Sensitive Detection of Nucleic Acids with Rolling Circle Amplification

Oct 4, 2010 - Detection of specific DNA sequences is important to molecular biology research and clinical diagnostics. To improve the sensitivity of s...
9 downloads 11 Views 1MB Size
Download PDF
Anal. Chem. 2010, 82, 8991–8997

Sensitive Detection of Nucleic Acids with Rolling Circle Amplification and Surface-Enhanced Raman Scattering Spectroscopy Juan Hu and Chun-yang Zhang* Institute of Biomedical Engineering and Health Technology, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, 518055, China Detection of specific DNA sequences is important to molecular biology research and clinical diagnostics. To improve the sensitivity of surface-enhanced Raman scattering spectroscopy (SERS), a variety of signal amplification methods has been developed, including Ramanactive-dye, polymerase chain reaction (PCR) technology, molecular beacon, SERS-active substrates, and SERS-tag. However, the combination of rolling circle amplification (RCA) with SERS for nucleic acid detection has not been reported. Herein, we describe a new approach for nucleic acid detection by the combination of RCA reaction with SERS. Because of the binding of abundance repeated sequences of RCA products with gold nanoparticle (Au NP) and Rox-modified detection probes, SERS signal is significantly amplified and the detection limit of 10.0 pM might be achieved. The sensitivity of RCA-based SERS has increased by as much as 3 orders of magnitude as compared to PCR-based SERS and is also comparable with or even exceeds that of both RCA-based electrochemical and RCA-based fluorescent methods. This RCA-based SERS might discriminate perfect matched target DNA from 1-base mismatched DNA with high selectivity. The high sensitivity and selectivity of RCA-based SERS makes it a potential tool for early diagnosis of gene-related disease and also offers a great promise for multiplexed assays with DNA microarrays. As the carriers of genetic information in all cells and in many viruses, nucleic acids might provides useful information for disease diagnosis and pharmacogenomics.1 Accordingly, the sensitive, rapid and reliable methods for nucleic acid detection are highly desired in molecular biology and clinical diagnostics, especially in early diagnosis of a variety of infectious and hereditary diseases. The polymerase chain reaction (PCR) assay is a fast and convenient method for amplifying a specific target DNA,2 but it suffers from both insufficient specificity in single nucleotide * To whom correspondence should be addressed. E-mail: cy.zhang@ sub.siat.ac.cn. (1) (a) Risch, N.; Merikangas, K. Science 1996, 273, 1516–1517. (b) McCarthy, J. J.; Hilfiker, R. Nat. Biotechnol. 2000, 18, 505–508. (2) (a) Mulder, J.; McKinney, N.; Christopherson, C.; Sninsky, J.; Greenfield, L.; Kwok, S. J. Clin. Microbiol. 1994, 32, 292–300. (b) Palmer, S.; Wiegand, A. P.; Maldarelli, F.; Bazmi, H.; Mican, J. M.; Polis, M.; Dewar, R. L.; Planta, A.; Liu, S. Y.; Metcalf, J. A.; Mellors, J. W.; Coffin, J. M. J. Clin. Microbiol. 2003, 41, 4531–4536. 10.1021/ac1019599  2010 American Chemical Society Published on Web 10/04/2010

