumor cells: toward early diagnosis and targeted treatment. ACS Appl. Mater. Interfaces 2015, 7 (33), 18600-18608. 22. Pla, L.; Xifre-Pérez, E.; Ribes, À.; Aznar, E.; Marcos, M.D.; Marsal, L.F.; Martínez-Máñez, R.; Sancenón, F. A mycoplasma genomic DNA probe using gated nanoporous anodic alumina. ChemPlusChem 2017, 82 (3), 337-341. 23. Chen, Y.; Santos, A.; Wang, W.; Wang, C.; Losic, D. Biomimetic nanoporous anodic alumina distributed Bragg reflectors in the form of films and microsized particles for sensing applications. ACS Appl. Mater. Interfaces 2015, 7 (35), 19816-19824. 24. Kumeria, T.; Santos, A.; Rahman, M.M.; Ferré-Borrull, J.; Marsal, L.F.; Losic, D. Advanced structural engineering of nanoporous photonic structures: Tailoring nanopore architecture to enhance sensing properties. ACS Photonics 2014, 1 (12), 1298-1306. 25. De la Escosura-Muñiz, A.; Merkoçi, A. Nanochannels preparation and application in biosensing. ACS Nano 2012, 6 (9), 7556-7583. 26. Kumeria, T.; Rahman, M.; Santos, A.; Ferré-Borrull, J.; Marsal, L.F.; Losic, D. Nanoporous anodic alumina rugate filters for sensing of ionic mercury: Toward environmental point-ofanalysis systems. Appl. Mater. Interfaces 2014, 6 (15), 12971-12978. 27. Santos, A.; Kumeria, T.; Losic, D. Nanoporous anodic alumina: a versatile platform for optical biosensors. Materials 2014, 7 (6), 4297-4320.

28. Urteaga, R.; Berli, C.L.; In Nanoporous Alumina. Fabrication, Structure, Properties and Applications; 1st Ed. Springer International Publishing 2015, 249-269. 29. Gong, D.; Yadavalli, V.; Paulose, M.; Pishko, M.; Grimes, C.A. Controlled molecular release using nanoporous alumina capsules. Biomed. Microdevices 2003, 5 (1), 75-80. 30. Sulka, G.R. Highly Ordered Anodic Porous Alumina Formation by Self-Organized Anodizing in Nanostructured Materials in Electrochemistry. Eftekhari, WILEY-VCH Verlag GmbH & Co. KGaA: Weinheim, 2008; pp 1- 116. 31. Baranowska, M.; Slota, A.J.; Eravuchira, P.J.; Macias, G. Xifré-Pérez, E.; Pallarès, J. Ferré-Borrull, J.; Marsal, L.F. Protein attachment to nanoporous anodic alumina for biotechnological applications: influence of pore size, protein size and functionalization path. Colloids. Surf. B Biointerfaces 2014, 122, 375-383. 32. Lim, Y.H.; Lee, D.H. Human infection with an avian H9N2 influenza A virus in Hong Kong in 2003. J. Microbiol. 2005, 43 (11), 5760-5767. 33. Gale, C.; Finkel, D.; Tao, N.; Meinke, M.; McClellan, M.; Olson, J.; Kendrick, K.; Hostetter, M. Cloning and expression of a gene encoding an integrin-like protein in Candida albicans. Proc. Natl. Acad. Sci. 1996, 93 (1), 357-361. 34. Kasai, M.; Francesconi, A.; Petraitiene, R.; Petraitis, V.; Kelaher, A.M.; Kim, H.; J. Meletiadis, J.; Sein, T.; Bacher, J.; Walsh, T.J. Use of quantitative real-time PCR to study the kinetics of extracellular DNA released from Candida albicans, with implications for diagnosis of invasive candidiasis. J. Clin. Microbiol. 2006, 44 (1), 143-150. 35. Dabrowski, M.; Sharma, P.S.; Iskierko, Z.; Noworyta, K.; Cieplak, M.; Lisowski, W.; Oborska, S.; Kuhn, A.; Kutner, W. Early diagnosis of fungal infections using piezomicrogravimetric and electric chemosensors based on polymers molecularly imprinted with D-arabitol. Biosens. Bioelectron. 2016, 79, 627– 635. 36. Tang, X.L.; Hua, Y.; Guan, Q.; Yuan, C.H. Improved detection of deeply invasive candidiasis with DNA aptamers specific binding to (1→3)-β-D-glucans from Candida albicans. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 35, 587–595. 37. Wang, Y.; Ju, Z.; Cao, B.; Gao, X.; Zhu, Y., Qiu, P.; Xu, H.; Pan, P.; Bao, H.; Wang, L.; Mao, C. Ultrasensitive Rapid Detection of Human Serum Antibody Biomarkers by BiomarkerCapturing Viral Nanofibers. ACSNano, 2015, 9(4), 4475–4483.

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For TOC only

ACS Paragon Plus Environment

Page 10 of 10