Splicing Site Recognition by Synergy of Three Domains in Splicing

Communication Cite This: Biochemistry XXXX, XXX, XXX−XXX

pubs.acs.org/biochemistry

Splicing Site Recognition by Synergy of Three Domains in Splicing Factor RBM10 Pedro Serrano,† John A. Hammond,† Michael Geralt,† and Kurt Wüthrich*,†,‡ †

Department of Integrative Structural and Computational Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States ‡ Skaggs Institute for Chemical Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States S Supporting Information *

interacting region containing a second zinc finger (ZnF2), an OCRE sequence motif,13,14 and a G-patch motif (Figure 1A). The RNA recognition domains in RBM5 and RBM10 have sequences that are ∼60% identical, recognize similar splice sites, and together with the OCRE domain15,16 govern Fas isoform ratios. In this work, we report on the recognition of exon 6 in Fas by cooperative action of the RRM1, ZnF1, and RRM2 domains of RBM10 and present nuclear magnetic resonance (NMR) structures of the individual RBM10 RNA binding domains. The biological functions of RBM5, RMB6, and RBM10 indicate that these splicing factors bind to mRNA with high affinity.2,4,7,9,17−19 Here, we set out to investigate the structural basis of these implicated interactions. Working with RBM10, we measured the binding affinities for an RNA fragment from exon 6 of Fas of the individual RRMs, the zinc finger, and combinations of two and three of these globular domains. We also determined NMR structures of the individual domains, which may support future studies of the general mechanisms of action by this class of splicing factors. To investigate the impact of synergies between multiple RNA binding domains in RBM10 during Fas recognition, we prepared RBM10 polypeptide fragments of variable lengths and evaluated their affinities for the 22-nucleotide sequence UAAUUGUUUGGGGUAAGUUCUU found in exon 6 of Fas (Figure 1B), which was selected on the basis of information provided in refs 1 and 4. RNA binding affinities were measured using membrane filter binding experiments. High-affinity binding was observed for a three-domain construct containing RRM1, ZnF1, and RRM2 connected by the natural linkers in RBM10 (RRM1−ZnF1−RRM2), with a KD of 20 nM, compared to values of 2.5 and 5.5 μM for the individual RRM1 and RRM2 domains, respectively, and 845 nM for ZnF1 (Figure 1B). The KD value for ZnF1 is similar to the affinities observed for other members of the ZRANB2 family.11,20 A construct of residues 128−250 containing RRM1 and ZnF1 (RRM1−ZnF1) was found to bind with intermediate affinity [KD = 412 nM (Figure 1B)]. Overall, the data in Figure 1B show that synergies among three covalently linked RBM10 domains can afford high-affinity recognition of the sequence of an RNA fragment taken from the Fas mRNA. The significantly

ABSTRACT: Splicing factor RBM10 and its close homologues RBM5 and RBM6 govern the splicing of oncogenes such as Fas, NUMB, and Bcl-X. The molecular architecture of these proteins includes zinc fingers (ZnFs) and RNA recognition motifs (RRMs). Three of these domains in RBM10 that constitute the RNA binding part of this splicing factor were found to individually bind RNAs with micromolar affinities. It was thus of interest to further investigate the structural basis of the welldocumented high-affinity RNA recognition by RMB10. Here, we investigated RNA binding by combinations of two or three of these domains and discovered that a polypeptide containing RRM1, ZnF1, and RRM2 connected by their natural linkers recognizes a specific sequence of the Fas exon 6 mRNA with an affinity of 20 nM. Nuclear magnetic resonance structures of the RBM10 domains RRM1 and ZnF1 and the natural V354del isoform of RRM2 further confirmed that the interactions with RNA are driven by canonical RNA recognition elements. The well-known high-fidelity RNA splice site recognition by RBM10, and probably by RBM5 and RBM6, can thus be largely rationalized by a cooperative binding action of RRM and ZnF domains.