polymorphism (SNP) detection and limitation in their multiplexing capacity. Alternatively, a number of new methods for nucleic acid detection have been developed, including electrochemical, optical, and single molecule detection methods based on fluorescent, radiolabel, or chemiluminescent labels and quantum dots.3 Among the optical detection methods, surface-enhanced Raman spectroscopy (SERS) has been attracting much attention due to its unique characteristics such as spectrum with enormous informational content than the fluorescent spectrum, narrow spectral bands for multiplexed assays, and free from both photobleaching and self-quenching of fluorophores. SERS has been widely applied in the detection of small bioactive molecules,4 nucleic acid,5-28 proteins,29,30 bacteria, and cells.31,32 In order to (3) (a) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 1192–1199. (b) Epstein, J. R.; Biran, I.; Walt, D. R. Anal. Chim. Acta 2002, 469, 3–36. (c) Zhang, C. Y.; Yeh, H. C.; Kuroki, M. T.; Wang, T. H. Nat. Mater. 2005, 4, 826–831. (4) Shafer-Peltier, K. E.; Haynes, C. L.; Glucksberg, M. R.; Van Duyne, R. P. J. Am. Chem. Soc. 2003, 125, 588–593. (5) Bell, S. E. J.; Sirimuthu, N. M. S. J. Am. Chem. Soc. 2006, 128, 15580– 15581. (6) Barhoumi, A.; Zhang, D.; Tam, F.; Halas, N. J. J. Am. Chem. Soc. 2008, 130, 5523–5529. (7) Bailo, E.; Deckert, V. Angew. Chem., Int. Ed. 2008, 47, 1658–1661. (8) Vodinh, T.; Houck, K.; Stokes, D. L. Anal. Chem. 1994, 66, 3379–3383. (9) Graham, D.; Mallinder, B. J.; Smith, W. E. Biopolymers 2000, 57, 85–91. (10) Stokes, R. J.; Macaskill, A.; Dougan, J. A.; Hargreaves, P. G.; Stanford, H. M.; Smith, W. E.; Faulds, K.; Graham, D. Chem. Commun. 2007, 2811–2813. (11) Huh, Y. S.; Chung, A. J.; Cordovez, B.; Erickson, D. Lab Chip 2009, 9, 433–439. (12) Isola, N. R.; Stokes, D. L.; Vo-Dinh, T. Anal. Chem. 1998, 70, 1352–1356. (13) Graham, D.; Mallinder, B. J.; Whitcombe, D.; Watson, N. D.; Smith, W. E. Anal. Chem. 2002, 74, 1069–1074. (14) Monaghan, P. B.; McCarney, K. M.; Ricketts, A.; Littleford, R. E.; Docherty, F.; Smith, W. E.; Graham, D.; Cooper, J. M. Anal. Chem. 2007, 79, 2844– 2849. (15) Mahajan, S.; Richardson, J.; Brown, T.; Bartlett, P. N. J. Am. Chem. Soc. 2008, 130, 15589–15601. (16) Wabuyele, M. B.; Vo-Dinh, T. Anal. Chem. 2005, 77, 7810–7815. (17) Faulds, K.; Fruk, L.; Robson, D. C.; Thompson, D. G.; Enright, A.; Smith, W. E.; Graham, D. Faraday Discuss. 2006, 132, 261–268. (18) Braun, G.; Lee, S. J.; Dante, M.; Nguyen, T. Q.; Moskovits, M.; Reich, N. J. Am. Chem. Soc. 2007, 129, 6378–6379. (19) Fabris, L.; Dante, M.; Braun, G.; Lee, S. J.; Reich, N. O.; Moskovits, M.; Nguyen, T. Q.; Bazan, G. C. J. Am. Chem. Soc. 2007, 129, 6086–6087. (20) Lim, D.-K.; Jeon, K.-S.; Kim, H. M.; Nam, J.-M.; Suh, Y. D. Nat. Mater. 2010, 9, 60–67. (21) Hu, J.; Zheng, P.-C.; Jiang, J.-H.; Shen, G.-L.; Yu, R.-Q.; Liu, G.-K. Analyst 2010, 135, 1084–1089. (22) Graham, D.; Thompson, D. G.; Smith, W. E.; Faulds, K. Nat. Nanotechnol. 2008, 3, 548–551. (23) Liang, Y.; Gong, J. L.; Huang, Y.; Zheng, Y.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Talanta 2007, 72, 443–449.

Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

8991

Table 1. Sequence of Probe and Target Oligonucleotides note

sequence (5′-3′)

capture probe primer probe perfect matched target DNA 1-base mismatched target DNA RCA template detection probe

SH-C6-TTTTTTTTTTTTTTTTTTTTGGCCACAGTGGTACG PO4-CGAGGCCACCACGAGGCGAAGACAGGTGCTTAGTC TCGTGGTGGCCTCGCGTACCACTGTGGCCA TCGTGGTGGCCTCGGGTACCACTGTGGCCA PO4-TGTCTTCGCCTTGTTTCCTTTCCTTGAAACTTCTTCCTTTCTTTCTTTCGACTAAGCACC Rox-TTGTTTCCTTTCCTTGAAACTTCTTCC-SH

