Sensitivity to Ethephon Degreening Treatment is Altered by Blue LED

Article pubs.acs.org/JAFC

Sensitivity to Ethephon Degreening Treatment Is Altered by Blue LED Light Irradiation in Mandarin Fruit Lili Deng,† Ziyi Yuan,† Jiao Xie,† Shixiang Yao,† and Kaifang Zeng*,† †

College of Food Science, Southwest University, Chongqing 400715, P.R. China ABSTRACT: Although citrus fruits are not climacteric, exogenous ethylene is widely used in the degreening treatment of citrus fruits. Irradiation with blue light-emitting diode (LED) light (450 nm) for 10 h can promote the formation of good coloration of ethephon-degreened fruit. This study evaluated the effect of blue LED light irradiation on the pigments contents of ethephondegreened fruit and evaluated whether the blue LED light irradiation could influence the sensitivity of mandarin fruit to ethylene. The results indicated that blue light can accelerate the color change of ethephon-degreened fruit, accompanied by changes in plastid ultrastructure and chlorophyll and carotenoid contents. Ethephon-induced expressions of CitACS1, CitACO, CitETR1, CitEIN2, CitEIL1, and CitERF2 were enhanced by blue LED light irradiation, which increased the sensitivity to ethylene in ethephon-degreened fruits. These results indicate that blue LED light-induced changes in sensitivity to ethylene in mandarin fruit may be responsible for the improved coloration of ethephon-degreened mandarin fruits. KEYWORDS: mandarin, ethephon, degreening, blue LED light, sensitivity to ethylene, coloration

■

INTRODUCTION Fresh citrus fruit consumption is in great demand worldwide due to its high yield and nutritional value. However, in early season and early harvested citrus cultivars, the external fruit color seems to be imperfect since the fruits reach adequate internal quality for marketing when the peel is still green.1,2 Hence, the fruits generally are exposed to ethylene to promote fruit color change and to advance the commercial and marketing period.3,4 In the peel of citrus fruits, the induction of chlorophyll (Chl) degradation and carotenoid biosynthesis occurs during the ethylene-degreening process.5−7 Chlorophyllase (Chlase) plays a key role in the degradation of Chl. The expression of Chl genes greatly increase in response to ethylene treatment. In addition, ethylene may regulate the expression of other genes involved in the breakdown of Chl such as chlorophyll b reductase (CitNYC), pheophytin pheophorbide hydrolase (CitPPH), and pheide a oxygenase (CitPaO). Ethylene-induced degreening leads to carotenoid changes in the peel of citrus fruit, and differential responses of specific carotenoids to ethylene have also been demonstrated; the carotenoid pigments that increased the most in ethylenedegreened citrus fruit were those that contributed most to the orange and red colors such as β-cryptoxanthin (orange) and βcitraurin (reddish orange). Violaxanthin (yellow) also increased but to a lesser extent.8 In general, ethylene may play a role in inducing the expression of carotenoid biosynthesis genes such as phytoene synthase (CitPSY), ζ-carotene desaturase (CitZDS), β-carotene hydroxylase (CitCHYB), phytoene desaturase (CitPDS), β-lycopene cyclase (CitLCYB), and zeaxanthin epoxidase (CitZEP). Furthermore, the ethylene-stimulated color change from green to yellow is closely linked to structural changes in the plastids, specifically the conversion of chloroplasts to chromoplasts. In general, an abundance of chloroplasts exists in the green citrus peel. In addition, typical thylakoid structures and grana stacking are found in the fruits. During the color © XXXX American Chemical Society

change process, the thylakoid system gradually collapses and even disappears, accompanied by the formation of many chromoplasts in the citrus fruit.9,10 It has been reported that chromoplasts are the site at which carotenoid biosynthesis and accumulation occur.11 Chromoplasts vary in their morphology of carotenoid- accumulating substructures, and they can be classified as globular, crystalline, membranous, fibrillar, or tubular. 12 In the flavedo of pummelo, two types of chromoplasts were formed: one contained only plastoglobuli, while the other, which predominated, also contained unusually long achlorophyllous membranes.13 Although citrus fruits are nonclimacteric, the fruits are generally sensitive to exogenous ethylene. As previously mentioned, the degreening process is complex, and the changes in the sensitivity to ethylene may be related to different coloration in the peel of citrus fruits.1,14 For example, when ethylene was applied to tangerines, tangelos, and oranges, the Robinson tangerine fruit was the most sensitive to degreening and coloration.8 Moreover, differential expression of genes involved in ethylene biosynthesis and signaling pathways might be responsible for differential ethylene sensitivity of citrus fruit. In mature mandarin fruit, a type II ethylene receptor (ETR2) showed higher sensitivity to exogenous ethylene than two other type I ethylene receptors (CsETR1 and CsERS1), indicating ETR2 might be associated with low ethylene sensitivity in mature fruit.5 In another study, ethylene application resulted in a faster rate of color change in “Fallglo” than in “Lee × Orlando” since expressions of ETR1 and ETR2 were ethylene responsive in “Fallglo”, but only ETR1 expression was ethylene responsive in “Lee × Orlando”.15 In addition, different coloration of mutants of citrus fruits during both natural Received: Revised: Accepted: Published: A

April 12, 2017 June 8, 2017 July 3, 2017 July 3, 2017 DOI: 10.1021/acs.jafc.7b01703 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