S

plicing factor RBM10 modulates the cellular isoform rates of multiple apoptotic genes, such as Fas,1 NUMB,2 and Bcl3,4 x, and has been linked to the onset of multiple cancers.5,6 Intracellularly, RBM5, RBM10, and the more distant homologue RBM6 mediate exon skipping as well as inclusion events and participate in the processing of multiple oncogenes.2,5,6 While in some alternative splicing events the involvement of the three RBM proteins favors one gene product, the individual splicing factors may also lead to the production of different isoforms.2 For example, in the alternative splicing of Fas, RBM5 and RBM10 behave similarly, by promoting exon 6 skipping and thus increasing the yield of an antiapoptotic isoform. In contrast, in the processing of NUMB, RBM10 induces exon 9 inclusion while RBM5 increases the rate of skipping.1,2,4,7−9 RBM10, RBM5, and RBM6 share similar domain architectures, which include an N-terminal RNA recognition region consisting of a C4-type zinc finger (ZnF1) flanked by two RRMs (RRM1 and RRM2),10−12 and a C-terminal protein© XXXX American Chemical Society

Received: December 11, 2017 Revised: February 5, 2018

A

DOI: 10.1021/acs.biochem.7b01242 Biochemistry XXXX, XXX, XXX−XXX

Communication

Biochemistry

Figure 2. NMR structures of RBM10 domains. RBM10 domains (A) RRM1, (B) ZnF1, and (C) RRM2[V354del] are represented by bundles of 20 conformers (left) and ribbon presentations of the conformer closest to the mean coordinates (right). The chain ends are identified by N and C. In panel B, the Zn2+ ion is not shown because it was not seen in the NMR spectra. For the structure calculation, the input included distance constraints between the position of Zn2+ and the four coordinated cysteines (see Protein Data Bank entry 2MXV for details).

Figure 1. Domain architecture of RBM5, RBM6, and RBM10 and recognition of an RNA fragment from exon 6 of Fas by RBM10 fragments. (A) Schematic representation of the domain architectures of the three proteins, RBM5, RBM6, and RBM10. The three globular domains studied here are highlighted in color. At the bottom, the RRM1−ZnF1 and RRM1−ZnF1−RRM2 polypeptide fragments of RBM10 used for RNA binding assays are indicated by thick colored lines and their amino acid positions are indicated in parentheses. (B) Protein−RNA association curves with a 22-nucleotide RNA sequence from exon 6 of Fas,1,4 UAAUUGUUUGGGGUAAGUUCUU. The data were obtained using membrane filter binding assays, as described previously.39,40 The color code is the same as that used in panel A. Average values from three independent experiments are shown as geometric symbols, and the standard deviations are represented as vertical bars. KD values obtained by fitting the data to a standard Hill equation are indicated at the bottom right.

340−344. Zn2+ is coordinated by four cysteines at positions 319, 322, 333, and 336, which are located within or near the four β-strands. As a C4 zinc finger, ZnF1 is a representative of the ZRANB2 family.11,20 The structure of the natural isoform of RBM10−RRM2, RRM2[V354del], contains helices α1 and α2 of residues 310− 324 and 351−359, respectively, and four β-strands are formed by polypeptide segments 301−305 (β1), 329−334 (β2), 344− 349 (β3), and 378−381 (β4) (Figure 2C). RRM2[V254del] thus adopts a canonical RRM structure. In addition, deletion of V254 did not have a significant effect on single-domain RNA binding (Figure 3). In view of the near identity of the structures of all three domains used here with those for which detailed studies of RNA complexation have been reported,10,24,25 we hypothesize that they also have similar patterns of contacts with RNAs. In conclusion, our data present a continuation of earlier work by others, which had shown that the function of RBM10 in the regulation of Fas alternative splicing is based on both the specific recognition of oligonucleotide motifs in the mRNA and additional interactions with supplementary splicing factors.2,4 While the C-terminal region of RBM10 is involved in protein recruitment, the N-terminal region with the three RNA binding domains RRM1, ZnF1, and RRM2 ensures recognition and binding of specific splice sites on the mRNA, which was the focus of the work presented here. Previous studies with tandem RRM constructs showed enhanced affinities when compared with those of the individual RRMs.26−33 RBM10 now provided

