Selenium-Enriched Probiotics Improve Antioxidant Status, Immune

May 9, 2014 - Selenium-Enriched Probiotics Improve Antioxidant Status, Immune Function, and .... AMB Express 2018 8 (1), ..... American Chemical Socie...
0 downloads 0 Views 600KB Size
Download PDF
Article pubs.acs.org/JAFC

Selenium-Enriched Probiotics Improve Antioxidant Status, Immune Function, and Selenoprotein Gene Expression of Piglets Raised under High Ambient Temperature Fang Gan,† Xingxiang Chen,† Shengfa F. Liao,‡ Chenhui Lv,† Fei Ren,† Gengping Ye,† Cuiling Pan,† Da Huang,† Jun Shi,† Xiuli Shi,† Hong Zhou,† and Kehe Huang*,† †

Institute of Nutritional and Metabolic Disorders in Domestic Animals and Fowls, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China ‡ Department of Animal and Dairy Sciences, Mississippi State University, Mississippi State, Mississippi 39762-9815, United States S Supporting Information *

ABSTRACT: This research was conducted to evaluate the effects of selenium-enriched probiotics (SP) on growth performance, antioxidant status, immune function, and selenoprotein gene expression of piglets under natural high ambient temperature in summer. Forty-eight crossbred weanling piglets randomly allocated to four groups were fed for 42 days ad libitum a basal diet without (Con, 0.16 mg Se/kg) and with supplementation of probiotics (P, 0.16 mg Se/kg), sodium selenite (SS, 0.46 mg Se/kg), and SP (0.46 mg Se/kg). From each group, three piglets were randomly selected for blood collection on days 0, 14, 28, and 42 and tissue collection on day 42. The SP improved growth performance of piglets. Both SS and SP increased blood glutathione peroxidase activity and tissue thioredoxin reductase 1 mRNA expression, with SP being higher than SS. All P, SS, and SP supplementation increased the superoxide dismutase activity (40.1, 53.0, and 64.5%), glutathione content (84.6, 104, and 165%), TCR-induced T lymphocyte proliferation (20.8, 26.4, and 50.0%), and IL-2 concentration (24.9, 27.2, and 46.2%) and decreased malondialdehyde content (25.1, 26.3, and 49.3%), respectively. The greatest effects of SP supplementation suggest that SP may serve as a better feed additive than P or SS for piglets under high-temperature environments. KEYWORDS: selenium-enriched probiotics, antioxidant status, immune function, high-temperature environment, piglet

■

further into selenoproteins,9 of which some function as antioxidant enzymes with selenocysteine in the catalytic centers.10 Selenoproteins such as glutathione peroxidase 1 (GPx1), GPx4, and thioredoxin reductase 1 (TR1) are thought to play important roles in animal antioxidant status and immune responses via the altered physiological Se status.11 Dietary Se supplementation has been reported to increase the GPX and SOD activities, decrease MDA levels,12 improve immunocompetence13 of broilers under heat stress, and enhance GPx1 and TR1 selenoprotein gene expression in livers of young pigs.14 A better effect of organic Se than inorganic Se has been reported in improving animal growth performance, as well as antioxidant and immune functions.15−17 However, little research has been conducted to explore the effects of Se on the antioxidant status, immune function, and selenoprotein gene expression of young piglets under high ambient temperature. Probiotics (P) are nonpathogenic microorganisms that can resist host small intestinal digestion and reach the colon alive, where they perform beneficial effects for the health of the host animals.18 Previous studies of probiotic lactobacillus bacteria and yeasts have demonstrated that either Lactobacillus acidophilus or Saccharomyces cerevisiae has strong effects on animal

INTRODUCTION High ambient temperature, which can cause heat stress to pigs, especially during the summer in southern China, is a major detrimental factor that negatively affects pig health and production performance.1 The global warming climate change as recently claimed may exacerbate this situation. A major health problem caused by heat stress in pigs is the reduction in their antioxidant capacity and immunity,2 which could result in enormous economic losses to the swine industry.3 It is known that the activities of glutathione peroxidase (GPX) and superoxide dismutase (SOD) and the content of glutathione (GSH) represent the competence of animal antioxidant status because these proteins participate in the clearing of superoxide anion free radicals in cells to protect cells from being injured.4 The malondialdehyde (MDA) content manifests the level of lipid peroxidation and indirectly represents the level of cell or tissue damage.4 T lymphocyte proliferation and interleukin 2 (IL-2) secretion play important roles in animal immune function.5 IL-2, a cytokine secreted by activated T lymphocytes, is an essential factor for the growth, proliferation, and differentiation of regulatory T cells.6 As an essential trace element nutrient for mammalian animals, selenium (Se) plays a key role in redox regulation, antioxidant defense, and immune function through GPX enzymes that catalyze the removal of the excess potentially damaging radicals produced during stress situation.7,8 The biological effects of Se are mainly exerted through its incorporation into selenocysteine (a special amino acid) and © 2014 American Chemical Society

Received: Revised: Accepted: Published: 4502

March 31, 2013 May 1, 2014 May 2, 2014 May 9, 2014 dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508

