siRNA delivery using cationic lipid based highly selective human DNA

Dec 19, 2017 - Present article illustrates the serendipitous discovery of a cationic lipid based human DNA ligase I inhibitor and development of siRNA...
0 downloads 10 Views 575KB Size
Download PDF
Subscriber access provided by READING UNIV

Article

siRNA delivery using cationic lipid based highly selective human DNA ligase I inhibitor Surendar Reddy Bathula, Komal Sharma, Deependra Singh, Muktapuram P. Reddy, Pushpa Ragini Sajja, Amit L Deshmukh, and Dibyendu Banerjee ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b19193 • Publication Date (Web): 19 Dec 2017 Downloaded from http://pubs.acs.org on December 19, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

siRNA delivery using cationic lipid based highly selective human DNA ligase I inhibitor Surendar R. Bathula,*‡ Komal Sharma,‡$ Deependra K. Singh,§$ Muktapuram P. Reddy, ‡$ Pushpa R. Sajja, ‡Amit L. Deshmukh,§ Dibyendu Banerjee*§ ‡Division of Natural Products Chemistry, CSIR-Indian Institute of Chemical Technology, Hyderabad -500007, India. §Molecular and Structural Biology Division, CSIR-Central Drug Research Institute, Lucknow-226 031, U.P., India. $ Authors contributed equally

KEYWORDS: Cationic lipids, human DNA ligase I inhibitors, siRNA delivery, cancer gene therapy, non-viral vectors, cationic liposomes ABSTRACT: Present article illustrates the serendipitous discovery of a cationic lipid based human DNA ligase I inhibitor and development of siRNA delivering, human DNA ligase I targeted cationic lipid based non-viral vector. We have tested a small in house library of structurally similar cationic lipo-anisamides for anti-ligase activity and amongst tested, N-dodecyl-N- (2-(4methoxybenzamido)ethyl)-N- methyldodecan-1- ammonium iodide (C12M) selectively and efficiently inhibited the enzyme activity of human DNA ligase I, compared to other human ligases (hLigIIIβ and hLigIV/XRCC4) and bacterial T4 DNA ligase. Furthermore, upon hydration with equimolar cholesterol C12M produced anti-ligase cationic liposomes which transfected survivin siRNA and showed significant inhibition of tumor growth.

INTRODUCTION Permanently charged cationic lipids (PCCLs) are widely used excipients along with genetic medicines in nanoparticle formulations.1-5 PCCLs entrap and transiently mask the negative charge of plasmid-DNA as well as siRNA to facilitate their intracellular entry.6-8 Numerous lipids with different structural traits were reported in order to assess nucleic acid transfection ability and many of them are available through commercial sources.9-14 However, toxicity is the major bottleneck associated with their clinical usage. Incidentally, to limit the toxicity of cationic lipids various research groups have reported attractive strategies i.e use of redox sensitive cationic lipids,15 employing peptide and nucleoside based lipids,16 administration of lipoplexes via local injection17 and using injection that targets a selected organ due to physic-chemical properties e.g lung.18 Recently, ionizable cationic lipids emerged as an alternative vectors with low toxicity and immunogenicity. But the transfection efficiency of the above lipids is highly dependent on endosomal pH and requires endosomal escape enhancers.19 A practical step forward to this end would be to develop non-toxic PCCLs which can effectively deliver genetic medicines. In this regard, mimicking the concept of molecularly targeted drugs20 which successfully solved the toxicity related issues of the conventional chemotherapeutic agents can offer a solution. Like molecularly targeted anticancer drugs, developing molecularly targeted cationic lipids (MTCL) which can deliver genetic medicines will offer an attractive strategy to reduce the toxicity of cationic lipids. Current manuscript illustrates the serendipitous discovery of siRNA transfecting MTCL which inhibit ligation by directly binding with human DNA ligase (hLig) I. Ligases are fundamental proteins for DNA replication and repair. They catalyse the formation of phosphodiester bonds between adjacent 5’-phosphoryl and 3’-hydroxyl termini at single strand breaks in duplex DNA molecules.21,22 Among the three forms of human ligases (i.e., human DNA ligase I, III, IV),

Scheme 1: Represents general structure of lipo-anisamides.