distance from the lamp to the fruit was 40 cm, and the fruits were placed with the stem end up. After the 10-h treatments, the fruits were individually packaged into plastic polyethylene bags (a special packaging bag for mandarin fruit, area = 150 mm × 150 mm; thickness = 0.015 mm) and sealed, and then fruit were stored in the dark at room temperature (26 °C) and 85−90% RH for subsequent evaluations. The measurement of fruit color and sampling were conducted at 0, 1, 2, 3, 6, and 9 d after treatment. The initiation time of the treatments was marked as 0 d in storage. Each sampling comprised a total of 90 fruits per treatment separated into three replicates, with 30 fruits per replicate. After the peel color was measured, the equatorial part (1 cm) of the peel from each fruit was collected, combined, cut into small pieces, frozen immediately in liquid nitrogen, and stored at −80 °C prior to later use. Sample Preparation for Transmission Electron Microscopy (TEM). The sampling for TEM was conducted according to the method of Lado et al., with some modifications.24 Peel pieces (3 mm × 1 mm × 1 mm) from the equatorial part of the citrus fruit were fixed overnight in 2.5% glutaraldehyde (in 0.1 mol L−1 phosphate buffer, pH 6.8), rinsed three times in buffer, postfixed in phosphate-buffered 1.0% osmium tetroxide, rinsed in bidistilled water, and dehydrated by a graded ethanol series (50%, 70%, and 90%) followed by a graded acetone series (90% ethanol +90% acetone (1:1), 90%, and 100%). Prior to embedding in Araldite resin, the sample was soaked in 100% acetone + embedding agent (1:1) and then in the embedding agent (Araldite resin) for 3 and 2 h, respectively. Ultrathin sections were then cut from needed regions of the tissue, stained with saturated uranyl acetate in 70% ethanol solution, and then viewed on a Hitachi H-7500 transmission electron microscope (TEM) (Hitachi Limited, Tokyo, Japan). Extraction and Quantification of Chlorophyll and Total Carotenoids. One gram of rind was ground to a fine powder using liquid N2 and extracted using ethanol in the dark for 48 h. The absorbance of ethanol extracts was measured at 470, 649, and 665 nm, and the pigment contents were estimated according to the previous methods.25 Prior to the high-performance liquid chromatography (HPLC) analysis, carotenoid saponification was carried out according to the method reported by Noga and Lenz, with some modifications.26 The pigment/ethanol solution from the previous procedure was collected and concentrated to dryness and then redissolved in 4 mL of methyl tert-butyl ether (MTBE) containing 0.01% BHT, and 4 mL of 10% methanolic KOH was added for saponification in the dark overnight at room temperature. The sample was transferred to a separatory funnel. Then 4 mL of saturated NaCl solution and 8 mL of 0.01% BHT/ MTBE were added, and the aqueous layer was removed. Three additional saturated NaCl solution rinses were carried out by draining the aqueous layer after each rinse. The MTBE layer was then dried by N2 and redissolved in 0.01% BHT/MTBE. The sample was filtered through a Millipore nylon 0.22-μm filter prior to the HPLC analysis. Carotenoid Analysis by HPLC. A 20-μL volume of the extracted sample was analyzed by HPLC using a C30 carotenoid column (250 × 4.6 mm, 5 μm; YMC. Co., Ltd.) connected to a UV detector set at 450 nm. The mobile phases were MeOH−MTBE−H2O (81:15:4, v/v, eluent A) and MeOH−MTBE−H2O (10:90:4, v/v, eluent B), with the linear gradient program as follows: initial condition was 100% A to 60% B for 45 min followed by returning to the initial condition for reequilibration at a flow rate of 1 mL/min. The carotenoids were identified by comparison of the spectra and retention time with those of authentic standards, and the carotenoids were quantified using external standard calibrations. The HPLC grade β-carotene (β-Car) standard was purchased from Sigma (St. Louis, MO, USA), and β-Cry was purchased from CaroteNature GmbH (Lupsingen, Switzerland). Lutein (Lut), α-carotene (α-Car), zeaxanthin (Zea), and violaxanthin (Vio) were purchased from ChromaDex (Irvine, CA, USA).27,28 Total RNA Extraction and cDNA Synthesis. Approximately 0.3 g of each sample was extracted in 1 mL of Total RNA Extractor (TRIzol Reagent) and vortexed quickly, after which it sat idle for 5 min and was centrifuged at 12 000 × g for 15 min at 4 °C. An amount

ripening and in response to ethylene treatment suggest the differential expression of genes involved in ethylene signaling and biosynthesis.16 During the ethylene-induced degreening process, sensitivity of citrus fruit to the ethylene may also be influenced by external factors such as temperature.6 At high temperatures (30 °C and above), the color is poor in the peel of degreened fruits since ethylene-induced Chl degradation is accelerated but carotenoid biosynthesis is suppressed.8,17 Actually, ethephon or ethylene degreening is not a simple simulation of the “natural ripening process”. Visually, in our previous studies, we found that the peel colors of ethephondegreened mandarin fruit were pale and yellow-colored compared to “on-tree” matured fruit. Therefore, finding an alternative or assisted degreening method is important for improving the external quality of ethephon- or ethylenedegreened citrus fruit. Light is an important external environmental factor, and some studies have reported that light has an effect on the coloration of citrus fruits. For example, after the enclosing paper bag is removed from shaded citrus fruits, the citrus peels display a better color and increased content of β-cryptoxanthin (β-Cry).18 A similar result also has been found in red lightemitting diode (LED)-treated citrus fruit.19,20 In actuality, blue light also induced a more reddish color in chili peppers21 and tomato.22 Additionally, Zhang et al. reported that blue light irradiation improved the carotenoid content in the juice sacs of Satsuma mandarin and Valencia orange, and the response of both citrus fruits to blue light was also closely related to the light intensity.23 Although exogenous ethephon or light treatment alone contribute to some physiological and molecular responses, such as the degreening and coloration processes, there is little information about the combination of these two treatments. A previous study reported the combination of ethylene- and red LED light-treated fruits developed deeper yellow color than those treated with ethylene or red light treatment alone. However, our previous work conducted in 2014 and 2015 indicated that blue LED light might provide increased improvement in the peel color of ethephon-degreened mandarin fruit compared with that obtained using the red LED light (data not shown). According to the differential degreening behavior, we hypothesized that blue light treatment might alter the sensitivity of ethephon-degreened citrus to ethylene. The molecular elements that regulate the sensitivity of citrus to ethylene degreening treatment by blue LED light irradiation were also evaluated in this paper.