Journal of Agricultural and Food Chemistry

Article

the pig shed (with natural ventilation) ranged from 25 to 38 °C, and during the last 9 days, the daytime temperature ranged from 31 to 40 °C. All of the diets for the piglets were replenished daily, and fresh water was accessible at all times throughout the trial. Each pig was weighed at the beginning and the end of the feeding trial. Feed intake was recorded daily. Average daily gain (ADG), average daily feed intake (ADFI), and feed/gain (F/G) ratio were calculated for each group and each pig. All experimental protocols were approved by the Committee for the Care and Use of Experimental Animals of Nanjing Agriculture University, and the Animal Ethical Number granted was SYXK (Su) 2011-0036. Sample Collection and Preparation. From each of four treatment groups three piglets were randomly selected for blood sample collection at 2:00 to 4:00 p.m. on days 0, 14, 28, and 42 from the precaval vein. From each piglet approximately 5 mL of blood was collected in a syringe primed with EDTA, and another 5 mL of blood was collected in a syringe without EDTA. Both blood samples with and without EDTA were gently ejected into 10 mL Eppendorf tubes, respectively. Approximately 2 mL of EDTA-primed blood samples was directly stored at −20 °C until analysis of GPX activity. To prepare erythrocyte lysates, 1 mL EDTA-primed whole blood samples were centrifuged at 700g for 10 min, and the resulting red blood cells were washed three times with physiological saline, resuspended in 4 mL of ice-cold distilled water, shaken vigorously to force hemolysis, and then centrifuged at 700g for 10 min. The resulting supernatant was the erythrocyte lysate sample required and stored at −20 °C until analysis of GSH content. To obtain serum samples, 5 mL of whole blood sample (without EDTA) was kept in a slanting position at 37 °C for 2 h and then at 4 °C overnight, followed by centrifugation at 700g for 15 min. The resulting supernatant was the serum sample required and stored at −20 °C until analysis of SOD activity, MDA content, and IL-2 concentration. At the end of the experiment (on day 42), three piglets from each of the four treatment groups were randomly selected and euthanized. Half of the spleen from each pig was harvested and stored at 37 °C until isolation of primary porcine splenocytes for analysis T lymphocyte proliferation. One-fourth of each liver, kidney, and spleen tissue was rapidly excised and rinsed with ice-cold isotonic saline, then snap-frozen in liquid nitrogen, and stored at −70 °C until analysis of GPx1, GPx4, and TR1 mRNA expression. Analysis of GPX and SOD Activities and GSH and MDA Contents. The GPX activity in whole blood, the GSH content in erythrocyte, the SOD activity, and MDA contents in serum were respectively determined using the commercial kits in accordance with the manufacturers’ instructions. GPX activity, SOD activity, and GSH and MDA contents were expressed as U/L, U/mL, μmol/g protein, and nmol/mL, respectively. TCR-Induced T Lymphocyte Proliferation Assay. The lymphocytes of peripheral blood and spleen were collected by using a commercial Lymphocyte Separation Medium (Tianjin Hematology Institute). The T lymphocyte proliferation induced by T-cell receptor (TCR) was analyzed using a WST-8 Cell Counting Kit-8 (Beyotime) according to the manufacturer’s instructions as previously described by Zhang and Sun.26 Briefly, 5.0 × 105 cells suspended in RPMI-1640 medium (100 μL) containing 10% fatal bovine serum were seeded in 96-well plates and treated in the absence (control) or presence of 2 μg/mL stimulatory anti-pig-CD3 mAb (clone PPT3; Abcam). After incubation for 44 h, CCK-8 solution (10 μL) was added to each well, and the cells were incubated at 37 °C for 4 h with 5% CO2. At the end, the cells in each well were measured by Vis spectrophotometer at 450 nm. Determination of IL-2 Concentrations in Serum. The IL-2 concentrations in the serum samples were measured by using a commercial porcine IL-2 enzyme-linked immunosorbent assay (ELISA) kit in accordance with the manufacturer’s protocol (YuanYe

antioxidant status and immunity and can inhibit lipid peroxidation in pigs under normal conditions.19,20 Likewise, a previous study in poultry also indicated that probiotics can reduce the adverse effects of heat stress.21 However, similar studies have scarcely been conducted in pigs under high ambient temperature. To combine the beneficial effects of both Se and probiotics, we have newly developed a feed additive product called Seenriched probiotics (SP) in our laboratory (Chinese patent no. ZL 2005 1 0040990.2).21 The probiotic L. acidophilus and S. cerevisiae strains we used are very efficient in transforming inorganic Se to organic Se.22,23 Previous studies have demonstrated that dietary SP supplementation has beneficial effects on inhibiting heat shock protein (hsp) mRNA expression in piglets24 and improving blood lipid profile in mice.25 The objective of this study was to investigate the potential effects of SP on the growth performance, antioxidant status, immune function, and selenoprotein gene expression of piglets raised under a high-temperature environment.