detect small amounts of biomolecules, additional signal enhancement is necessary for the SERS method, and both label-free detection5–7 and label-dye detection8–24 have been employed. The tip-enhanced Raman scattering with atomic force microscope is a typical example of signal amplification for label-free detection.7 The signal amplification for label-dye detection includes (1) Raman-active-dye-based SERS signal amplification,8–11 (2) PCRbased SERS signal amplification,12–15 (3) molecular beacon-based SERS signal amplification,16,17 (4) substrate-based SERS signal amplification and SERS-active gold-silver core-shell nanodumbbells,18–21 and (5) SERS-tag-based SERS signal amplification.22–24 The signal amplification strategies are now being widely applied for sensitive quantitative analysis of nucleic acids, distinguishing SNP, and multiplexed detection of the gene.25–28 As a unique method of molecular amplification, rolling-circle amplification (RCA) might catalyze DNA polymerization at a constant temperature of 30 °C or even room temperature with a short reaction time of as little as 1-2 h and might achieve a signal amplification with a linear form of about a 1000-fold increase and an exponential form of approximately a 10 000-fold increase.33 RCA possesses significant advantages of rapid and efficient analysis, high sensitivity and specificity, and capability of multiplexed analysis.34 RCA has been employed for the analysis of SNP, platelet-derived growth factor B-chain, proteins, nucleic acids, and cocaine by the combination with electrochemical,35 fluorescence,36 UV-vis spectroscopy and colorimetry,37 chemiluminescence and (24) Qian, X. M.; Zhou, X.; Nie, S. M. J. Am. Chem. Soc. 2008, 130, 14934– 14935. (25) Cao, Y. W. C.; Jin, R. C.; Mirkin, C. A. Science 2002, 297, 1536–1540. (26) Faulds, K.; Smith, W. E.; Graham, D. Anal. Chem. 2004, 76, 412–417. (27) McCabe, A. F.; Eliasson, C.; Prasath, R. A.; Hernandez-Santana, A.; Stevenson, L.; Apple, I.; Cormack, P. A. G.; Graham, D.; Smith, W. E.; Corish, P.; Lipscomb, S. J.; Holland, E. R.; Prince, P. D. Faraday Discuss. 2006, 132, 303–308. (28) Sun, L.; Yu, C. X.; Irudayaraj, J. Anal. Chem. 2007, 79, 3981–3988. (29) Ni, J.; Lipert, R. J.; Dawson, G. B.; Porter, M. D. Anal. Chem. 1999, 71, 4903–4908. (30) Hu, J.; Zheng, P. C.; Jiang, J. H.; Shen, G. L.; Yu, R. Q.; Liu, G. K. Anal. Chem. 2009, 81, 87–93. (31) Kneipp, K.; Haka, A. S.; Kneipp, H.; Badizadegan, K.; Yoshizawa, N.; Boone, C.; Shafer-Peltier, K. E.; Motz, J. T.; Dasari, R. R.; Feld, M. S. Appl. Spectrosc. 2002, 56, 150–154. (32) Qian, X. M.; Peng, X. H.; Ansari, D. O.; Yin-Goen, Q.; Chen, G. Z.; Shin, D. M.; Yang, L.; Young, A. N.; Wang, M. D.; Nie, S. M. Nat. Biotechnol. 2008, 26, 83–90. (33) (a) Nilsson, M.; Malmgren, H.; Samiotaki, M.; Kwiatkowski, M.; Chowdhary, B. P.; Landegren, U. Science 1994, 265, 2085–2088. (b) Fire, A.; Xu, S. Q. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 4641–4645. (c) Liu, D. Y.; Daubendiek, S. L.; Zillman, M. A.; Ryan, K.; Kool, E. T. J. Am. Chem. Soc. 1996, 118, 1587–1594. (34) (a) Nallur, G.; Luo, C. H.; Fang, L. H.; Cooley, S.; Dave, V.; Lambert, J.; Kukanskis, K.; Kingsmore, S.; Lasken, R.; Schweitzer, B. Nucleic Acids Res. 2001, 29, e118. (b) Schweitzer, B.; Roberts, S.; Grimwade, B.; Shao, W. P.; Wang, M. J.; Fu, Q.; Shu, Q. P.; Laroche, I.; Zhou, Z. M.; Tchernev, V. T.; Christiansen, J.; Velleca, M.; Kingsmore, S. F. Nat. Biotechnol. 2002, 20, 359–365.