■

MATERIALS AND METHODS

Fruits Materials. Early season Satsuma mandarin (Citrus unshiu Marc.) fruits were harvested in mid-September from the Beibei District of Chongqing, China. In this stage, fruit flesh was mature, and fruit peel color was green (a* = −10.21 ± 0.12; b* = 34.10 ± 1.41). Disease- and damage-free fruits with a uniform size, color, and maturity were selected and used for this study. Treatments and Sampling. The fruits were immersed in a 1000 mg L−1 ethephon solution for 1 min (Zhou et al.2) and air-dried. The fruit were then continuously treated at 26 °C for 10 h under 300-lx blue LED lights (450 nm) [ETH+Blue(300 lx 10 h)] or under darkness (ETH), fruit immersed in water (without ethephon), and stored in the dark at 26 °C were used as control (Control). The experiment was conducted in a plant growth chamber (RDN-1000D, Chongqing Aiti Instruments Co., Ltd.), equipped with the blue LED light provided by Professor Muqing Liu of Fudan University). The B

DOI: 10.1021/acs.jafc.7b01703 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequences of Genes Related to Ethylene Biosynthesis, Perception, and Signal Transduction Used for Quantitative RT-PCR Reactions gene name

sense primer sequence (5′−3′)

CitActin CCAAGCAGCATGAAGATCAA Ethylene Biosynthesis Associated Genes CitACS1 TTCGAATCCACTAGGCACAACTT CitACS2 CACAGTGTTCACCAAGGAGTC CitACO TGGAGCACAGAGTGGTTTCTC Ethylene Perception and Signal Transduction Associated Genes CitETR1 TCGTCAGCAGAATCCTGTTGG CitETR2 AACTTCGCCCATCCATTGC CitETR3 GGCACAATAGCAAAGAAATTAAGGAG CitERS1 TTGTGGACTGACTCACTTCATAAGC CitCTR1 GTGGATGGCACCGGAAGTT CitEIN2 GAAAAGGATGATGATGAAGCAGATT CitEIL1 ACAGAGCAAGAGTAAGGAATGTGTTG CitEIL2 GGGCTGAAGATGAGCCAAACT CitERF1 TGATGGTCTCGTGATCAGTTCTTGTT CitERF2 CTCAAGCTTTAGCCGATTGTACCCA CitERF5 CAGCAAAGAACAGTAGCAAATCC CitERF6 GACGGGTCTTTATTGGATCTTTT CitERF7 CGCTTTCATTAGGAAGAAGGCTA CitERF13 AGGAATGGACCATATGAGTGATG

antisense primer sequence (5′−3′)

ref

ATCTGCTGGAAGGTGCTGAG

Yun et al.34

CAACGCTCGTGAACTTAGGAGA CGAGTAAATGATACCGACCCTAA GGATAGATCACAGCATCACTTCC

John-Karuppiah and Burns15 Distefano et al.16 Distefano et al.16

GGCCTTAATCTTGCTACTGGACA TCACCGTCAGCTAATAAAACTTGC CGTGCAAGACCCTGATAGTTAGG ATGACACAAAAGCACAAGCC GAATTTCTCCAAGGTTTTTGCAG GAAGCCGGACCATCAGACAT TCTTGTGCCCGAGACATCTTC CATAAGGTGGTTGTTGATTCGGTA CGCTAGACGTTGCCGTTGAATC GATCAGATTCGGCTAACTGCTCC CCTCTCGAAGCTACTGAGATCAA ATAGCCCATCAAAATTCTCGTCT GGGTCGGGTAACTTATTCAAATC TAGAAATTCCAGAGAAACGACGA

John-Karuppiah John-Karuppiah John-Karuppiah John-Karuppiah John-Karuppiah John-Karuppiah John-Karuppiah John-Karuppiah Yang et al.32 Alós et al.30 Xie et al.31 Xie et al.31 Xie et al.31 Yin et al.33

of 0.2 mL of chloroform was added to the collected supernatants, and the tubes were then shaken vigorously by hand for 15 s. Afterward, the mixture was incubated for 3 min at room temperature and then centrifuged. Isopropanol with an equal volume of supernatant (aqueous phase) was added, mixed well, incubated for 20 min, and then centrifuged. The supernatant was then discarded. The pellet was washed three times with 1 mL of 75% ethanol, vortexed briefly, and then centrifuged at 12 000 × g for 5 min. The wash was removed, and the RNA pellet was air-dried for 5−10 min. Then 50 μL of RNase-free ddH2O was used to redissolve the RNA pellet, and samples were stored at −80 °C.29 The extracted total RNA was reverse-transcribed to cDNA with the AMV First Strand cDNA Synthesis Kit (Sangon Biotech, Co., Ltd.) according to the manufacturer’s instructions. Real-Time Quantitative PCR (qRT-PCR) Analysis. Real-time quantitative PCR (qRT-PCR) was performed in a LightCycler480 with using its software (Roche, Shanghai, China). The PCR reaction contained 2 μL of reverse transcriptase mix (cDNA template), 10 μL of 2 × SG Fast qPCR Master Mix (Sangon Biotech, Co., Ltd.), and 0.4 μL of 10 μM of each primer, adding ddH2O to a final volume of 20 μL. The cycles were programmed as follows: one initial denaturing cycle at 95 °C for 3 min followed by 45 cycles of 95 °C for 7 s, 55 °C for 10 s and 72 °C for 15 s (Ma et al.;20 Wei et al.29). Three biological replicates were performed, and the primer names and corresponding sequences were designed according to some in the literature and listed in Table 1.15,16,30−34 The relative expression was normalized to the internal control (actin gene) with 2−ΔΔCT method. The untreated sample (control) was set as the calibrator for relative expression levels. Statistical Analysis. For all biochemical measurements, the data were analyzed using Excel 2013 and SPSS 16.0 software. Three replicates of all experiments were carried out (n = 3), and the results were expressed as the means ± standard error. The statistical comparisons were made by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. Differences were considered as significant at P < 0.05.

and and and and and and and and

Burns15 Burns15 Burns15 Burns15 Burns15 Burns15 Burns15 Burns15

Figure 1. Changes in the external color of ethephon-degreened mandarin fruit during storage (0, 1, 2, 3, 6, and 9 d). Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

■

RESULTS Effect of Blue LED Light Irradiation on Rind Color of Ethephon-Degreened Mandarin Fruit. The external appearance of the tested mandarin fruits is shown in Figure 1. Compared with the control, the degreened fruit had a distinct degreening and yellowing process. As expected, blue