■

MATERIALS AND METHODS

Chemicals. The antioxidant assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Both the WST-8 Cell Counting Kit-8 and the total protein assay kit were purchased from Biyuntian Institute (Nanjing, China). Lymphocyte Separation Medium was purchased from Tianjin Hematology Institute, Chinese Academy of Medical Sciences (Tianjin, China). The interleukin-2 (IL-2) assay kit was obtained from YuanYe Biotechnology Co., Ltd. (Shanghai, China). The inorganic sodium selenite (SS) used in this study was purchased from Sigma (Shanghai, China). The stock solution of sodium selenite as a Se standard [GBW(E) 080215] and the certified Se reference material, pork liver (GBW 08551), were provided by the National Research Center for Standard Materials (Beijing, China) and the Institute of Food Examination of the Ministry of Commerce (Beijing, China), respectively. Reagents used for realtime PCR were purchased from TaKaRa (Dalian, China). All reagents for the Se assay were of analytical grade. P, SS, and SP Products. Both P and SP products used were obtained from our own laboratory in Nanjing Agricultural University (Jiangsu, China) and contain two probiotic strains, L. acidophilus and S. cerevisiae. The colony-forming units (CFU) of L. acidophilus and S. cerevisiae strains in both products were approximately 1011 and 109 CFU/mL, respectively. The total Se content in SS stock solution was 100 mg/L. The total Se content in SP was 10.0 mg/L, with >90% being organic Se and >75% being selenomethionine (Se-Met).23 Experimental Design and Animal Trial. According to a completely randomized experimental design, 48 crossbred [(Landrace × Yorkshire) × Duroc] weanling barrows (4 weeks old, body weight = 7.9 ± 0.5 kg) were randomly divided into four groups of 12 in each. Piglets in each group were further allotted into three feeding pens (as three replicates) with four piglets in each pen or replicate. All piglets received a basal diet that contained 0.16 mg Se/kg for 2 weeks prior to the feeding trial. The ingredient composition of the basal diet has been previously reported.24 Piglets of the four treatment groups were fed the basal diet without or with supplementation of P, SS, or SP product. The SP product provided 0.3 mg total Se/kg diet, and so did the SS product. The final calculated total Se concentration in either the SS- or the SPsupplemented diet was 0.46 mg/kg. The P product provided L. acidophilus and S. cerevisiae to the diet at doses equivalent to that provided by the SP product with the total cell counts of L. acidophilus and S. cerevisiae being 3 × 1011 and 3 × 109 CFU/kg, respectively. The animal feeding trial lasted for a total of 6 weeks (42 days, from June 19 to July 30, 2011) and was conducted at Bangcheng Swine Farm located in Xinghua (32°93′ N latitude and 119°82′ E longitude), Jiangsu, China. During the first 33 days, the daytime temperature in 4503

dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508

Journal of Agricultural and Food Chemistry

Article

The ΔΔCt values were converted to fold differences by raising 2 to the power of −ΔΔCt (i.e., 2−ΔΔCt). Statistical Analysis. Data were analyzed by the one-way ANOVA model followed by Duncan’s multiple-range tests to separate the means using the SPSS computer program for Windows (version 17.0). Data for each treatment group are presented as means ± SE, and the statistical significance was set at P < 0.05.

Biotechnology Co., Ltd.). The concentration units were expressed as pg/mL. Determination of Selenoprotein mRNA Expression. Real-time quantitative PCR method was employed for selenoprotein mRNA detection. The PCR primers (Table 1) for two selenoprotein genes

■

Table 1. Primers Used for Real-Time Quantitative PCR gene

accession no.a

primer sequence (5′−3′)

RESULTS Animal Growth Performance. The initial body weight (BW) and final BW, ADG, ADFI, and F/G in different groups of pigs are shown in Table 2. As expected, there was no difference in initial BW among the four treatment groups. Among the Con, P, and SS treatment groups, there were no differences in all of the growth performance parameters including ADFI, ADG, final BW, and F/G. Although there was no difference in ADFI when the SP group was compared with the other three groups, the SP group had higher (P < 0.05) final BW and ADG and lower (P < 0.05) F/G. GPX Activity of Whole Blood. The GPX activities of whole blood from the four treatment groups are shown in Table 3. As expected, on day 0 there was no difference in GPX

product (bp)

β-actin

DQ845171.1

forward: CTGCGGCATCCACGAAACT reverse: AGGGCCGTGATCTCCTTCTG

147

GPx4

NM_214407.1

forward: GATTCTGGCCTTCCCTTGC reverse: TCCCCTTGGGCTGGACTTT

183

TR1

NM_214 154

forward: CCCTGGTGACAAAGAGTA reverse: GTCCTGGTCAAATCCTCT

184

a

For retrieving the corresponding cDNA or gene sequences from the GenBank database (http://www.ncbi.nlm.nih.gov).

Table 3. GPX Activity of Whole Blood of Pigletsa GPX activity (U/L) group

(GPx4 and TR1) and one reference gene (β-actin) were designed using Primer Premier Software (PREMIER Biosoft International, Palo Alto, CA, USA) on the basis of the known porcine sequences reported in the NCBI database (http://www.ncbi.nlm.nih.gov). Total RNA was isolated from the frozen tissue samples using the RNAiso Plus (TaKaRa) reagent according to the manufacturer’s protocol. The isolated RNA pellets were resuspended in 30 μL of diethyl pyrocarbonate-treated water, quantified by measurement of the absorbance ratio at 260/280 nm, and then stored at −70 °C prior to cDNA synthesis. First-strand cDNA was synthesized from 1 μg of total RNA using Oligo dT primers and M-MLV reverse transcriptase (TaKaRa) according to the manufacturer’ instructions. Real-time PCR was performed on an ABI PRISM 7300 detection system (Applied Biosystems, USA). Reactions were performed in a 25 μL reaction mixture containing 12.5 μL of 2× SYBR Green I PCR Master Mix (TaKaRa), 10 μL of cDNA, 1 μL of each primer (10 μM), and 0.5 μL of PCR-grade water. The PCR procedure consisted of a 95 °C step for 30 s followed by 40 cycles consisting of 95 °C for 5 s and 60 °C for 31 s. A dissociation curve was run for each plate to confirm the production of a single product. A nontemplate reaction served as the negative control. The relative levels of selenoprotein mRNA were determined using the Δ cycle threshold (ΔCt) method with β-actin serving as a reference gene. For each of the target selenoprotein genes, the ΔΔCt values of all the samples were calculated by subtracting the average ΔCt of the Con group from the average ΔCt of the P, SS, or SP group.

