ARTICLE pubs.acs.org/ac
Sensitive Quantification of Somatic Mutations Using Molecular Inversion Probes Rena Hirani,† Ashley R. Connolly,*,† Lisa Putral,† Alexander Dobrovic,‡ and Matt Trau*,† †
Centre for Biomarker Research and Development, Australian Institute for Bioengineering and Nanotechnology (AIBN), The University of Queensland, Brisbane, Qld, 4072 Australia ‡ Molecular Pathology Research and Development Laboratory, Peter MacCallum Cancer Centre, Locked Bag 1, A'Beckett St, Melbourne, Victoria, 8006 Australia ABSTRACT: Somatic mutations in DNA can serve as cancer specific biomarkers and are increasingly being used to direct treatment. However, they can be difficult to detect in tissue biopsies because there is often only a minimal amount of sample and the mutations are often masked by the presence of wild type alleles from nontumor material in the sample. To facilitate the sensitive and specific analysis of DNA mutations in tissues, a multiplex assay capable of detecting nucleotide changes in less than 150 cells was developed. The assay extends the application of molecular inversion probes to enable sensitive discrimination and quantification of nucleotide mutations that are present in less than 0.1% of a cell population. The assay was characterized by detecting selected mutations in the KRAS gene, which has been implicated in up to 25% of all cancers. These mutations were detected in a single multiplex assay by incorporating the rapid flow cytometric readout of multiplexable DNA biosensors.
M
any cancers can be treated or cured if they are detected at an early stage.1 The tumors often contain thousands of DNA mutations, some of which are suitable biomarkers for cancer detection.24 However, identifying tumor specific biomarkers at an early stage of cancer is often confounded by the low abundance of tumor cells in a tissue sample, which also limits the amount of tumor material available for analysis. As a result, cancer often remains undetected and untreated early in the disease process. Despite its potential, detecting genetic biomarkers in tissues containing only a small number of tumor cells is often problematic because DNA from the nontumor material can interfere with detection. Detection is particularly difficult when the biomarker represents a single nucleotide mutation within the genome. Nevertheless, a variety of novel analytical techniques have been developed to detect DNA mutations, many of which aim to selectively amplify the mutated nucleotide to a level suitable for analysis (reviewed by Shuga5). However, amplification is often confounded by coamplification of wild type DNA in the sample. This can compromise the specificity and sensitivity of mutation detection and as a result, early stage tumors often remain undiagnosed.6,7 This can be avoided if tumor derived DNA is isolated prior to analysis, but tumor enrichment procedures are often time-consuming, are labor intensive, and require a substantial amount of material for accurate diagnosis.8 This presents an opportunity for novel molecular assays capable of selectively detecting low-frequency DNA mutation profiles in tissues with a high level of sensitivity, in a multiplex format so extensive information can be derived from a limited amount of tissue. r 2011 American Chemical Society
An assay capable of detecting DNA mutations in less than 150 tumor cells is described herein. The assay proceeds with a high level of selectivity, which has been achieved by extending the application of molecular inversion probes (MIPs) to enable DNA mutations to be both detected and quantified in a complex genomic extract. A DNA ligase was used to directly circularize MIPs to an extent that accurately portrayed the amount of mutated and native DNA in the sample. Ligation also enabled different mutations to be detected with a high level of selectivity and as a result, low-frequency mutations could be detected in samples containing excessive amounts of native DNA. As little as 0.1% mutant DNA could be detected in a background of native DNA. Several MIPs were combined in a single assay to facilitate multiplex mutation screening. This enabled multiplex amplification and detection of cancer specific somatic mutations, which could also be accurately quantified so extensive information could be acquired from a small amount (picograms) of genomic DNA. The assay was evaluated by measuring DNA mutations in codon 12 of the KRAS gene, which is a diagnostic biomarker for a number of cancers including pancreatic, colorectal, and lung cancer.911 The assay was developed for applications that demand analysis of low frequency DNA mutation profiles in a large number of clinical samples, since it can be rapidly analyzed using multiplexable DNA biosensors on a flexible flow cytometry platform. Received: July 27, 2011 Accepted: September 26, 2011 Published: September 26, 2011 8215
dx.doi.org/10.1021/ac2019409 | Anal. Chem. 2011, 83, 8215–8221
Analytical Chemistry Table 1. MIP Oligonucleotide Sequencesa
The 50 and 30 end of each MIP contain KRAS DNA binding domains (upper case) each designed to detect a unique mutation (underlined) in codon 12 of the KRAS gene. Each MIP also contains a unique DNA barcode (gray) and conserved PCR primer binding domains (lower case) separated by two uracil nucleotides (U). Oligonucleotide barcodes were immobilized on optically unique microbeads. The 30 end of each oligonucleotide (gray) complemented a unique DNA barcode on a MIP, which enabled multiplex PCR products to be deconvoluted and quantified using flow cytometry. a
In its current form the assay has research and diagnostic potential in applications that demand rapid, sensitive, and selective analysis of DNA mutations, which we anticipate will facilitate biomarker research and evaluation.