LED irradiation visibly accelerated the color variation of ethephon-degreened fruit, especially on the part of pedicel. Nearly 9/10 of the fruit turned yellow on day 3. The results indicate that blue light treatment can greatly shorten the timeC


Article


Figure 2. TEM images showing the plastid ultrastructure of ethephon-degreened mandarin peels at 0, 3, 6, and 9 d of storage. t, thylakoids; Pg, plastoglobuli; mm, achlorophyllous membranes; s, starch grains; Igd, irregular gray droplets; m, mitochondria; r, ribosome. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

to-market of Satsuma mandarin fruits. In addition, the first 3 days of storage is a key time during which the sensitivity to ethylene was obvious between the fruit receiving the blue light and ethephon degreening combination and the fruit receiving ethephon degreening treatment only. Hence, this storage time was chosen to further evaluate the molecular mechanisms underlying the altered response to ethylene in blue lightirradiated mandarin fruits. Ultrastructural Changes of Plastids in EthephonDegreened Mandarin Fruit Peels. The ultrastructural changes of the rind plastids are shown in Figure 2. The result showed that the color change from green to yellow occurred slowly in the controls. At day 1, lens-shaped chloroplasts were the predominant plastids of the mandarin fruit peel, and many chloroplasts existed in the rind of green citrus fruits. The thylakoids, the site where chlorophyll exists, were arranged regularly, forming the typical grana structure. The ultrastructural changes were more evident in ethephon-degreened fruit than in the controls during prolonged storage. Moreover, obvious differences were observed between the ethephondegreened fruit and the blue LED light-irradiated fruit. After 3 d of ethephon application, the number of thylakoids decreased, and the lamellar structure was somewhat unclear. In addition, few plastoglobuli were also present in the rind of ethephondegreened fruit. At this time, the thylakoid system gradually became disorganized or disappeared, and the typical long, single thylakoids were formed. In the blue light-irradiated fruit, especially by day 6, many thylakoids disintegrated, and some disordered, long filamentous structures were formed. At the

same time, a higher abundance of plastoglobuli and long concentric achlorophyllous membranes were also observed. In contrast, the irregular low electron-dense droplet structure was observed in ethephon-degreened fruit. As the peel coloration progressed, chloroplasts were transformed into chromoplasts. On day 9 of storage, the number of chromoplasts in the blue light-irradiated mandarin fruits was much higher than in other groups, while in the control fruit the number of plastoglobuli was much higher than the numbers on days 3 and 6. Effect of Blue LED Light Irradiation on Chlorophyll a and b Contents of Ethephon-Degreened Mandarin Fruit Peels. The Chl a, Chl b, and total Chl contents in the blue light-irradiated mandarin fruits and ethephon-degreened mandarin fruit decreased rapidly during the storage (Figure 3). This difference was obvious during early storage; the blue LED light accelerated the Chl degradation, and thus, the levels of Chl a, Chl b and total Chl were lower than those of the other treatment groups. These results showed that the Chl degradation of degreened fruit was more sensitive to blue light treatment, especially during the first 3 days of storage. Effect of Blue LED Light Irradiation on Carotenoid Content and Composition in Ethephon-Degreened Mandarin Fruit Peels. As shown in Figure 4, changes in the total carotenoid contents and composition are shown. As storage time progressed, the total carotenoid contents showed a gradually increase. Interestingly, the total carotenoid contents increased slowly before the first 2 d of storage and then increased rapidly. Compared with the ethephon treatment, blue light irradiation enhanced the carotenoid levels, which were D


Article


cyclopropane-1-carboxylate synthase 1 (CitACS1), CitACS2, and 1-amino-cyclopropane-1-carboxylate oxidase (CitACO) was evaluated. As shown in Figure 5, the expression of CitACS1 increased and reached a maximum level at day 1, followed by a rapid decline thereafter. The ethephon application dramatically triggered the accumulation of CitACS1 mRNA. The ethephoninduced expression of CitACS1 was positively influenced by blue LED light. The CitACS1 transcript levels in the rind of blue light-irradiated fruit were approximately 71.36% and 38.47% higher than those in the ethephon-degreened fruit at 1 and 2 d of storage, respectively. The expression pattern of CitACO was similar to that of the CitACS1 gene. The levels of CitACO transcripts gradually accumulated in degreened citrus on day 1, which were increased by the blue light treatment. At that time, the expression of the CitACO gene was 85.53% higher in the blue light-degreened fruit than in the ethephondegreened fruit (P < 0.05). In contrast, the CitACS2 mRNA levels were higher in the control fruit. The external degreening treatment to a certain extent suppressed CitACS2 expression within 3 d of storage. Effect of Blue LED Light Irradiation on Gene Expression Associated with Ethylene Perception in Ethephon-Degreened Mandarin Peels. In this paper, we also analyzed the expression of four ethylene receptors, including ethylene response 1 (CitETR1), CitETR2, CitETR3, and ethylene response sensor 1 (CitERS1). Compared with the control fruit, fruit exposed to the ethephon degreening treatment showed higher expression levels of these four ethylene receptors (Figure 6). However, the changes in the expression levels of these ethylene receptors might be affected by the blue light irradiation. Under the blue light irradiation, CitETR1 and CitERS1 mRNA levels in the ethephon-degreened fruit showed moderate increasing trends on days 2 and 3, respectively. The expression levels of CitETR2 and CitETR3 were different than those of the above-mentioned ethylene receptor genes; expression of CitETR2 and CitETR3 was inhibited by the combination treatments but induced by ethephon alone. On day 1, CitETR2 and CitETR3 mRNA levels were higher in the ethephon- degreened fruit than in the combined degreened fruit. Effect of Blue LED Light Irradiation on Gene Expression Associated with Ethylene Signal Transduction in Ethephon-Degreened Mandarin Peels. Downstream signaling elements were observed in this work, and the results are shown in Figure 7. With the exception of the CitEIL2 gene, the expression levels of constitutive triple response 1 (CitCTR1), ethylene insensitive 2 (CitEIN2) and ethylene insensitive 3-like 1 (CitEIL1) had a positive response to external ethephon stimuli throughout the whole experimental period. In addition, in the ethephon-degreened citrus fruits, blue LED light caused different effects on the four downstream signaling genes. The stimulation of CitEIN2 and CitEIL1 genes by ethephon was enhanced by blue light irradiation during the different storage times. The increased changes in the expression of CitEIN2 were obvious on day 1, but the effects decreased slowly and even disappeared by day 3. In contrast, a higher accumulation of CitEIL1 mRNA in blue light-degreened fruit occurred at the later stage of storage. However, compared with the control fruit, the CitEIL2 expression was inhibited by both degreening treatments. Effect of Blue LED Light Irradiation on Expression of Ethylene Response Factors (ERFs) in EthephonDegreened Mandarin Peels. The ethylene response factors