hLigI is the major form in replicating cells.23,24 Inhibiting ligases leads to accumulation of DNA strand breaks in the cells that are lethal at high concentrations. Reports also confirm that the levels of DNA ligases are higher in cancer cells compared to normal cells that do not replicate all the time.25 Earlier, we have reported seventeen anisamide based cationic lipids with varying alkyl chain lengths starting from C2-C18 carbon atoms with an objective to develop bifunctional molecule possessing both drug targeting as well as antiproliferative activity.26 Compounds with medium-length alkyl chains (C7-C12) showed selective anticancer activity. Furthermore, molecule with a ten carbon chain-length (C10M) showed selective interactions with CDK2 protein and mediated siRNA delivery. In continuation with our efforts to develop clinically safe and effective siRNA delivery vectors, herein we report new class of PCCL which targets hLigI, produce anti-ligase cationic liposomes upon hydration along with equimolar cholesterol and transfects siRNA. In this regard, we have screened medium alkyl chain (C7-C14) lipoanisamides against hLigI. Experimental data indicates that among the structurally similar cationic lipo-anisamides, N-dodecyl-N(2-(4methoxybenzamido)ethyl)-N- methyldodecan-1- ammonium iodide (C12M) efficiently inhibited the enzyme activity of hLigI. Furthermore, C12M showed selectivity to hLigI compared to other human ligases (hLigIIIβ and hLigIV/XRCC4) and bacterial T4 DNA ligase. Finally, C12M produced anti-

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

lgase cationic liposomes and successfully delivered survivin siRNA in PC-3 cells.

bromophenol blue], samples were separated by 6.5% native PAGE and bands were detected by Image Quant LAS4010.

EXPERIMENTAL SECTION:

In-vitro fluorescence quenching assay by spectrofluorometer: For the interaction study of compound with DNA and protein we performed in-vitro fluorescence quenching assays. Any compound can interact with DNA by atleast three different ways (intercalation, major groove binding and minor groove binding) which can be studied by spectrofluorometer. For the study of DNA intercalation 50 µg DNA was completely saturated with 20 µM of ETBR then the intercalated ETBR was displaced with increasing concentrations of C12M (5 and 10 µM). The emission spectra (λem) was recorded at 500-700 nm after the excitation (λex) at 485nm.To study if the compound could bind to minor groove of DNA 50 µg DNA was completely saturated with 2 µM of DAPI then bound DAPI was displaced with increasing concentrations of C12M (5 and 10 µM). The λem was recorded at 400-550 nm after excitation at 358 nm. For the study of major groove DNA binding, 50 µg DNA completely saturated with 15 µM of Methyl Green was challenged with increasing concentration of C12M. The λem was recorded at 650-750 nm after the excitation at 630 nm. For the study of interaction between compound and protein, 10 pmol proteins were incubated with different concentrations of C12M (5 and 10 µM). The λem was recorded at 300-400 nm after the excitation at 280 nm.