’ MATERIALS AND METHODS Optically Encoded Microbeads. Populations of optically unique microbeads were prepared by covalently coupling different amounts of Attotec 488 nm and Attotec 550 nm fluorescent dyes to the interior of 5 μm diameter silica microbeads. Each microbead population was coated with amino-propylsilane and adipic acid as previously described.12 Oligonucleotide barcodes (BC) (Sigma-Aldrich) with a 50 amine/hexamethyl spacer (Table 1) were coupled to distinct populations of optically encoded microbeads using 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) chemistry as previously described,13 and then the functionalized microbeads were washed 3 with 1 mL of MES buffer (100 mM 2-morpholinoethane sulfonic acid, 0.01% sodium dodecyl sulfate (SDS)) and stored at 4 °C. DNA Preparation. MCF-7, A549, Panc-1, Aspc-1, and HEK293 cell lines were cultured under standard conditions. Genomic DNA was extracted from cell pellets containing approximately 1 106 cells resuspended in 100 μL of phosphate buffered saline (PBS). Cells were lysed for 1 h at 37 °C in 1 mL of lysis buffer (10 mM Tris-HCl pH 8.0, 0.1 M EDTA pH 8.0, 0.5% (w/v) SDS). Following lysis, 1 mL of phenol/choloroform/ isoamyl alcohol (25:24:1, Sigma-Aldrich, St. Louis, MO) was added, and the sample was mixed then centrifuged at 12 000g for 5 min at room temperature. The aqueous layer was removed, and the phenol extraction protocol was repeated to ensure the DNA was high purity. The aqueous phase containing DNA was retained and purified using a Qiagen blood and tissue DNeasy kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Purified DNA was eluted in 200 μL of DNAase free H2O, and then the concentration and purity were measured using a spectrophotometer (Nanodrop ND1000, Thermo Fisher Scientific, Waltham, MA).
ARTICLE
Alternatively, DNA was prepared from low numbers of cells (1251 000 cells) diluted in 100 μL of PBS. Cells were counted on a hemocytometer to verify the average number used in the assay. Cells were incubated for 1 h at 37 °C in 100 μL of lysis buffer, and then the DNA was extracted using 100 μL of phenol/ choloroform/isoamyl alcohol as previously outlined. The DNA was purified using a Qiagen blood and tissue DNeasy kit and eluted in 30 μL of DNAase free H2O. The eluate was recycled through the column 3 to maximize the DNA yield. A volume of 2 μL of the eluate was added to each KRAS polymerase chain reaction (PCR) assay. KRAS PCR. A 456 bp section of the KRAS gene (accession number NG_007524) spanning codon 12 was amplified using a sense primer 50 AGGTACTGGTGGAGTATTTGATAGTGT 30 and antisense primer 50 GCACAGAGAGTGAACATCATGGACC 30 (Geneworks, Adelaide, Australia). Each 20 μL PCR contained 2 mM MgCl2, 200 nM of each dNTP, 1 GeneAmp PCR buffer II (Applied Biosystems, Foster City, CA), 125 nM of each primer, 1 U Amplitaq gold DNA polymerase (Applied Biosystems), and the specified amount of genomic DNA template. Thermal cycling was performed using the following conditions: denaturation 95 °C, 10 min followed by 35 cycles of 95 °C, 30 s; 52 °C, 30 s; 72 °C, 30 s then a 5 min incubation at 72 °C in a PCR machine (MJ mini PCR machine, Bio-Rad Laboratories, Hercules, CA). DNA extracted from low numbers of cells (