Figure 3. Effect of blue LED light irradiation on chlorophyll (Chl) contents in the flavedo of ethephon-degreened mandarin fruit. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

higher than those in the other groups during the storage. In addition, the trends regarding the contents of violaxanthin (Vio), β-Cry, and zeaxanthin (Zea) were consistent with that of the total carotenoids. The ethephon treatment, to some degree, enhanced the accumulation of Vio, β-Cry, and Zea, especially in the later time of storage, and the effect was evident in the blue light-irradiated fruit. Among them, the β-Cry contents in blue LED light-irradiated fruit were 17.33, 61.64, and 94.26% higher than those in ethephon-degreened fruit after 3, 6, and 9 d of storage, respectively. In addition, the level of lutein (Lut) had a sustained increasing trend and peaked on day 6. On the other hand, β-carotene (β-Car) and α-carotene (α-Car) contents were both lower in degreened fruits. Effect of Blue LED Light Irradiation on Gene Expression Associated with Ethylene Biosynthesis in Ethephon-Degreened Mandarin Peels. The ethylene biosynthesis pathway is the first step of the response to ethylene. To study whether blue light irradiation might influence the biosynthesis of endogenous ethylene of ethephon-degreened fruit, the gene expression of 1-aminoE


Article


Figure 4. Effect of blue LED light irradiation on carotenoid (Car) contents in the flavedo of ethephon-degreened mandarin fruit. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

(ERFs) constitute the final step in the ethylene signaling pathway. In the current study, the expression of six ethylene response factors was detected. They exhibited different trends during the 3 d. As shown in Figure 8, the CitERF1 gene expression level showed a transient increasing trend for 2 d, while the expression of other genes decreased rapidly or slightly but then partly increased at the later storage stage. The expression of CitERF1, CitERF5, and CitERF6 were significantly up-regulated by the ethephon treatment. Ethephon degreening had no significant effect on the expression levels of CitERF2

and CitERF13 compared with those of the control fruit, and degreening had a negative effect on the expression of the CitERF7 gene. Furthermore, in the blue LED-irradiated fruit, the expression levels of CitERF2, CitERF5, CitERF6, and CitERF7 were higher than those of fruit treated with ethephon alone. The altered sensitivity of blue light-degreened fruit to ethylene seemed to be time dependent. Among them, the sensitivity to ethylene was 73.86% higher for CitERF2 in blue light-treated fruit than in ethephon-treated fruit on day 1. F


Article


total Chl had a rapid response to the ethylene treatment; this response reduced the Chl a, Chl b, and total Chl levels, and the rate of reduction reached its peak on day 1. In addition, under the blue light irradiation, Chl a, Chl b, and total Chl of ethephon-treated fruit had lower contents and faster reduction rates, especially during the first 3 d of storage. In addition to the loss of Chl a, Chl b, and total Chl, the degreening process in the flavedo of mandarin fruit was also accompanied by an increase in the contents of carotenoids. The blue LED light irradiation induced the accumulation of total carotenoids in ethephondegreened fruit. Some key colored individual carotenoids, including Vio, lutein, Zea, and β-Cry, were the critical pigments that greatly responded to the blue LED light irradiation treatment (Figure 4). Similar results were also found in clementine fruits.38 The Chl and carotenoid pigments changed in our proposed degreening treatment were related to the changes in the plastid ultrastructure. The chloroplast changes were in agreement with those of previous reports.9,13,24 The stacked thylakoids arranged in typical chloroplastic grana usually showed disassembled thylakoid membranes, which may possibly coincide with the loss of Chl and the loss of specific chloroplastic carotenoids such as α- and β-carotene (Figure 2, 3 and 4). Different chromoplast structures were then detected. Plastoglobuli are common chromoplast structures, and the presence of plastoglobuli has also been reported in different citrus species such as pummelo,13 kumquat,39 Valencia orange,10 and Satsuma mandarin.9 Moreover, compared with the ethylene alone treatment, blue light increased the number of plastoglobuli (Figure 2). This result indicated a higher accumulation of xanthophyll (Figure 4) since it has been proposed that plastoglobuli may provide the key site for xanthophyll accumulation in oranges.10 Achlorophyllous membranes were also found in tomato40 and pummel,13 and their presence influences carotenoid biosynthesis. In the blue LED lightirradiated fruit, achlorophyllous membranes were detected after 6 d of treatment, which paralleled the accumulation of carotenoids (Figure 2 and 4). In contrast, these membranes structures were not present in the ethephon-degreened fruit. Different chromoplast structures, which appeared as irregular gray droplets, occurred at a later storage period (6 and 9 d after storage). Similar results were also described in the chromoplasts of grapefruit.24 Different ethylene responses between the ethephon treatment alone and the blue light plus ethephon treatments might be due to changes in ethylene biosynthesis, perception, and signal transduction. In this paper, the expressions of CitACS1 and CitACO were up-regulated by ethephon treatment, which was similar to results previously described in Valencia orange and mandarin fruits.15,30,41 Moreover, the blue LED light significantly induced their transcription levels in the ethephontreated fruit. This phenomenon might relate to results found in previous studies, as it has been reported that nonclimacteric citrus fruits have system I- and system II-like pathways of ethylene biosynthesis, and the CitACS1 gene mainly participates in system II-like ethylene biosynthesis.41,42 On the other hand, the changes in the expression of ethylene biosynthesis genes could also affect changes in response to ethylene in fruits. Trainotti et al. reported that ethylene increased the expression of FaACO1 in strawberries, which showed an increase in response to ethylene.43 However, in the present study, the expression of the CitACS2 gene was inhibited by the ethephon degreening treatment, but the presence of blue LED light had

Figure 5. Effect of blue LED light irradiation on gene expression associated with ethylene biosynthesis in ethephon-degreened mandarin peels. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

However, the expression of both CitERF5 and CitERF6 was more sensitive to ethylene, especially on day 3.