8992

Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

bioluminescence,38 gel electrophoresis and capillary electrophoresis,39 fluorescence microscopy,40 and single molecule detection.41 However, the combination of RCA with SERS for nucleic acid detection has not been reported. Herein, we develop a new approach for specific and sensitive detection of DNA by the combination of RCA with SERS. Because of the binding of abundance of repeated sequences of RCA products with gold nanoparticle (Au NPs) and Rox-modified detection probes, the SERS signal is significantly amplified and the detection sensitivity of 10.0 pM might be achieved. EXPERIMENTAL SECTION Reagents and Materials. All DNA oligonucleotides (Table 1) were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). T4 DNA ligase and 10× T4L DNA ligase buffer were obtained from Takara Biotechnology Co., Ltd. (Dalian, China). The RepliPHI Phi29 DNA polymerization and deoxyribonucleoside 5′-triphosphates (dNTPs) mixture were purchased from Epicenter Technologies (Madison, WI). Bovine serum albumin (BSA) was obtained from Aladdin-Reagent, Inc. (Shanghai, China). 6-Mercaptohecanol was obtained from Sigma-Aldrich, Inc. (St. Louis, MO). Other reagents were purchased from China National Medicines Co. Ltd. (Beijing, China). Solutions were prepared with Milli-Q deionized water. The pH of all buffers was adjusted with either NaOH or HCl solution. Preparation of Detection Probe-Modified Gold Nanoparticles. Gold nanoparticles were prepared following the reported protocals with a step-by-step growth procedure.42 Briefly, 9 mL of 1% sodium citrate was quickly added in 94 mL of 1.0 mM HAuCl4 boiling solution and kept boiling for 10 min under vigorous stirring to obtain a wine red gold nanoparticles solution. The size of above gold nanoparticles is about 15 nm. The 26 nm gold nanoparticles were obtained by dropping 0.8 (35) (a) Zhou, L.; Ou, L. J.; Chu, X.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2007, 79, 7492–7500. (b) Zhang, S. B.; Wu, Z. S.; Shen, G. L.; Yu, R. Q. Biosens. Bioelectron. 2009, 24, 3201–3207. (c) Cheng, W.; Yan, F.; Ding, L.; Ju, H. X.; Yin, Y. B. Anal. Chem. 2010, 82, 3337–3342. (36) (a) Ou, L. J.; Liu, S. J.; Chu, X.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2009, 81, 9664–9673. (b) Ali, M. M.; Aguirre, S. D.; Xu, Y. Q.; Filipe, C. D. M.; Pelton, R.; Li, Y. F. Chem. Commun. 2009, 6640–6642. (c) Cheng, Y. Q.; Zhang, X.; Li, Z. P.; Jiao, X. X.; Wang, Y. C.; Zhang, Y. L. Angew. Chem., Int. Ed. 2009, 48, 3268–3272. (d) He, J. L.; Wu, Z. S.; Zhou, H.; Wang, H. Q.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2010, 82, 1358– 1364. (37) (a) Li, J. S.; Deng, T.; Chu, X.; Yang, R. H.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2010, 82, 2811–2816. (b) Ali, M. M.; Li, Y. F. Angew. Chem., Int. Ed. 2009, 48, 3512–3515. (38) (a) Cheglakov, Z.; Weizmann, Y.; Basnar, B.; Willner, I. Org. Biomol. Chem. 2007, 5, 223–225. (b) Su, Q.; Xing, D.; Zhou, X. M. Biosens. Bioelectron. 2010, 25, 1615–1621. (39) (a) Hatch, A.; Sano, T.; Misasi, J.; Smith, C. L. Genet. Anal.: Biomol. Eng. 1999, 15, 35–40. (b) Li, N.; Jablonowski, C.; Jin, H. L.; Zhong, W. W. Anal. Chem. 2009, 81, 4906–4913.

Figure 1. Scheme of the RCA-based SERS assay for DNA detection.

mL of 1% HAuCl4 into a mixture containing 20 mL of Au seeds, 24 mL of 25.0 mM NH2OH, and 56 mL of H2O at room temperature. The 56 nm gold nanoparticles were prepared through a reaction of 0.9 mL of 1% HAuCl4 with 10 mL of 26 nm gold nanoparticles solution, 9 mL of 25.0 mM NH2OH solution, and 80 mL of H2O. Detection probe-modified gold nanoparticles were prepared according to a published protocol.21,43 Briefly, 3′-thiol and 5′-Rox modified detection probes (50 µL, 5.0 µM) were added to the gold nanoparticles (1 mL, 134 µM), and the solution was aged overnight at 4 °C. Then phosphate buffer and NaCl were added to prepare a solution with 10.0 mM phosphate buffer (pH 7.0) and 0.1 M NaCl. After the centrifugation of above solution, the supernatant was removed and the soft pellet in the bottom was washed with buffer. Preparation of Capture Probe-Modified Gold Electrode. A polycrystal gold electrode was used as the substrate. Before the modification of capture probe, the electrode was first polished by 0.03 µm alumina powder to a mirror, followed by ultrasonic (40) (a) Lizardi, P. M.; Huang, X. H.; Zhu, Z. R.; Bray-Ward, P.; Thomas, D. C.; Ward, D. C. Nat. Genet. 1998, 19, 225–232. (b) Schweitzer, B.; Wiltshire, S.; Lambert, J.; O’Malley, S.; Kukanskis, K.; Zhu, Z. R.; Kingsmore, S. F.; Lizardi, P. M.; Ward, D. C. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 10113– 10119. (c) Zhong, X. B.; Lizardi, P. M.; Huang, X. H.; Bray-Ward, P. L.; Ward, D. C. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 3940–3945. (d) Christian, A. T.; Pattee, M. S.; Attix, C. M.; Reed, B. E.; Sorensen, K. J.; Tucker, J. D. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 14238–14243. (e) Larsson, C.; Koch, J.; Nygren, A.; Janssen, G.; Raap, A. K.; Landegren, U.; Nilsson, M. Nat. Methods 2004, 1, 227–232. (f) Cho, E. J.; Yang, L. T.; Levy, M.; Ellington, A. D. J. Am. Chem. Soc. 2005, 127, 2022–2023. (g) Nie, B.; Shortreed, M. R.; Smith, L. M. Anal. Chem. 2005, 77, 6594–6600. (h) Smolina, I.; Lee, C.; Frank-Kamenetskii, M. Appl. Environ. Microbiol. 2007, 73, 2324–2328. (41) (a) Blab, G. A.; Schmidt, T.; Nilsson, M. Anal. Chem. 2004, 76, 495–498. (b) Melin, J.; Johansson, H.; Soderberg, O.; Nikolajeff, F.; Landegren, U.; Nilsson, M.; Jarvius, J. Anal. Chem. 2005, 77, 7122–7130. (c) Jarvius, J.; Melin, J.; Goransson, J.; Stenberg, J.; Fredriksson, S.; Gonzalez-Rey, C.; Bertilsson, S.; Nilsson, M. Nat. Methods 2006, 3, 725–727. (d) Andersen, F. F.; Stougaard, M.; Jorgensen, H. L.; Bendsen, S.; Juul, S.; Hald, K.; Andersen, A. H.; Koch, J.; Knudsen, B. R. ACS Nano 2009, 3, 4043–4054. (42) (a) Frens, G. Nat. Phys. Sci. 1973, 241, 20–22. (b) Liu, G. K.; Hu, J.; Zheng, P. C.; Shen, G. L.; Jiang, J. H.; Yu, R. Q.; Cui, Y.; Ren, B. J. Phys. Chem. C 2008, 112, 6499–6508. (43) (a) Hurst, S. J.; Lytton-Jean, A. K. R.; Mirkin, C. A. Anal. Chem. 2006, 78, 8313–8318. (b) Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal. Chem. 2000, 72, 5535–5541.