Con P SS SP

day 0 117 114 115 116

± ± ± ±

day 14

3.22a 4.47a 4.09a 4.97a

112 117 147 182

± ± ± ±

2.36a 3.89a 3.09b 2.68c

day 28 109 121 155 188

± ± ± ±

day 42

5.43a 3.22a 4.73b 4.64c

111 121 163 192

± ± ± ±

4.72a 2.68a 5.58b 3.57c

a

The GPX activities in whole blood (U/L) of piglets fed the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a column means followed by different letters are significantly different (P < 0.05).

activities among the four treatment groups. On days 14, 28, and 42, the GPX activities in the P group were not higher than that in the Con group, but significant increases (P < 0.05) were observed in the SS and SP groups when compared to the P or Con group. Furthermore, the SP group was even higher (P < 0.05) than the SS group in GPX activities by approximately 23.8, 21.3, and 17.8% on days 14, 28, and 42, respectively. GSH Content of Erythrocytes. The erythrocyte GSH contents in the four treatment groups are shown in Table 4. As expected, on day 0 there was no difference in GSH contents among the four groups. Although there were no differences

Table 2. Growth Performance of Pigletsa group initial BW (kg) final BW (kg) ADG (g/day) ADFI (g/day) F/G

Con

P

SS

SP

7.46 ± 0.29a 20.96 ± 0.79a 321 ± 25a 770 ± 51a 2.40 ± 0.03a

8.04 ± 0.15a 21.83 ± 0.61a 328 ± 12a 786 ± 36a 2.39 ± 0.08a

7.96 ± 0.23a 21.79 ± 0.65a 329 ± 10a 794 ± 38a 2.41 ± 0.11a

8.00 ± 0.22a 24.25 ± 0.83b 387 ± 17b 807 ± 41a 2.09 ± 0.12b

a

Growth performance of piglets fed the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a column means followed by different letters are significantly different (P < 0.05). 4504

dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508

Journal of Agricultural and Food Chemistry

Article

Table 4. GSH Content of Erythrocytes of Pigletsa

Table 6. MDA Content in Serum of Pigletsa

GSH content (μmol/g protein) group Con P SS SP

day 0 17.4 16.0 18.4 17.3

± ± ± ±

1.93a 2.30a 1.90a 2.06a

day 14 18.5 31.3 33.5 44.9

± ± ± ±

day 28

1.95a 2.05b 1.59b 1.97c

20.2 39.1 43.6 56.6

± ± ± ±

1.85a 2.30b 2.75b 2.10c

MDA content (nmol/mL) day 42

group

± ± ± ±

Con P SS SP

21.2 40.5 45.4 57.9

1.97a 2.55b 1.92b 2.14c

a The GSH contents in erythrocytes (μmol/g protein) of piglets fed the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a column means followed by different letters are significantly different (P < 0.05).

day 0 2.59 2.69 2.54 2.64

± ± ± ±

day 14

0.17a 0.10a 0.13a 0.09a

4.12 3.02 2.97 1.97

± ± ± ±

0.21a 0.22b 0.17b 0.19c

day 28 4.14 3.11 3.06 2.09

± ± ± ±

day 42

0.13a 0.18b 0.15b 0.24c

4.24 3.23 3.18 2.28

± ± ± ±

0.10a 0.17b 0.18b 0.13c

a

The MDA contents in serum (nmol/mL) of piglets fed with the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a column means followed by different letters are significantly different (P < 0.05).

between the SS and P groups, either the SS or P group was higher (P < 0.05) than the Con group on days 14, 28, and 42. Furthermore, the SP group was even higher (P < 0.05) than the SS or the P group in erythrocyte GSH contents by approximately 38.5, 36.7, and 34.7% on days 14, 28, and 42, respectively. SOD Activity of Serum. The SOD activities of serum from the four treatment groups are shown in Table 5. As expected, on day 0, there were no differences in SOD activities among the four treatment groups. Although there were no differences between the SS and P groups and between the SP and SS groups, either the P or SS group was higher (P < 0.05) than the Con group in SOD activities on days 14, 28, and 42. Furthermore, the SP group was even higher (P < 0.05) than the P group by approximately 18.3, 19.7, and 14.5% on days 14, 28, and 42, respectively. MDA Content of Serum. The MDA contents of serum from four treatment groups are shown in Table 6. As expected, on day 0, there was no difference in MDA contents among the four groups. Although there were no differences between the SS and P groups, either the SS or P group was lower (P < 0.05) than the Con group on days 14, 28, and 42. Furthermore, the SP group was even lower (P < 0.05) than the SS or P group by approximately 34.3, 32.4, and 29.0% on days 14, 28, and 42, respectively. TCR-Induced T Lmphocyte Proliferation. The TCRinduced T lymphocyte proliferation in the peripheral blood lymphocytes and the splenocytes collected from the four treatment groups on day 42 postfeeding are shown in Figure 1. When compared to the Con group, significant promotions (P < 0.05) were observed in the TCR-induced T lymphocyte proliferations in both tissues in the P, SS, and SP groups. Although there was no difference in promoting T lymphocyte proliferation between the P and SS groups in both tissues, a

Figure 1. TCR-induced T lymphocyte proliferation in the peripheral blood lymphocytes (A) and splenocytes (B) of piglets fed the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a panel bars labeled with different letters differ (P < 0.05).