■

DISCUSSION A positive effect of ethylene on the coloration in the peel of different varieties of citrus fruits has been proven.8,35 Generally, ethylene fumigation requires expensive degreening facilities to deliver perfect coloration effects. In light of this, 2chloroethylphosphonic acid (ethephon), an ethylene-releasing chemical, is applied extensively in China.2 Despite this fact, blue LED light treatment alone was shown improve the citrus coloration to a certain extent. However, during the short degreening time (Figure 1), this effect was not evident by the treatment (data not shown). Conversely, in the present study, we found that the color change in the peel of ethephondegreened Satsuma mandarin fruits was accelerated markedly by treatment with blue LED light irradiation (Figure 1). The coloration change is closely related to the Chl and carotenoid pigment mechanisms.36,37 Clearly, Chl a, Chl b, and G


Article


Figure 6. Effect of blue LED light irradiation on gene expression associated with ethylene perception in ethephon-degreened mandarin peels. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

Figure 7. Effect of blue LED light irradiation on gene expression associated with ethylene signal transduction in ethephon-degreened mandarin peels. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

CitETR2, CitETR3, and CitERS1 did not respond to ethylene when the degreened fruits were exposed to the blue LED light, showing little effect on ethylene sensitivity. Downstream of the receptors in the ethylene signaling pathway is CTR1 (constitutive triple response 1), EIN2 (ethylene insensitive 2), and EIN3-like (EIL), in sequence. EIN2 is a positive regulator in the ethylene signaling pathway.46 In the present study, blue LED light might enhance the expression of CitEIN2 and CitEIL1 in the ethephon-degreened fruit, which might explain the differences of both degreened

no effect on this phenomenon. A previous study also indicated that ACS2 seemed to exert a subsidiary role.44 Many studies have demonstrated that gene expression levels of ethylene receptors are responsive to ethylene and that their expression levels usually are enhanced by ethylene.15,30,45 Similar results were also found for the CitETR1, CitETR2, CitETR3, and CitERS1 genes in this paper. In addition, compared with the ethephon treatment, blue light transiently increased the expression of CitETR1, which affected the sensitivity of the mandarin fruit to ethylene. However, H


Article


Figure 8. Effect of blue LED light irradiation on expression of ethylene response factors (ERFs) in ethephon-degreened mandarin peels. Control, the untreated group; ETH, ethephon treatment; ETH+Blue (300 lx 10 h), ethephon and blue LED light treatment. All treated fruits were stored at room temperature (26 °C) and 85−90% RH.

■

citrus fruits in response to ethylene. Six ERFs (CitERF1, CitERF2, CitERF5, CitERF6, CitERF7, and CitERF13) were also discussed during the degreening process of mandarin fruit. CitERF5, CitERF6, CitERF7, and CitERF13 have significant negative correlations with chlorophyll content in citrus fruits (Xie et al.31); however, in the present study blue LED light treatments were ineffective at stimulating changes in the expression levels of these genes in ethephon-degreened fruit. At the same time, this contrasts the results of a recent study, which demonstrated that CitERF13 gene expression was induced by ethylene treatment. The differences in ethylene concentration (40 ppm), fruit maturity, and storage duration may lead to these differences in results.33 Indeed, the degreening process is complicated and generally is affected by endogenous and exogenous factors.4,35 Moreover, compared with the ethephontreated fruit, the expression levels of CitERF2 in the blue lightdegreened fruit were higher, indicating that CitERF2 is involved in the ethylene response. Similar results also have been reported in tomato.47 Taken together, these results suggest that altered sensitivity of mandarin fruit to ethylene treatment under blue LED light irradiation might promote the degreening citrus fruit coloration.

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: +86 23 68250374. Fax: +86 23 68250374. ORCID

Kaifang Zeng: 0000-0003-3122-8852 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We would like to thank Professor Muqing Liu of Department of Electrical Light Sources and Illuminating Engineering, Fudan University, for providing the LED light and technology support and helpful advice. This study was funded by the National Natural Science Foundation of China (Grant No. 31401540), Special Foundation of Chongqing Postdoctoral Science (Xm2014106), and the Projects in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (2015BAD16B07).

■

ABBREVIATIONS USED Chl, chlorophylls; β-Cry, β-cryptoxanthin; LED, light-emitting diode; BHT, 2,6-di-tert-butyl-methylphenol; MTBE, methyl tert-butyl ether; β-Car, β-carotene; Lut, lutein; α-Car, αI