cleaning in Mill-Q water, alcohol, and water. Subsequently, the Au electrode was cleaned with piranha solution for 15 min, rinsed with water, and then dried in air. The resulting gold electrode was immersed in a tris-EDTA buffer solution containing 1.0 µM capture probe, 1.0 µM 6-mercaptohecanol, and 1.0 M NaCl for 16 h at 37 °C. DNA Hybridization and Ligation. The capture probe-modified electrode was immerged in a series of 100 µL solutions containing 1.0 µM primer probe, T4 DNA ligase buffer (66.0 mM Tris-HCl (pH 7.6), 6.6 mM MgCl2, 10.0 mM DTT, and 0.1 mM ATP), 1 µL of perfect matched target DNA (10.0 pM∼10.0 nM). The ligation mixture were incubated at 65 °C for 3 min and then slowly cooled to room temperature followed by the addition of T4 DNA ligase (1.0 U/µL) and bovine serum albumin (BSA, 200.0 µg/mL). After incubation at 37 °C for up to 2 h, the electrode was washed twice with buffer. RCA Reaction. After DNA ligation, the electrode was incubated at 67 °C for 3 min with 100 µL solution containing RCA template (0.1 µM), Phi29 DNA polymerization reaction buffer (40.0 mM Tris-HCl (pH 7.5), 50.0 mM KCl, 10.0 mM MgCl2, 5.0 mM (NH4)2SO4, and 4.0 mM DTT). Phi29 DNA polymerization (1.0 U/µL), dNTPs (625.0 µM for each of dATP, dCTP, dGTP and dTTP), and 200.0 µg/mL BSA were added after cooling to room temperature, and the reaction was carried out at 30 °C for 2 h. After RCA reaction, the solution was removed from the surface of the electrode. Hybridization Reaction. The above electrode was immerged in 100 µL of detection probe-modified gold nanoparticles for 1 h at 37 °C. The electrode was then washed three times with buffer subsequently. Measurement of Raman Spectrum. SERS spectra were measured by an Advantage 200A Raman spectrometer with a 632.8 nm laser (DeltaNu, Laramie, WY). The laser power was 3 mW, and the resolution of SERS spectra over 200-3400 cm-1 was about 10 cm-1. The collection time for each spectrum was 60 s. RESULTS AND DISCUSSION Design of Detection Scheme for RCA-Based SERS. The schematic design of DNA detection with the combination of RCA and SERS is shown in Figure 1. Six DNA molecules were used in this experiment: capture probe with 5′-end modified by thiol; Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

8993

Figure 2. SERS spectra obtained from DNA ligation and RCA reaction: (a) ligation with primer probe and T4 DNA ligase (T4L) but in the absence of target DNA; (b) ligation with primer probe and target DNA but in the absence of T4L; (c) in the presence of perfectly matched target DNA, primer probe, and T4L, RCA reaction with Phi29 DNA polymerization (Phi29) but without RCA template; (d) in the presence of perfectly matched target DNA, primer probe, and T4L, RCA reaction with RCA template but without Phi29; (e) ligation with primer probe and target DNA in the presence of T4L, RCA reaction with RCA template and Phi29. The concentration of target DNA is 10.0 nM. The insert shows the molecular structure of Rox.