Fluorescence Based Ligation Assay: Fluorescence based ligation assays27 were performed to check the ability of the synthesized compounds to inhibit hLigI enzymatic activity. The DNA molecules 52 mer (5’GTACGTCGATCGATTGGTAGATCAGGGTCTATGTATGT CAGTGAGATAGTAC-3’), was annealed with 25-mer (5′CTGATCTACCAATCGATCGACGTAC-3′) and 5′ fluorescent (Cy3) labelled 27 mer (5′/5Cy3/GTACTATCTCACTGACATACATAGAC A-3′) oligos to construct a double stranded nicked substrate for the ligase enzyme. Reaction mixture (20 µL) containing 1 pmol of labelled DNA substrate and hLigI (0.2 pmol) in ligation buffer (50 mM Tris Cl (pH 7.5), 10 mM MgCl2, 0.25 mg/mL BSA, NaCl (100 mM) and 500 µM ATP) was incubated in the absence or presence of HTS 01682 at 100 µM (positive control) and inhibitors (C7M-C14M at 5 µM conc.) at 37°C for 30 min. Reactions were stopped by adding 10 µL of ligaton stop buffer (90% Formamide, 10% 50 mM EDTA). The ligated DNA molecule is larger in size and runs higher up on a denaturing gel containing 7 M urea and 12% acrylamide. If an inhibitor is added to the reaction mixture, this would inhibit ligation and lead to a corresponding loss of ligated product in the gel. The gel picture captured by Image Quant Las 4010 and the band's intensity calculated by 1D gel analysis tool of Image Quant TL software was used to determine the inhibition activity. The ligated band for solvent (DMSO) control lane was taken as 100% ligation and the intensity of ligated bands in other lanes were calculated with respect to this lane. DNA gel retardation assay: To determine whether the inhibition of ligation occurs due to sequestration of DNA due to intercalation with the test compound rather than a specific interaction with the ligase protein, we performed the DNA gel retardation assay.27 We incubated 100 ng of linearized pUC18 DNA with 100 µM of either the test compounds C11M, C12M, C13M or with Doxorubicin (known DNA intercalator and positive control) or CTAB (cationic lipid) for 30 min at 37 ºC. Reaction products were resolved on a 1% agarose gel at 5.3 V/cm. Gel was visualized by ethidium bromide staining after the run. Electrophoretic Mobility Shift Assay (EMSA): EMSA28 was performed as described previously. We used a non-ligatable, nicked, double stranded DNA substrate. Briefly, the substrate is made up of three different oligos (25 mer, 27 mer and 52 mer) in which 5′ end of 27-mer oligo ((5′-/56FAM/GTACTATCTCACTGACATA CATAGAC/3ddc/-3′) was tagged with FAM for easy detection of DNA substrate and 3′ end was dideoxy modified for creating the non ligatable nick. The other two oligos were a 25-mer (5′CTGATCTACCAATCGATCGACGTAC-3′) and a 52-mer (5′GTACGTCGATCGATTGGTA GATCAGGGTCTATGTATGTCAGTGAGATAGTAC-3′). The 25 mer oligo was phophorylated with T4 polynucleotide kinase and annealed with 27 and 52 mer oligos to obtain a nonligatable ds nicked substrate for hLigI protein. We incubated 10 pmole of hLigI with 100 µM inhibitor (C11M-C13M) and 2 pmole of DNA substrate in a ligation buffer containing Tris-Cl (50 mM, pH 7.5), MgCl2 (10 mM), BSA (0.25 mg/mL), NaCl (100 mM) and ATP (500 µM), in a reaction volume of 20 µL, for two hours on ice. After the addition of 10 µL of native gel buffer [50 mM TrisCl (pH7.5), 20% glycerol, 0.05%

Native gel electrophoresis: We have also performed native gel electrophoresis to study the direct interaction between hLigI and C12M. First we incubated hLigI (25 pmol) with increasing concentrations of C12M (25, 50, 100 µM) at 4°C for 2 h in the ligation buffer (Tris-Cl (50 mM, pH 7.5), MgCl2 (10 mM), BSA (0.25 mg/mL), NaCl (100 mM) and ATP (500 µM)). After the addition of 10 µL of native gel buffer (50 mM TrisCl pH 7.5), 20% glycerol, 0.05% Bromophenol blue), samples were separated on 6.5% native PAGE and bands were detected by Coomassie blue staining. Circular Dichroism (CD) spectroscopy studies: The compound C12M induced conformational changes in the hLigI protein. This was studied by CD spectroscopy.29 10 pmol purified hLigI was resuspended in CD buffer (10mM Tris ph7.5, 10mM Nacl, 0.1mM EDTA) in absence or prescence of C7M. The spectrum was recorded at a wavelength of 195-250 nm at 4°C with a JASCO J-810 spectropolarimeter. Following equation calculated the mean residual ellipticity. [θ] = 100(signal)/Cnl, where [θ] = mean residue ellipticity in deg cm2 dmol-1, signal = raw output in mdeg, C = protein concentration in mM, n = amino acid residues, l = cell pathlength in cm. The graph was generated by plotting the value of mean residue ellipticity in deg cm2 dmol-1 with respect to wavelength. Liposome and lipoplex preparation: Liposomes of C12M were prepared with cholesterol as co-lipid by ethanol injection method. In ethanol C12M and cholesterol were taken in 1:1 ratio and rapidly added to water to make liposomes. We have measured the size and zeta potential of liposomes. We have used Survivin siRNA (Sigma) for making lipoplexes. Lipoplexes were prepared by mixing the equal volume of siRNA and C12M liposomes in the charge ratio of 8, 4, 2, 1 and size and zeta potential were also measured for the same. Size and surface charge measurements for liposomes and lipoplexes: The sizes and the global surface charges (zeta potentials) of liposomes (Table S2) were measured by photon correlation spectroscopy and electrophoretic mobility with a Zetasizer 3000HSA (Malvern Instruments, UK). The system was calibrated by using the 199 ± 6 nm NanosphereTM Size