Article


(19) Ma, G.; Zhang, L.; Kato, M.; Yamawaki, K.; Kiriiwa, Y.; Yahata, M.; Ikoma, Y.; Matsumoto, H. Effect of blue and red led light irradiation on beta-cryptoxanthin accumulation in the flavedo of citrus fruits. J. Agric. Food Chem. 2012, 60, 197−201. (20) Ma, G.; Zhang, L.; Kato, M.; Yamawaki, K.; Kiriiwa, Y.; Yahata, M.; Ikoma, Y.; Matsumoto, H. Effect of the combination of ethylene and red LED light irradiation on carotenoid accumulation and carotenogenic gene expression in the flavedo of citrus fruit. Postharvest Biol. Technol. 2015, 99, 99−104. (21) Gangadhar, B. H.; Mishra, R. K.; Pandian, G.; Park, S. W. Comparative study of color, pungency, and biochemical composition in chili pepper (Capsicum annuum) under different light-emitting diode treatments. HortScience 2012, 47, 1729−1735. (22) Xu, H. L.; Xu, Q.; Li, F.; Feng, Y.; Qin, F.; Fang, W. Applications of xerophytophysiology in plant production-LED blue light as a stimulus improved the tomato crop. Sci. Hortic. 2012, 148, 190−196. (23) Zhang, L. C.; Ma, G.; Yamawaki, K.; Ikoma, Y.; Matsumoto, H.; Yoshioka, T.; Ohta, S.; Kato, M. Effect of blue LED light intensity on carotenoid accumulation in citrus juice sacs. J. Plant Physiol. 2015, 188, 58−63. (24) Lado, J.; Zacarias, L.; Gurrea, A.; Page, A.; Stead, A.; Rodrigo, M. J. Exploring the diversity in Citrus fruit colouration to decipher the relationship between plastid ultrastructure and carotenoid composition. Planta 2015, 242, 645−661. (25) Lichtenthaler, H. K.; Wellburn, A. R. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem. Soc. Trans. 1983, 11, 591−592. (26) Noga, G.; Lenz, F. Separation of citrus carotenoids by reversedphase high-performance liquid chromatography. Chromatographia 1983, 17, 139−142. (27) Tao, N. G.; Hu, Z. Y.; Liu, Q.; Xu, J.; Cheng, Y. J.; Guo, L. L.; Guo, W. W.; Deng, X. X. Expression of phytoene synthase gene (Psy) is enhanced during fruit ripening of Cara Cara navel orange (Citrus sinensis Osbeck). Plant Cell Rep. 2007, 26, 837−843. (28) Tao, N. G.; Wang, C. G.; Xu, J.; Cheng, Y. J. Carotenoid accumulation in postharvest ″Cara Cara″ navel orange (Citrus sinensis Osbeck) fruits stored at different temperatures was transcriptionally regulated in a tissue-dependent manner. Plant Cell Rep. 2012, 31, 1667−1676. (29) Wei, X.; Chen, C. X.; Yu, Q. B.; Gady, A.; Yu, Y.; Liang, G. L.; Gmitter, F. G., Jr Novel expression patterns of carotenoid pathwayrelated genes in citrus leaves and maturing fruits. Tree Genet. Genom. 2014, 10, 439−448. (30) Alós, E.; Distefano, G.; Rodrigo, M. J.; Gentile, A.; Zacarías, L. Altered sensitivity to ethylene in ‘Tardivo’, a late-ripening mutant of Clementine mandarin. Physiol. Plant. 2014, 151, 507−521. (31) Xie, X. L.; Shen, S. L.; Yin, X. R.; Xu, Q.; Sun, C. D.; Grierson, D.; Ferguson, I.; Chen, K. S. Isolation, classification and transcription profiles of the AP2/ERF transcription factor superfamily in citrus. Mol. Biol. Rep. 2014, 41, 4261−4271. (32) Yang, X. Y.; Xie, J. X.; Lu, X. P.; Liu, Y. Z.; Peng, S. A. Isolation of a Citrus ethylene-responsive element binding factor gene and its expression in response to abiotic stress, girdling and shading. Sci. Hortic. 2011, 127, 275−281. (33) Yin, X. R.; Xie, X. L.; Xia, X. J.; Yu, J. Q.; Ferguson, I. B.; Giovannoni, J. J.; Chen, K. S. Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening. Plant J. 2016, 86, 403−412. (34) Yun, Z.; Jin, S.; Ding, Y. D.; Wang, Z.; Gao, H. J.; Pan, Z. Y.; Xu, J.; Cheng, Y. J.; Deng, X. X. Comparative transcriptomics and proteomics analysis of citrus fruit, to improve understanding of the effect of low temperature on maintaining fruit quality during lengthy post-harvest storage. J. Exp. Bot. 2012, 63, 2873−2893. (35) Cronje, P. J. R.; Barry, G. H.; Huysamer, M. Postharvest rind breakdown of ’Nules Clementine’ mandarin is influenced by ethylene application, storage temperature and storage duration. Postharvest Biol. Technol. 2011, 60, 192−201.

carotene; Zea, zeaxanthin; Vio, violaxanthin; ACS, 1-aminocyclopropane-1-carboxylate synthase; ACO, 1-amino-cyclopropane-1-carboxylate oxidase; ERS1, ethylene response sensor; ETR, ethylene response; CTR1, constitutive triple response 1; EIN, ethylene insensitive; EIL, ethylene insensitive 3-like; ethylene response factor, ERF