Figure 3. Variance of normalized Raman intensity with the concentration of capture probe. The concentration of target DNA is 10.0 nM. Error bars show the standard deviation of three experiments.

primer probe with 5′-end modified by a PO4 group as the primer of RCA; perfect matched target DNA; 1-base mismatched target DNA; RCA template with 5′ end phosphorylated for ligation reactions and also complementary to the primer; detection probe with 5′ end labeled by a Rox and 3′ end by a SH group to react with gold nanoparticles and also complementary to RCA product. The thiol-labeled capture probes were first immobilized on the surface of the gold electrode, followed by sandwich hybridization with the perfect matched target DNAs and primer probe. Afterward, T4L DNA ligase which catalyzed the 5′-terminal PO4 primer probe was added and the primer probe acted as a primer to hybridize the RCA template. The RCA reaction was performed in the presence of the Phi29 DNA polymerase and dNTPs. After the RCA reaction, the detection probe-modified gold nanoparticles, whose sequence was complementary to the RCA product in each repeat sequence, were added to hybridize with the long amplified DNA products. The nonhybridized detection probe-modified gold nanoparticles were removed by washing with buffer before the measurement of SERS spectra. Through RCA reaction, the target DNA was significantly amplified, and the amplification efficiency correlated with the perfect matched target DNA concentration. Consequently, the SERS signal increased due to the binding of the amplified RCA products with the detection probemodified gold nanoparticles, resulting in improved sensitivity for low-abundance DNA detection. Figure 2 shows five SERS spectra obtained from DNA ligation and RCA reaction. The characteristics of the SERS spectrum were similar to that of Rhodamine dyes absorbed on metallic (e.g., Ag) surfaces:44 these peaks centered at ∼1344, 1499, and 1644 cm-1 could be assigned to the ring C-C stretching vibrations of Rox (The molecular structure of Rox was shown in the insert of

Figure 2). The strongest Raman band at 1499 cm-1 was selected as the characteristic peak in the following research. To verify the improvement of SERS signal induced by RCA reaction, the following four control experiments were performed: (1) ligation with primer probe and T4 DNA ligase (T4L) but in the absence of perfect matched target DNA (Figure 2a); (2) ligation with primer probe and perfect matched target DNA but in the absence of T4L (Figure 2b); (3) in the presence of perfect matched target DNA, primer probe, and T4L, RCA reaction with Phi29 DNA polymerization (Phi29) but without RCA template (Figure 2c); (4) in the presence of perfect matched target DNA, primer probe, and T4L, RCA reaction with the RCA template but without Phi29 (Figure 2d). In Figure 2a-d, some low signals were observed due to the nonspecific adsorption of the detection probes on the surface of the electrode, but no significant enhancement in SERS spectrum was observed due to the lack of perfect matched target DNA or RCA reaction, indicative of no signal amplification without RCA products. When ligation with the primer probe and the perfect matched target DNA in the presence of T4L followed by RCA reaction with RCA template and Phi29, the SERS intensity was improved by as much as 7.5 times even in the presence of 10.0 nM target DNA (Figure 2e) as compared to the control in Figure 2a-d, suggesting the improvement of SERS signal induced by RCA reaction. Influence of Capture Probe Concentration on SERS Signal. Figure 3 shows the variance of normalized Raman intensity with the concentration of capture probe. In the presence of 10.0 nM target DNA, the SERS signal increased as a result of the increase of capture probe concentration from 5.0 × 10-8 M to 1.0 × 10-6 M but tended to level off beyond the concentration of 1.0 × 10-6 M. These results demonstrated that lowconcentration capture probes might not hybridize with sufficient target DNA, but high-concentration capture probes might increase the steric hindrance of the microenvironment, adversely preventing their hybridization with target DNA.45 The spectra studies revealed that the optimum capture probe concentration was in the range of 1.0 × 10-7 to ∼1.2 × 10-6 M.21,35b Our result was in agreement with these reported results,

(44) (a) Michaels, A. M.; Nirmal, M.; Brus, L. E. J. Am. Chem. Soc. 1999, 121, 9932–9939. (b) Lu, Y.; Liu, G. L.; Lee, L. P. Nano Lett. 2005, 5, 5–9.

(45) Kjallman, T. H. M.; Peng, H.; Soeller, C.; Travas-Sejdic, J. Anal. Chem. 2008, 80, 9460–9466.