ACS Paragon Plus Environment

Page 2 of 7

Page 3 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Figure 1. (A) A representative gel picture and graph showing inhibition of hLigI activity of C7M-C14M compounds. Lane 1 represents Cy3-labelled DNA substrate control with no added ligase. Lane 2 shows ligation activity in the absence of any inhibitor. A previously reported positive control HTS01682 is shown in lane 3 for comparison. Lanes 4-10 show percentage of ligation in the presence of inhibitors C7M-C14M. (B) The specificity of most active compound C12M was checked against other human (hLigIIIβ and hLigIV/XRCC4) and non-human T4 DNA ligases. The gel pictures (Figure 1B, lane 3-5) and graphs clearly show that the compound specifically inhibits hLigI activity. (C) The compound C12M inhibits the ligation activity of HepG2 cell lysate (Figure 1C, lane 3-5) which indicates that the compound can retain its activity inside the cells.

Standard (Duke Scientific Corp., Palo Alto, CA, USA) and DTS 0050 standard from Malvern. Gene silencing studies by western blot: The endogenous gene silencing efficiency of C12M liposomes: siRNA against survivin was measured in PC-3 cells. PC-3 cells were treated with 100 nM of human survivin siRNA alone or complexed with C12M liposomes (1:8 siRNA: lipid charge ratio) to provide a measure of target gene silencing at protein level by western blotting.30 The proteins were separated by SDS-PAGE and transferred to a polyvinylidenedifluoride (PVDF) membrane. Proteins of interest were incubated with ECL detection reagent and developed by using Chem Doc. Cell Viability assay: The PC-3 cells were plated at a cell density of 5000 cells/well in 96 well plates usually 18-24 h before transfection. The 8:1 cationic lipid to siRNA charge ratios was taken and from that, 25-200 nm concentration was added to plates. After 24 h 10 µL of MTT (5 mg/mL in PBS) was added to each well and kept at 37°C for 2-3 h. The medium was removed completely and the cells were dissolved in 50 µL of DMSO:methanol (50:50) and the UV absorption was measured at 550 nm. Absorbance of cells, untreated with either of the lipoplex, at 550 nm upon MTT treatment is depicted as A550 (untreated cells). Absorbance of cells, treated with either of the targeted or non-targeted lipoplex, at 550 nm upon MTT treatment is depicted as A550 (treated cells). In-vivo studies in melanoma model Male C57BL6J mice were attained from CSIR-CDRI (Lucknow, India). Institutional Animal Ethical Committee approved protocols used in experimentation of animals. Male C57BL6/J mice which were 6-8 weeks old were inoculated subcutaneously with 2.0×105 B16F10 cells in the lower right abdomen beneath skin. Nine days after injecting cancer cells mice were grouped according to treatment. The groups were a) group treated with PBS (4 mice) b) group treated with C12M liposomes (4 mice) c) group treated with Survivin siRNA (4 mice) d) group treated with Survivin siRNA loaded C12M

liposomes (4 mice). For treatment group 0.5 mg/Kg Survivn siRNA was given intravenously on every third day till 21 day after treatment. Tumor volume of tumors were measured every third day. The tumor sizes were expressed in volume (mm3) and calculated using the formula (0.5×a×b2), where ‘a’ is the longest dimension and ‘b’ is the shortest dimension of the tumors. Experiment was terminated when the average tumor volume of the control treated group reached ~4000mm3. RESULTS AND DISCUSSION Fluorescence Based Ligation Assay: PCCL’s, C7M-C14M (Scheme 1) were tested for their ability to inhibit ligation against hLigI. Surprisingly lipo-anisamides C11M-C14M demonstrated the enzyme inhibition with the maximum inhibitory activity appearing at the C11M chain length and sharply shooting up to >90% inhibition for C12M chain length. Activity decreased at the C13M and C14M chain lengths (Figure 1A). The data suggests that the chain length C12M possessed the right structural requirements to bind specifically with the ligase enzyme. To check the specificity of C12M for activity against the hLigI protein, we tested its activity against other human ligases (hLigIIIβ and hLigIV/XRCC4) as well as the bacterial T4 DNA ligase enzyme (Figure 1B). The specificity of C12M towards inhibiting hLigI activity is apparent from Figure 1B, where the graph clearly shows that at 5 µM concentrations, only hLigI is inhibited by more than 50% whereas the other ligases are not affected significantly. This again suggests that the chain length of C12M has some specific molecular interaction with hLigI enzyme and also proves that certain structural requirements are specifically met by the C12M molecule but not by the other closely related molecules tested here. Given the fact that C12M can inhibit the activity of hLigI but not the related proteins hLigIII and hLigIV which have very similar structures31, 32 this suggests that the inhibition of hLigI is highly specific and not because of non-specific interactions between the ligand and the protein.