significant promotion (P < 0.05) was observed in the SP group when compared to the P or SS group in either tissue. In the peripheral blood lymphocytes (Figure 1A), the magnitudes of promotion were 25.0 and 19.6% for the P and SS groups, respectively. In the splenocytes (Figure 1B), the magnitudes of promotion were 23.3 and 17.8% for the P and SS groups, respectively. IL-2 Concentration in Serum. The IL-2 concentrations in serum from four treatment groups are shown in Table 7. As expected, on day 0, there were no differences in IL-2 concentrations among the four groups. Although there were no differences between the SS and P groups, either the SS or P group was higher (P < 0.05) than the Con group on days 14− 42. Furthermore, the SP group was even higher (P < 0.05) than

Table 5. SOD Activity in Serum of Pigletsa SOD activity (U/mL) group Con P SS SP

day 0 106 108 107 106

± ± ± ±

4.61a 5.03a 3.66a 3.52a

day 14 96.3 131 143 155

± ± ± ±

4.44a 6.27b 3.96bc 3.56c

day 28 105 142 155 170

± ± ± ±

2.54a 5.71b 5.63bc 3.22c

day 42 102 152 166 174

± ± ± ±

4.24a 5.89b 3.38bc 3.26c

a

The SOD activities in serum (U/mL) of piglets fed with the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a column means followed by different letters are significantly different (P < 0.05). 4505

dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508

Journal of Agricultural and Food Chemistry

Article

Table 7. IL-2 Concentration in Serum of Pigletsa

sheep.13,29,30 It has been reported that probiotics can also relieve the adverse effects in poultry such as decreased growth performance and immune response under heat stress.21 Another SP product, also developed in our laboratory, was reported to have additive beneficial effect of P and Se in terms of hens’ egg-laying performance.22 However, there is very limited knowledge concerning the effects of SP on piglets exposed to high-temperature environments. Previous studies found no difference in ADG, ADFI, and F/ G between control pigs and the pigs fed extra probiotics or inorganic Se at 0.3 mg/kg diet, whereas decreased F/G was observed with the pigs fed organic Se at 0.3 mg/kg diet.31,32 Consistent with those data obtained from normal temperature conditions, the P or SS supplementation did not affect final BW, ADG, ADFI, and F/G in the current study under hightemperature condition; however, SP supplementation improved final BW and ADG and decreased F/G of these piglets. This discrepancy is not easily explained. One may hypothesize that the improved growth performance resulting from SP supplementation is due to the organic Se in the SP product because organic Se could affect thyroid hormone (TH) secretion, which directly or indirectly leads to a decreased F/ G. Although TH was not determined in this study, it was reported that thyroxine (T4) and tri-iodothyronine (T3) could be responsible for anabolic metabolism of nutrients in lambs, with T3 being the most active form, and the Se-dependent enzyme, type I deiodinase, is needed when T4 is deiodinated to the active T3.33 Supplemental Se caused a decrease in T4 and an increase in T3, and organic Se may be superior to inorganic Se in facilitating the T4 to T3 conversion through the action of selenoenzyme,15 because sodium selenite had no effects on T3, T4, and T4/T3 ratio.34 The present study of piglets raised under high ambient temperature showed that dietary P supplementation increased GSH content and SOD activity and decreased MDA content, which is consistent with previous results on pigs raised under normal temperature conditions.35,36 Besides these GSH, SOD, and MDA parameters, dietary SS and SP supplementation additionally increased GPX activity. Although the mechanism of probiotics on increasing GSH content and SOD activity is still unclear, the reduced MDA content may be associated with the increased GSH content and SOD activity and is further evidence of the role of probiotics (L. acidophilus) in improving the function of swine antioxidant defense system.35 The effects of SS on GPX and SOD activities and GSH and MDA contents

IL-2 concentration (pg/mL) group Con P SS SP

day 0 102 103 97.2 100

± ± ± ±

4.28a 3.54a 2.93a 3.52a

day 14 99.3 122 124 139

± ± ± ±

3.23a 2.47b 3.73b 3.54c

day 28 100 126 128 147

± ± ± ±

2.85a 3.61b 3.17b 3.07c

day 42 101 127 130 153

± ± ± ±

3.33a 2.47b 3.06b 3.73c

a

The IL-2 concentrations in serum (pg/mL) of piglets fed with the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a column means followed by different letters are significantly different (P < 0.05).

the SS or P group in serum IL-2 concentrations by approximately 13.0, 15.7, and 19.5% on days 14, 28, and 42, respectively. GPx4 mRNA Expression. The expression levels of GPx4 mRNA in liver, kidney, and spleen tissues from four treatment groups on day 42 postfeeding are shown in Figure S1 (see the Supporting Information). Although some numerical increases in the GPx4 mRNA expression levels can be seen for the SS and SP groups in all three tissues, there were no statistically significant increases found in these tissues. TR1 mRNA Expression. The expression levels of TR1 mRNA in liver, kidney, and spleen tissues collected from four different treatment groups on day 42 postfeeding are shown in Figure 2. There were no differences in terms of TR1 mRNA expression levels between the P and Con groups in any of the three tissues. However, significant increases (P < 0.05) of TR1 mRNA expression were observed for the SS and SP groups in all three tissues. When compared to the SS group, the SP group showed further increases (P < 0.05) in TR1 mRNA expression by 51.4, 23.5, and 27.5% in liver, kidney, and spleen tissues, respectively.