8994

Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

Figure 4. Variance of normalized Raman intensity with RCA reaction time. The concentration of target DNA is 10.0 nM. Error bars showed the standard deviation of three experiments.

and 1.0 × 10-6 M was used as the optimum concentration for the capture probe in following research. Influence of RCA Reaction Time on SERS Signal. The SERS intensity was dependent on the amount of the detection probes bound to the RCA product. The greater the number of repeated sequences produced by RCA reaction, the greater the amount of the bound detection probe. In theory, a long RCA reaction time was expected to generate more complementary segments of the circular template for enhanced signal amplification. Figure 4 shows the variance of normalized Raman intensity with RCA reaction. The Raman intensity increased rapidly with the RCA reaction time from 10 min to 2 h but tended to saturate over 2 h, which might result from the termination of RCA reaction due to the exhaustion of RCA substrates or inactivation of the Phi29 DNA polymerase.35c Therefore, 2 h was selected as the optimum time for the RCA reaction. This time was also in agreement with the reported RCA reaction time of 1-3 h.35c,36a,38b Influence of Dye Concentration on SERS Signal. In order to study the effect of dye concentration upon the SERS signal intensity, a different volume of detection probes (5.0 µM) was added to 100 µL of 56 nm Au NPs (0.134 nM) for SERS measurement. Figure 5 shows the variance of normalized Raman intensity with the volume of detection probes. The Raman intensity increased with the volume of detection probes from 0.5 to 5.0 µL, then leveled off beyond 5.0 µL. The detection probe per Au NP might play an important role in the amplification of SERS signal. Previous research demonstrated that the DNA molecules per 50 nm nanoparticle is ∼1200 molecules with full coverage, and the DNA molecules per 80 nm nanoparticle is ∼2800 molecules.43a According to the published methods,24 we calculated that the number of detection probes per 56 nm Au NP is approximately 1800 molecules with full coverage, which might significantly increase the chance of detection probe-conjugated Au NPs binding to RCA products. In following research, we selected 5.0 µL as the optimum volume of detection probes (the corresponding concentration is 0.25 µM). Sensitivity of RCA-Based SERS. Figure 6A shows the SERS spectra with the addition of different concentration of target DNA. Improved SERS signal was observed with the increase of target DNA concentration. With the measurement of the normalized

Figure 5. Variance of normalized Raman intensity with the volume of detection probe. The concentration of target DNA is 10.0 nM. Error bars showed the standard deviation of three experiments.

Figure 6. SERS spectra (A) and variance of normalized Raman intensity with the concentration of target DNA (B). The dashed line showed the result of the control experiments. The average of five spectra was obtained from different spots on the electrode surface, and three repeated experiments were performed. Error bars showed the standard deviation of three experiments.

Raman intensity of the 1499 cm-1 peak, we quantitatively analyzed the change of normalized Raman intensity with the concentration of target DNA. As shown in Figure 6B, the normalized Raman intensity was a good linear fit to the logarithm of target DNA in the range from 1.0 × 10-11 to 1.0 × 10-7 M. The Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

8995

correlation equation was I ) 0.17 log C + 1.98 (C was the concentration of target DNA), and the correlation coefficient (R) was 0.9872. The corresponding detection limit was calculated to be 10.0 pM by evaluating the average response of the blank plus 3 times the standard deviation; this corresponded to 1.0 fmol of DNA target in 100.0 µL of solution. Notably, the sensitivity of the current method had increased by as much as 3 orders of magnitude as compared to the PCR-based SERS method with a detection limit of 20.6 nM14 and was also comparable with and even exceeded the reported detection limit of 0.1 nM by the RCA-based electrochemical method35b and 100.0 pM by the RCA-based fluorescence method.36b Moreover, in comparison with the RCA-based fluorescence method, RCA-based SERS had significant advantages of high sensitivity (1 order of magnitude improvement), multiplexed assays with simultaneous excitation of different fluorophores by a single-wavelength laser, and free from both self-quenching and photobleaching of fluorophores. In addition, unlike PCRbased SERS, RCA-based SERS did not require any thermal cycling, thus significantly reducing the cost and simplifying the process of DNA detection. The high sensitivity of RCA-based SERS might be attributed to following two factors: (1) On the basis of the Raman scattering equation,46 the larger the number density of scatterers, the stronger the Raman intensity. Because of the amplification of abundance repeated sequences of target DNA by RCA reaction, more Au NP and dye-modified detection probes would hybridize with RCA products to form the dye- and Au-nanoassembled superstructures (Figure 1). The formation of Au-nanoassembled superstructures along the long RCA products had been confirmed by the height-mode AFM image,47 and the RCA products with numerous complementary DNA-tagged dyes had also been proved by the confocal microscopy images.47 Thus, the SERS signal might be significantly amplified as a result of the increase of particle density in the dye- and Au-nanoassembled superstructures. (2) On the basis of the distance dependence of SERS enhancement in eq 1, -10