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To determine whether C12M can target hLigI inside the cells, we checked its antiligase activity in the cell lysate of HepG2 cells (30 µg). We prepared cell extract of HepG2 cells in PBS, and then checked its ligation activity in the presence of different concentrations of C12M (50, 100, 200 µM). We found that the ligation activity of HepG2 cell lysate decreased with increasing concentrations of C12M. The inhibition activity is observed here at relatively higher concentrations than with purified protein (10 µM range) since there are other ligases (hLigIII and hLigIV) in the lysate that can also ligate the DNA and hence a higher concentration of inhibitor is needed to see complete inhibition of activity. At 100 and 200 µM concentration of C12M roughly 66.22 ± 2.31% and 91.13 ± 1.71% inhibition of ligation is observed respectively in 30 µg cell extract (Figure. 1C). DNA binding experiments: We further demonstrated that the inhibition of ligation was due to specific ligand-protein interaction and not due to the proximity of cationic lipid-based compounds which have a natural tendency to interact electrostatically with ligase-substrate DNA. For this, we checked DNA binding propensity of the compounds (C11MC13M). Figure 2A suggests that the compounds do not intercalate with DNA at all, whereas Doxorubicin, a known DNA intercalator caused a shift in mobility of DNA due to its interaction with DNA, resulting in increased mass and retarded movement of the complex (lane 6). Here we used a classical cationic lipid CTAB as a lipid control (lane 2) but did not find any hindrance in the movement of DNA in agarose gel upto 100 µM concentration as compared to positive control doxorubicin. We also used spectrofluorometric methods to study the DNA interactions (intercalation, major groove binding and minor groove binding) of C12M.

Figure 2. (A) DNA gel retardation assay with compounds C11M-C13M. Lanes 1 and 2 are controls with DMSO and CTAB respectively. Lanes 3-5 show no shift in the position of the DNA in the presence of compounds C11M, C12M and C13M respectively while lane 6 shows a shift in the movement of DNA in the presence of the known DNA intercalator Doxorubicin. Spectrofluorometric studies showed that the compound C12M was not able to displace (B) ETBR, (C) Methyl Green or (D) DAPI from DNA significantly.

We used known DNA interacting compounds like ETBR (DNA intercalator), Methyl Green (DNA major groove binder) and DAPI (DNA minor groove binder) for our study. Our spectrofluorometric studies showed that at the ligation inhibition concentrations (5 and 10 µM) C12M was not able to displace the ETBR (Figure 2B) and Methyl Green (Figure 2C) from DNA whereas minute displacement of DAPI (Figure 2D) was

observed. The fluorescence quenching obtained from DAPI displacement was negligible as compared to fluorescence quenching obtained from binding between C12M and hLigI (Figure 3B). Thus we can conclude that the inhibition of ligation was plainly due to ligand-protein interaction and not due to interaction with DNA. Ligand binding experiments: Ligand (C12M) binding to hLigI was also verified by direct protein binding experiments such as EMSA, circular dichroism and fluorescence based experiments between the ligand and the protein. At first the EMSA assay with a double stranded non-ligatable DNA (as substrate) and the compounds C11M-C13M (Figure 3A) was performed. We labeled the 5’end of our double stranded nicked DNA substrate with a fluorescent dye (FAM) so that we could track its mobility on a gel (Figure 3A, lane 1, lower left arrow). When ligase binds with the DNA, it leads to an increase in its apparent molecular weight and shift in the movement of labelled DNA on the gel (Figure 3A, lane 2, middle left arrow versus lane 1). Binding of the inhibitors leads to a further increase in molecular weight of the DNA-ligase-inhibitor tertiary complex that is observed in lanes 3-5 (top left arrow). This indicates a direct binding of the compounds C11M-C13M with the protein itself or with the protein-DNA complex.