■

DISCUSSION Earlier studies demonstrated that high-temperature environments could decrease egg production and compromise the immune function of poultry, pigs, and dairy calves,3,27,28 and supplementation of vitamin E, vitamin C, amino acids, or Se can reduce the negative effects such as immune and physiological responses of high temperature on poultry and

Figure 2. TR1 mRNA expression in the liver (A), kidney (B), and spleen (C) from the piglets fed with the normal basal diet (Con group), the basal diet supplemented with probiotics (P group), the basal diet supplemented with sodium selenite (SS group), and the basal diet supplemented with selenium-enriched probiotics (SP group). Data presented are means ± SE (n = 3). Within a panel bars labeled with different letters differ (P < 0.05). 4506

dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508

Journal of Agricultural and Food Chemistry

Article

probiotics and Se in these beneficial effects, and (ii) the more robust antioxidant effects of the SP product may be due to the organic Se it contained relative to the inorganic Se contained in the SS.

in pigs raised under high-temperature conditions have not been reported until this study. It is known that the GPX activity in which Se plays a crucial role is strongly associated with animal antioxidant status,10 as previous studies indicated that Se can elevate the antioxidant status of pigs under normal temperature conditions.36 That the SP supplementation further increased GPX and SOD activities and GSH content and reduced MDA content in this study strongly suggests that the SP used has more robust beneficial effects in terms of improving animal antioxidant status than P or SS alone. Our previous study also demonstrated that SP could improve murine blood lipid profile of mice and that the beneficial effects of SP are more robust than that of P or SS used alone.25 The effects of Se on promoting T lymphocyte proliferation and increasing IL-2 concentration in pigs raised under a hightemperature condition have not been reported either until this study. The data obtained from this study showed that dietary supplementation of P, SS, or SP promoted TCR-induced T lymphocyte proliferation in both blood and spleen and increased serum IL-2 concentrations, which are consistent with some previous studies under normal temperature conditions.9,37 Although the mechanism is not very clear, these positive effects were thought to be due to the effects of Se on increasing Ca2+ flux38 and involving cellular free thiols.39 Furthermore, this study also showed that the effects of SP supplementation in increasing lymphocyte number and IL-2 secretion were more dramatic than that of P or SS supplementation alone, suggesting that SP is more effective in boosting pig immune function than P or SS used alone. The reason may be because there was a synergistic effect of Se and P in T lymphocyte proliferation and IL-2 secretion. It was reported that a probiotics of L. acidophilus increased lymphocyte number and IL-2 secretion in pigs raised under normal temperature conditions.40,41 The results of this study showed that TR1, but not GPx4, mRNA expressions were up-regulated by dietary supplementations of SS or SP for piglets. The mechanism of Se regulation on the expression of selenoprotein mRNA is not very clear. However, it is known that this is due to neither the transcriptional regulation nor the mRNA processing and exports from the nucleus.42 On the other hand, it has been suggested that the explanation of Se affecting mRNA expression is that selenoprotein transcripts are affected via nonsensemediated mRNA decay mechanism.43 This study found that SP supplementation has a more dramatic effect in up-regulation of TR1 mRNA expressions than SS supplementation, which may be due to the better bioavailability of the organic Se in the SP product than that of the inorganic Se in the SS product.43 That the GPx4 mRNA expression was not affected by dietary SS or SP supplementation, as found in this study, is also consistent with previous research results.14 But why the GPx4 mRNA expression is not sensitive to dietary Se supplementation is unknown. In summary, the present study indicated that dietary supplementation of SP improved animal growth performance, antioxidant status, immune function, and some selenoprotein mRNA expression in piglets raised under high ambient temperature, suggesting that this SP product is a feasible dietary supplementation for piglets during hot seasons. The more robust beneficial effects of the SP product than the P or SS product used alone may be explained by two possible reasons: (i) there is an additivity or a synergistic effect between

■

ASSOCIATED CONTENT

* Supporting Information S

Figure S1. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*(K.H.) College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, China. Phone: +86-25-84395507. Fax: +86-25-84398669. E-mail: khhuang@ njau.edu.cn. Funding

This work was supported by the National Natural Science Foundation of China (30871892 and 31272627), the Research Fund for Doctoral Program of Higher Education in China (20110097110014 and 20120097130002), the Special Fund for Agro-scientific Research in the Public Interest of China (201003011), the Priority Academic Program Development of Jiangsu Higher Education Institutions (Jiangsu, China), and the research fund from the Mississippi Agricultural and Forestry Experiment Station (027000901200; approved for publication as Journal Article 12355; Mississippi State University, USA). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Lucas, E.; Randall, J.; Meneses, J. Potential for evaporative cooling during heat stress periods in pig production in Portugal (Alentejo). J. Agric. Eng. Res. 2000, 76, 363−371. (2) Ju, X. H.; Yong, Y. H.; Xu, H. J.; An, L. L.; Xu, Y. M. Impacts of heat stress on baseline immune measures and a subset of T cells in Bama miniature pigs. Livest. Sci. 2011, 135, 289−292. (3) Yu, J.; Yin, P.; Liu, F.; Cheng, G.; Guo, K.; Lu, A.; Zhu, X.; Luan, W.; Xu, J. Effect of heat stress on the porcine small intestine: a morphological and gene expression study. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 2010, 156, 119−128. (4) Su, Li.; Wang, M.; Yin, S. T.; Wang, H. L.; Chen, Liang.; Sun, L. G.; Ruan, D. Y. The interaction of selenium and mercury in the accumulations and oxidative stress of rat tissues. Ecotox. Environ. Saf. 2008, 70, 483−489. (5) Grimble, R. F. Modification of inflammatory aspects of immune function by nutrients. Nutr. Res. (N.Y.) 1998, 18, 1297−1317. (6) Kim, H. P.; Imbert, J.; Leonard, W. J. Both integrated and differential regulation of components of the IL-2/IL-2 receptor system. Cytokine Growth Factor Rev. 2006, 17, 349−366. (7) Danesi, F.; Malaguti, M.; Nunzio, M. D.; Maranesi, M.; Biagi, P. L.; Bordoni, A. Counteraction of adriamycin-induced oxidative damage in rat heart by selenium dietary supplementation. J. Agric. Food Chem. 2006, 54, 1203−1208. (8) Maggini, S.; Wintergerst, E. S.; Beveridge, S.; Hornig, D. H. Selected vitamins and trace elements support immune function by strengthening epithelial barriers and cellular and humoral immune responses. Br. J. Nutr. 2007, 98, 29−35. (9) Hoffmann, F. K. W.; Hashimoto, A. C.; Shafer, L. A.; Dow, S.; Berry, M. J.; Hoffmann, P. R. Dietary selenium modulates activation and differentiation of CD4+ T cells in mice through a mechanism involving cellular free thiols. J. Nutr. 2010, 140, 1155−1161. (10) Rotruck, J. T.; Pope, A. L.; Ganther, H. E.; Swanson, A. B.; Hafeman, D. G.; Hoekstra, W. G. Selenium: biochemical role as a component of glutathione peroxidase. Science 1973, 179, 588−590.