ISERS ) (a + r)-10/a

(1)

where “a” is the size of the Au NPs and “r” is the distance between the NPs and the molecule,46 the shorter the distance, the larger the SERS enhancement. The hybridization of RCA products with detection probes led to the formation of the coil containing the (46) (a) Chang, R. K.; Furtak, T. E. Surface Enhanced Raman Scattering; Plenum Press: New York, 1982. (b) Moskovits, M. Rev. Mod. Phys. 1985, 57, 783– 826. (c) Otto, A.; Mrozek, I.; Grabhorn, H.; Akemann, W. J. Phys.: Condens. Matter 1992, 4, 1143–1212. (d) Nie, S.; Emory, S. R. Science 1997, 275, 1102–1106. (e) Campion, A.; Kambhampati, P. Chem. Soc. Rev. 1998, 27, 241–250. (f) Xu, H.; Bjerneld, E. J.; Kall, M.; Borjesson, L. Phys. Rev. Lett. 1999, 83, 4357–4360. (g) Kennedy, B. J.; Spaeth, S.; Dickey, M.; Carron, K. T. J. Phys. Chem. B 1999, 103, 3640–3646. (h) Tian, Z. Q.; Ren, B.; Wu, D. Y. J. Phys. Chem. B 2002, 106, 9463–9483. (i) Otto, A. J. Raman Spectrosc. 2005, 36, 497–509. (j) Lombardi, J. R.; Birke, R. L. J. Chem. Phys. 2007, 126, 244709–244717. (47) (a) Deng, Z. X.; Tian, Y.; Lee, S. H.; Ribbe, A. E.; Mao, C. D. Angew. Chem., Int. Ed. 2005, 44, 3582–3585. (b) Zhao, W. A.; Gao, Y.; Kandadai, S. A.; Brook, M. A.; Li, Y. F. Angew. Chem., Int. Ed. 2006, 45, 2409–2413. (c) Beyer, S.; Nickels, P.; Simmel, F. C. Nano Lett. 2005, 5, 719–722.

8996

Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

Figure 7. The normalized Raman intensity in the presence of only buffer (control), 10.0 nM 1-base mismatched target DNA (mismatched), and 10.0 nM perfect matched target DNA (perfect matched). Error bars showed the standard deviation of three experiments.

Au NPs and the dyes,48 resulting in a shorter distance between the Au NPs and the dyes and consequently generating a stronger Raman signal in comparison with the line-form DNA. Moreover, the electromagnetic field intensity created by the coupled Au NPs would increase when they were in close proximity,46 which also contributed to the strong Raman signal in RCA-based SERS. On the basis of previous research46–48 and our experimental results, we assumed that both the increase of particle density (or the decrease of interparticle distance) and RCA amplification contributed equally to the signal amplifications. Selectivity of RCA-Based SERS. The highly specific hybridization and ligation reaction between capture probe, primer probe, and target offered high selectivity for DNA detection. Since both A/T, G/A, and A/G mismatch had been studied by RCA,35b,37a,40g as a proof of concept, we used the C/G mismatch to demonstrate the reliability of RCA-based SERS. As shown in Figure 7, a small SERS signal was observed in the absence of target DNA (control); this small SERS signal might result from the nonspecific adsorption of detection probe-modified Au NPs on the electrode surface. In the presence of 1-base mismatched target DNA, no significant difference in SERS signals was observed as compared to the control group without target DNA (Figure 7), suggesting no RCA reaction occurred due to the replacement of base C by G at the ligation site in the mismatched target DNA. However, in the presence of 10.0 nM perfect matched target DNA, the normalized SERS intensity increased by as much as 4.6 times than that in the presence of 1-base mismatched target DNA (Figure 7), suggesting the high selectivity of the RCA-based SERS for SNP detection. CONCLUSIONS We develop a new approach for nucleic acids detection by the combination of RCA with SERS. This RCA-SERS based method has significant advantages of improved sensitivity and high selectivity. The detection limit of RCA-based SERS might (48) (a) de la Torre, T. Z. G.; Stromberg, M.; Russell, C.; Goransson, J.; Nilsson, M.; Svedlindh, P.; Stromme, M. J. Phys. Chem. B 2010, 114, 3707–3713. (b) Stromberg, M.; de la Torre, T. Z. G.; Goransson, J.; Gunnarsson, K.; Nilsson, M.; Stromme, M.; Svedlindh, P. Biosens. Bioelectron. 2008, 24, 696–703.

reach 10.0 pM, which increases by as much as 3 orders of magnitude as compared to PCR-based SERS and is also comparable with or even exceeds the reported detection limit by both RCA-based electrochemical and RCA-based fluorescent methods. This RCA-based SERS might discriminate perfect matched target DNA from 1-base mismatched DNA with high selectivity. The high sensitivity and selectivity of RCA-based SERS makes it a potential tool for early diagnosis of generelated disease and also offers great promise for multiplexed assays with DNA microarrays.25

ACKNOWLEDGMENT This work was supported by the Knowledge Innovation Project of Chinese Academy of Science (Grant No. KGCX2-YW-130), National Science Foundation of China (Grant No. 21075129), and the National Basic Research Program 973 (Grant Numbers 2010CB732600 and 2011CB933600).

Received for review July 24, 2010. Accepted September 23, 2010. AC1019599

Analytical Chemistry, Vol. 82, No. 21, November 1, 2010

8997