Figure 3. (A) Electrophoretic mobility shift assay with the compounds C11MC13M. Lane 1 shows the position of labelled DNA alone in the gel (lower left arrow). Lane 2 shows mobility of labelled DNA in complex with ligase I protein (middle left arrow). Lanes 3-5 show the position of the DNA-ligase-inhibitor complex (upper left arrow) exhibiting the direct binding of inhibitor with either the protein or the protein-DNA complex. (B) In-vitro fluorescence quenching assay shows decrease in fluorescence intensity of hligI in presence of C12M. (C) Native PAGE for hligI and hLigI-C12M complex shows that the inhibitor directly binds with hligI. (D) Change in fluorescence spectra of CD shows C12M induced conformational change in hLigI protein.

To further validate the above results, we performed two alternative direct binding experiments as well as enzyme kinetic study with increasing concentrations of substrate DNA. First we performed an in-vitro fluorescence quenching experiment (Figure 3B) where fluorescence spectra of hLigI protein alone and in presence of 5 and 10 µM of C12M was measured after excitation at 280 nm. A decrease in fluorescence intensity from hLigI was observed in the presence of C12M. Usually quenching can only occur when the tryptophan residues are bound by the ligand. This clearly indicates the direct binding between protein and the above compound.

ACS Paragon Plus Environment

Page 4 of 7

Page 5 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces Next, we performed native gel electrophoresis experiment to validate the direct binding. For this we incubated hLigI with increasing concentration of C12M at 4°C for 2 hrs and the resultant complexes were loaded on a native PAGE gel and electrophoresed. Binding of C12M with hLigI caused increase in the molecular weight of resultant complexes and accordingly they moved more slowly as compared to hLigI alone (Figure 3C). To conclusively prove that C12M directly binds with the hLigI we have performed CD spectroscopy and studied the C12M induced conformational changes in hLigI protein. A clear shift in spectra was observed on addition of 5 and 10 µM concentration of C12M to hLigI as compared to control (Figure 3D). From all these experiments we can conclude that C12M interacts directly with hLigI. Finally, we have performed enzyme kinetics experiments to understand how C12M inhibits the hLigI enzyme. As shown in Table S1 and Figure S2A, addition of C12M to the ligation reaction caused the regression in Km and Vmax values indicating the uncompetitive mode of binding. This mode of inhibition works by stabilizing the enzyme-substrate complex as observed in the EMSA described above. From all these experiments we can safely conclude that C12M interacts directly with hLigI and inhibits its activity.

decreased the survivin levels in PC-3 cells (Figure 4A). Further, we tested the relative anticancer efficacies of the apoptosis inducing survivin siRNA in PC-3 cells (Figure 4B) by MTT assay. Results show that the anticancer activity is siRNA concentration dependent. However, no toxicity is observed with liposomes alone and cells treated with free survivin siRNA because of “lack of spontaneous cellular entry”. Finally, to understand the in-vivo fate of the anti-ligase delivery systems, we have used highly established and easily accesible syngenic B16F10 melanoma model.[33] We started the intravenous dosing nine days after tumor implantation and injected 0.5 mg/ kg antisurvivin siRNA complexed with C12M liposomes on every third day till 21 days. Interestingly, survivin siRNA-loaded C12M liposomes suppressed tumor growth (Figure 4C & D) and neither C12M liposomes nor survivin siRNA showed significant tumor inhibition. CONCLUSION In summary, we have successfully developed a highly selective and efficient molecularly targeted cationic lipid based siRNA delivery system. The in vitro and in vivo results demonstrated the efficient gene silencing and tumor growth inhibition. This single molecule-based dual strategy of siRNA delivery and selective ligase inhibition will provide a new direction to cancer gene therapy.

ASSOCIATED CONTENT Supporting Information. Details for synthesis and characterization of all compounds together with protocols for biological assays. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author Email: [email protected]; [email protected]

Funding Sources Financial support from DBT (GAP0556) is acknowledged. Figure 4. (A) Gene silencing efficiency of surviving siRNA delivered by C12M liposomes in PC-3 cells. (B) Anticancer effect of survivin siRNA in PC-3 cells measured by MTT assay. (C) Relative tumor size of the B16F10 syngenic tumorbearing mice after treatment by PBS (control), C12M liposomes, Survivin siRNA and C12M lipo loaded Survivin siRNA. (D) Representative images of the harvested B16F10 tumor from each group at day 21. * P