■

REFERENCES

(1) Sdiri, S.; Navarro, P.; Monterde, A.; Benabda, J.; Salvador, A. New degreening treatments to improve the quality of citrus fruit combining different periods with and without ethylene exposure. Postharvest Biol. Technol. 2012, 63, 25−32. (2) Zhou, J. Y.; Sun, C. D.; Zhang, L. L.; Dai, X.; Xu, C. J.; Chen, K. S. Preferential accumulation of orange-colored carotenoids in Ponkan (Citrus reticulata) fruit peel following postharvest application of ethylene or ethephon. Sci. Hortic. 2010, 126, 229−235. (3) Poole, N. D.; Gray, K. Quality in citrus fruit: to degreen or not degreen? Br. Food J. 2002, 104, 492−505. (4) Porat, R. Degreening of citrus fruit. Tree and Forestry Science and Biotechnology 2008, 2, 71−76. (5) Fujii, H.; Shimada, T.; Sugiyama, A.; Nishikawa, F.; Endo, T.; Nakano, M.; Ikoma, Y.; Shimizu, T.; Omura, M. Profiling ethyleneresponsive genes in mature mandarin fruit using a citrus 22K oligoarray. Plant Sci. 2007, 173, 340−348. (6) Matsumoto, H.; Ikoma, Y.; Kato, M.; Nakajima, N.; Hasegawa, Y. Effect of postharvest temperature and ethylene on carotenoid accumulation in the flavedo and juice sacs of Satsuma mandarin (Citrus unshiu Marc.) fruit. J. Agric. Food Chem. 2009, 57, 4724−4732. (7) Purvis, A. C.; Barmore, C. R. Involvement of ethylene in chlorophyll degradation in peel of citrus fruits. Plant Physiol. 1981, 68, 854−856. (8) Stewart, I.; Wheaton, T. A. Carotenoids in citrus:Their accumulation induced by ethylene. J. Agric. Food Chem. 1972, 20, 448−449. (9) Shimokawa, K.; Sakanoshita, A.; Horiba, K. Ethylene-induced changes of chloroplast structure in Satsuma mandarin (Citrus unshiu Marc.). Plant Cell Physiol. 1978, 19, 229−236. (10) Thomson, W. W. Ultrastructural development of chromoplasts in valencia oranges. Bot. Gaz. 1966, 127, 133−139. (11) Zeng, Y. L.; Pan, Z. Y.; Ding, Y. D.; Zhu, A. D.; Cao, H. B.; Xu, Q.; Deng, X. X. A proteomic analysis of the chromoplasts isolated from sweet orange fruits Citrus sinensis (L.) Osbeck. J. Exp. Bot. 2011, 62, 5297−5309. (12) Egea, I.; Barsan, C.; Bian, W.; Purgatto, E.; Latche, A.; Chervin, C.; Bouzayen, M.; Pech, J. C. Chromoplast differentiation: current status and perspectives. Plant Cell Physiol. 2010, 51, 1601−1611. (13) Gross, J.; Timberg, R.; Graef, M. Pigment and ultrastructuralchanges in the developing pummelo citrus-grandis-goliath. Bot. Gaz. 1983, 144, 401−406. (14) Alonso, J. M.; Chamarro, J.; Granell, A. Evidence for the involvement of ethylene in the expression of specific rnas during maturation of the orange, a nonclimacteric fruit. Plant Mol. Biol. 1995, 29, 385−390. (15) John-Karuppiah, K. J.; Burns, J. K. Degreening behavior in ’Fallglo’ and ’Lee x Orlando’ is correlated with differential expression of ethylene signaling and biosynthesis genes. Postharvest Biol. Technol. 2010, 58, 185−193. (16) Distefano, G.; Las Casas, G.; Caruso, M.; Todaro, A.; Rapisarda, P.; La Malfa, S.; Gentile, A.; Tribulato, E. Physiological and Molecular Analysis of the Maturation Process in Fruits of Clementine Mandarin and One of Its Late-Ripening Mutants. J. Agric. Food Chem. 2009, 57, 7974−7982. (17) Cohen, E. Effect of temperature and relative humidity during degreening on coloring of shamouti orange fruit. J. Hortic. Sci. 1978, 53, 143−146. (18) Tao, J.; Zhang, S. L.; An, X. M.; Zhao, Z. Z. Effects of light on carotenoid biosynthesis and color formation of citrus fruit peel. Ying Yong Sheng Tai Xue Bao 2003, 14, 1833−1836. J


Article

Journal of Agricultural and Food Chemistry (36) Jacob-Wilk, D.; Holland, D.; Goldschmidt, E. E.; Riov, J.; Eyal, Y. Chlorophyll breakdown by chlorophyllase: isolation and functional expression of the Chlase1 gene from ethylene-treated Citrus fruit and its regulation during development. Plant J. 1999, 20, 653−661. (37) Rodrigo, M. J.; Zacarias, L. Effect of postharvest ethylene treatment on carotenoid accumulation and the expression of carotenoid biosynthetic genes in the flavedo of orange (Citrus sinensis L. Osbeck) fruit. Postharvest Biol. Technol. 2007, 43, 14−22. (38) Alos, E.; Cercos, M.; Rodrigo, M. J.; Zacarias, L.; Talon, M. Regulation of color break in citrus fruits. Changes in pigment profiling and gene expression induced by gibberellins and nitrate, two ripening retardants. J. Agric. Food Chem. 2006, 54, 4888−4895. (39) Huyskens, S.; Timberg, R.; Gross, J. Pigment and plastid ultrastructural-changes in kumquat (fortunella-margarita) nagami during ripening. J. Plant Physiol. 1985, 118, 61−72. (40) Nogueira, M.; Mora, L.; Enfissi, E. M. A.; Bramley, P. M.; Fraser, P. D. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations. Plant Cell 2013, 25, 4560−4579. (41) Yuan, R. C.; Wu, Z. C.; Kostenyuk, I. A.; Burns, J. K. G-proteincoupled alpha(2A)- adrenoreceptor agonists differentially alter citrus leaf and fruit abscission by affecting expression of ACC synthase and ACC oxidase. J. Exp. Bot. 2005, 56, 1867−1875. (42) Katz, E.; Lagunes, P. M.; Riov, J.; Weiss, D.; Goldschmidt, E. E. Molecular and physiological evidence suggests the existence of a system II-like pathway of ethylene production in non-climacteric Citrus fruit. Planta 2004, 219, 243−252. (43) Trainotti, L.; Pavanello, A.; Casadoro, G. Different ethylene receptors show an increased expression during the ripening of strawberries: does such an increment imply a role for ethylene in the ripening of these non-climacteric fruits? J. Exp. Bot. 2005, 56, 2037−2046. (44) Marcos, J. F.; Gonzalez-Candelas, L.; Zacarias, L. Involvement of ethylene biosynthesis and perception in the susceptibility of citrus fruits to Penicillium digitatum infection and the accumulation of defence-related mRNAs. J. Exp. Bot. 2005, 56, 2183−2193. (45) Yin, X. R.; Chen, K. S.; Allan, A. C.; Wu, R. M.; Zhang, B.; Lallu, N.; Ferguson, I. B. Ethylene-induced modulation of genes associated with the ethylene signalling pathway in ripening kiwifruit. J. Exp. Bot. 2008, 59, 2097−2108. (46) Alonso, J. M.; Hirayama, T.; Roman, G.; Nourizadeh, S.; Ecker, J. R. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 1999, 284, 2148−2152. (47) Zhang, Z.; Zhang, H.; Quan, R.; Wang, X. C.; Huang, R. Transcriptional Regulation of the Ethylene Response Factor LeERF2 in the Expression of Ethylene Biosynthesis Genes Controls Ethylene Production in Tomato and Tobacco. Plant Physiol. 2009, 150, 365− 377.

K


Sensitivity to Ethephon Degreening Treatment is Altered by Blue LED

Recommend Documents