enhanced RNA binding affinity of the RRM1−ZnF1−RRM2 polypeptide fragment suggests that there is significant intramolecular domain binding cooperativity. NMR structures of RBM10 domains RRM1, ZnF1, and RRM2[V354del] were determined using the J-UNIO protocol with non-uniform sampling of the three-dimensional heteronuclear-resolved 1H−1H NOESY data sets.21−23 High-quality structures were thus obtained, as indicated by the statistics presented in Table 1. RRM1 shows a variation of the canonical RRM architecture, with a four-stranded antiparallel β-sheet and two αhelices.10,24,25 In RBM10−RRM1, helices α1 and α2 contain residues 141−153 and 181−191, respectively, and β-strands are formed by polypeptide segments 128−132 (β1), 157−162 (β2), 174−178 (β3), 195−198 (β3′), and 201−205 (β4). The unique feature of RRM1 is that the linker between α2 and β4 forms an additional strand, β3′ (Figure 2A), which is not part of the canonical RRM β-sheet.10,24,25 The ZnF1 domain adopts a ZRANB2-like structure (Figure 2B)11,20 containing an α-turn with residues 240−244 and four short β-strands of residues 315−318, 324−328, 336−338, and B


Communication

Biochemistry

Table 1. Input for the Structure Calculations and Characterization of Bundles of 20 Energy-Minimized CYANA Conformers Representing the NMR Structures of RBM10 Domains RRM1, ZnF1, and RRM2[V354del]a RRM1 no. of NOE upper distance limits intraresidual short range medium range long range dihedral angle constraints residual target function value (Å2) residual NOE violations no. ≥0.1 Å maximum (Å) residual dihedral angle violations no. ≥2.5° maximum (deg) Amber energy (kcal/mol) total van der Waals electrostatic RMSD from ideal geometry bond lengths (Å) bond angles (deg) RMSD from the mean coordinates (Å)b bb ha Ramachandran plot statistics (%)c most favored regions additional allowed regions generously allowed regions disallowed regions

ZnF1

RRM2[V354del]

1960 457 540 376 587 385 1.66 ± 0.30

420 135 109 77 99 179 0.34 ± 0.05

1693 442 556 278 417 336 1.44 ± 0.24

5±2 0.14

1±1 0.12

6±1 0.13

1±1 1.56

1±1 1.78

0±0 0.87

−3462 ± 105 −279 ± 18 −3994 ± 92

−1117 ± 87 −208 ± 15 −1519 ± 112

−3801 ± 57 −223 ± 18 −3291 ± 68

0.0091 1.48

0.0081 1.31

0.0078 1.44

0.46 ± 0.06 0.93 ± 0.09

0.41 ± 0.07 1.01 ± 0.12

0.68 ± 0.08 1.04 ± 0.09

83.5 13.9 2.6 0

85.3 13.3 0.9 0.5

74.5 21.3 3.1 1.1

a Except for the top six entries, which describe the input generated in the final cycle of the ATNOS/CANDID/CYANA calculation,36−38 the remaining entries refer to the 20 best CYANA conformers after energy minimization with OPALp (see the text). Where applicable, the average value for the bundle of 20 conformers and the standard deviation are given. bbb indicates backbone atoms N, Cα, and C′; ha stands for all heavy atoms. c As determined by PROCHECK.

in RBM10 have structural properties nearly identical to those of corresponding domains in other splicing factors,10,12,24−26 with the sole exception that the RBM10−RRM1 fragment includes an additional, noncanonical regular secondary structure element, β3′ (Figure 2A). We have demonstrated that recognition of exon 6 in Fas by the combination of the three RNA binding domains of RBM10 results in a low nanomolar binding affinity while individual domains have relatively weak affinities (Figure 1B). Complementarity of the biological functions of splicing factors RBM5 and RBM10 has previously been extensively investigated.2,4,7,17−19,34,35 The high degree of sequence homology and the high degree of similarity of the three-dimensional structures of their RNA binding domains, in as far as they are available,11,12 suggest a homologous RNA recognition mode, which coincides with evidence that the two splicing factors may target closely related mRNA motifs.2,32−35

Figure 3. Association curves of RRM2 and RRM2[V354del] with the 22-nucleotide RNA fragment UAAUUGUUUGGGGUAAGUUCUU from exon 6 of Fas. RNA binding data for RRM2 and RRM2[V35del] are shown, using methods and a presentation similar to those used in Figure 1B.