4507

dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508

Journal of Agricultural and Food Chemistry

Article

(11) Banerjee, S.; Yang, S.; Foster, C. B. A luciferase reporter assay to investigate the differential selenium-dependent stability of selenoprotein mRNAs. J. Nutr. Biochem. 2011, 23, 1294−1301. (12) Ghazi, H. S.; Habibiyan, M.; Moeini, M. M.; Abdolmohammadi, A. R. Effects of dietary selenium, vitamin E, and their combination on growth, serum metabolites, and antioxidant defense system in skeletal muscle of broilers under heat stress. Biol. Trace Elem. Res. 2012, 148, 322−330. (13) Niu, Z.; Liu, F.; Yan, Q.; Li, L. Effects of different levels of selenium on growth performance and immunocompetence of broilers under heat stress. Arch. Anim. Nutr. 2009, 63, 56−65. (14) Zhou, J. C.; Zhao, H.; Li, J. G.; Xia, X. J.; Wang, K. N.; Zhang, Y. J.; Liu, Y.; Zhao, Y.; Lei, X. G. Selenoprotein gene expression in thyroid and pituitary of young pigs is not affected by dietary selenium deficiency or excess. J. Nutr. 2009, 139, 1061−1066. (15) Zhan, X. A.; Qie, Y. Z.; Wang, M.; Li, X.; Zhao, R. Q. Selenomethionine: an effective selenium source for sow to improve Se distribution, antioxidant status, and growth performance of pig offspring. Biol. Trace Elem. Res. 2011, 142, 481−491. (16) Jiang, Z. Y.; Lin, Y. C.; Zhou, G. L.; Luo, L. H.; Jiang, S. Q.; Chen, F. Effects of dietary selenomethionine supplementation on growth performance, meat quality and antioxidant property in yellow broilers. J. Agric. Food Chem. 2009, 57, 9769−9772. (17) Montgomery, J. B.; Wichtel, J. J.; Wichtel, M. G.; McNiven, M. A.; McClure, J. T.; Markham, F.; Horohov, D. W. Effects of selenium source on measures of selenium status and immune function in horses. Can. J. Vet. Res. 2012, 76, 281−291. (18) Musa, H. H.; Wu, S. L.; Zhu, C. H.; Seri, H. I.; Zhu, G. Q. The potential benefits of probiotics in animal production and health. J. Anim. Vet. Adv. 2009, 8, 313−321. (19) Zhang, W.; Azevedo, M. S. P.; Wen, K.; Gonzalez, A.; Saif, L. J.; Li, G. H.; Yousefc, A. E.; Yuan, L. J. Probiotic Lactobacillus acidophilus enhances the immunogenicity of an oral rotavirus vaccine in gnotobiotic pigs. Vaccine 2008, 26, 3655−3661. (20) Lessard, M.; Dupuis, M.; Gagnon, N.; Nadeau, É.; Matte, J. J.; Goulet, J.; Fairbrother, J. M. Administration of Pediococcus acidilactici or Saccharomyces cerevisiae boulardii modulates development of porcine mucosal immunity and reduces intestinal bacterial translocation after Escherichia coli challenge. J. Anim. Sci. 2009, 87, 922−934. (21) Zulkifli, I.; Abdullah, N.; Mohd, N.; Ho, Y. Growth performance and immune response of two commercial broiler strains fed diets containing Lactobacillus cultures and oxytetracycline under heat stress conditions. Br. Poult. Sci. 2000, 41, 593−597. (22) Pan, C.; Zhao, Y.; Liao, S. F.; Chen, F.; Qin, S.; Wu, X.; Zhou, H.; Huang, K. Effect of selenium-enriched probiotics on laying performance, egg quality, egg selenium content, and egg glutathione peroxidase activity. J. Agric. Food Chem. 2011, 59, 11424−11431. (23) Gao, J.; Huang, K.; Qin, S. Determination of selenomethionine in selenium-enriched yeast by gas chromatography-mass spectrometry [in Chinese]. Se Pu 2006, 24, 235−238. (24) Gan, F.; Ren, F.; Chen, X.; Lv, C.; Pan, C.; Ye, G.; Shi, J.; Shi, X.; Zhou, H.; Shituleni, S. A.; Huang, K. Effects of selenium-enriched probiotics on heat shock protein mRNA levels in piglet under heat stress conditions. J. Agric. Food Chem. 2013, 61, 2385−2391. (25) Ibrahim, H. A. M.; Zhu, Y. X.; Wu, C.; Lu, C. H.; Ezekwe, M. O.; Liao, S. F.; Haung, K. H. Selenium-enriched probiotics improves murine male fertility compromised by high fat diet. Biol. Trace Elem. Res. 2012, 147, 251−260. (26) Zhang, H. Y.; Sun, H. Up-regulation of Foxp3 inhibits cell proliferation, migration and invasion in epithelial ovarian cancer. Cancer Lett. 2010, 287, 91−97. (27) Yoshida, N.; Fujita, M.; Nakahara, M.; Kuwahara, T.; Kawakami, S. I.; Bungo, T. Effect of high environmental temperature on egg production, serum lipoproteins and follicle steroid hormones in laying hens. J. Poult. Sci. 2011, 48, 207−211. (28) Tao, S.; Monteiro, A. P.; Thompson, I. M.; Hayen, M. J.; Dahl, G. E. Effect of late-gestation maternal heat stress on growth and immune function of dairy calves. J. Dairy. Sci. 2012, 95, 7128−7136.

(29) Niu, Z. Y.; Liu, F. Z.; Yan, Q. L.; Li, W. C. Effects of different levels of vitamin E on growth performance and immune responses of broilers under heat stress. Poult. Sci. 2009, 88, 2101−2107. (30) Alhidary, I.; Shini, S.; Al, J. R.; Gaughan, J. Effect of various doses of injected selenium on performance and physiological responses of sheep to heat load. J. Anim. Sci. 2012, 90, 2988−2994. (31) Lähteinen, T.; Lindholm, A.; Rinttilä, T.; Junnikkala, S.; Kant, R.; Pietilä, T. E.; Levonen, K.; Ossowski, I.; Solano, A. G.; Jakava, V. M. Effect of Lactobacillus brevis ATCC 8287 as a feeding supplement on the performance and immune function of piglets. Vet. Immunol. Immunopathol. 2014, 158, 14−25. (32) Speight, S. M.; Estienne, M. J.; Harper, A. F.; Barb, C. R.; Pringle, T. D. Effects of organic selenium supplementation on growth performance, carcass measurements, tissue selenium concentrations, characteristics of reproductive organs, and testis gene expression profiles in boars. J. Anim. Sci. 2012, 90, 533−542. (33) Chadio, S. E.; Kotsampasi, B. M.; Menegatos, J. G.; Zervas, G. P.; Kalogiannis, D. G. Effect of selenium supplementation on thyroid hormone levels and selenoenzyme activities in growing lambs. Biol. Trace Elem. Res. 2006, 109, 145−154. (34) Kumar, N.; Garg, A. K.; Mudgal, V.; Dass, R. S.; Chaturvedi, V. K.; Varshney, V. P. Effect of different levels of selenium supplementation on growth rate, nutrient utilization, blood metabolic profile, and immune response in lambs. Biol. Trace. Elem. Res. 2008, 126, 44−56. (35) Wang, A.; Yi, X.; Yu, H.; Dong, B.; Qiao, S. Free radical scavenging activity of Lactobacillus fermentum in vitro and its antioxidative effect on growing-finishing pigs. J. Appl. Microbiol. 2009, 107, 1140−1148. (36) Wang, J.; Ji, H.; Wang, S.; Zhang, D.; Liu, H.; Shan, D.; Wang, Y. Lactobacillus plantarum ZLP001: in vitro assessment of antioxidant capacity and effect on growth performance and antioxidant status in weaning piglets. J. Anim. Sci. 2012, 25, 1153−1158. (37) Ren, F.; Chen, X.; Hesketh, J.; Gan, F.; Huang, K. Selenium promotes T-Cell response to TCR-stimulation and ConA, but not PHA in primary porcine splenocytes. PLoS One 2012, 7, DOI: 10.1371/journal.pone.0035375. (38) Huang, Z.; Rose, A. H.; Hoffmann, P. R. The role of selenium in inflammation and immunity: from molecular mechanisms to therapeutic opportunities. Antioxid. Redox Signal. 2012, 16, 705−743. (39) Mahan, D. C. Effect of organic and inorganic selenium sources and levels on sow colostrum and milk selenium content. J. Anim. Sci. 2000, 78, 100−105. (40) Babinska, I.; Rotkiewicz, T.; Otrocka, D. I. The effect of Lactobacillus acidophilus and Bif idobacterium spp. administration on the morphology of the gastrointestinal tract, liver and pancreas in piglets. Pol. J. Vet. Sci. 2005, 8, 29−35. (41) Tortuero, F.; Rioperez, J.; Fernandez, E.; Rodriguez, M. L. Response of piglets to oral administration of lactic acid bacteria. J. Food Prot. 1995, 58, 1369−1374. (42) Christensen, M. J.; Burgener, K. W. Dietary selenium stabilizes glutathione peroxidase mRNA in rat liver. J. Nutr. 1992, 122, 1620. (43) Maquat, L. E. Evidence that selenium deficiency results in the cytoplasmic decay of GPx1 mRNA dependent on pre-mRNA splicing proteins bound to the mRNA exon-exon junction. Biofactors. 2001, 14, 37−42.

4508

dx.doi.org/10.1021/jf501065d | J. Agric. Food Chem. 2014, 62, 4502−4508