■

ASSOCIATED CONTENT

* Supporting Information

an opportunity to investigate possible cooperativity between RRMs and a zinc finger domain, which exhibits a different structure and a different mode of RNA recognition. Introduction of non-RRM domains into splicing factors (Figure 1A) obviously increases the diversity of RNA recognition and is found extensively in nature. Individually, the RRMs and ZnF1

S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.7b01242. Detailed materials and methods (PDF) C


Communication

Biochemistry Accession Codes

(8) Ray, D., Kazan, H., Cook, K. B., Weirauch, M. T., Najafabadi, H. S., Li, X., Gueroussov, S., Albu, M., Zheng, H., Yang, A., Na, H., Irimia, M., Matzat, L. H., Dale, R. K., Smith, S. A., Yarosh, C. A., Kelly, S. M., Nabet, B., Mecenas, D., Li, W., Laishram, R. S., Qiao, M., Lipshitz, H. D., Piano, F., Corbett, A. H., Carstens, R. P., Frey, B. J., Anderson, R. A., Lynch, K. W., Penalva, L. O., Lei, E. P., Fraser, A. G., Blencowe, B. J., Morris, Q. D., and Hughes, T. R. (2013) Nature 499, 172−177. (9) Wang, Y., Gogol-Doring, A., Hu, H., Frohler, S., Ma, Y., Jens, M., Maaskola, J., Murakawa, Y., Quedenau, C., Landthaler, M., Kalscheuer, V., Wieczorek, D., Wang, Y., Hu, Y., and Chen, W. (2013) EMBO Mol. Med. 5, 1431−1442. (10) Maris, C., Dominguez, C., and Allain, F. H. (2005) FEBS J. 272, 2118−2131. (11) Nguyen, C. D., Mansfield, R. E., Leung, W., Vaz, P. M., Loughlin, F. E., Grant, R. P., and Mackay, J. P. (2011) J. Mol. Biol. 407, 273−283. (12) Song, Z., Wu, P., Ji, P., Zhang, J., Gong, Q., Wu, J., and Shi, Y. (2012) Biochemistry 51, 6667−6678. (13) Callebaut, I., and Mornon, J. P. (2005) Bioinformatics 21, 699− 702. (14) Inoue, A., Takahashi, K., Kimura, M., Watanabe, T., and Morisawa, S. (1996) Nucleic Acids Res. 24, 2990−2997. (15) Mourão, A., Bonnal, S., Komal, S., Warner, L., Bordonné, R., Valcárcel, J., and Sattler, M. (2016) eLife 5, e14707. (16) Martin, B. T., Serrano, P., Geralt, M., and Wüthrich, K. (2016) Structure 24, 158−164. (17) Xiao, S. J., Wang, L. Y., Kimura, M., Kojima, H., Kunimoto, H., Nishiumi, F., Yamamoto, N., Nishio, K., Fujimoto, S., Kato, T., Kitagawa, S., Yamane, H., Nakajima, K., and Inoue, A. (2013) Biol. Cell 105, 162−174. (18) Hernández, J., Bechara, E., Schlesinger, D., Delgado, J., Serrano, L., and Valcárcel, J. (2016) RNA Biol. 13, 466−672. (19) Tessier, S., Loiselle, J., McBain, A., Pullen, C., Koenderink, B., Roy, J., and Sutherland, L. (2015) BMC Res. Notes 8, 46−56. (20) Loughlin, F. E., Mansfield, R. E., Vaz, P. M., McGrath, A. P., Setiyaputra, S., Gamsjaeger, R., Chen, E. S., Morris, B. J., Guss, J. M., and Mackay, J. P. (2009) Proc. Natl. Acad. Sci. U. S. A. 106, 5581− 5586. (21) Serrano, P., Pedrini, B., Mohanty, B., Geralt, M., Herrmann, T., and Wüthrich, K. (2012) J. Biomol. NMR 53, 341−354. (22) Didenko, T., Proudfoot, A., Dutta, S. K., Serrano, P., and Wüthrich, K. (2015) Chem. - Eur. J. 21, 12363−12369. (23) Dutta, S. K., Serrano, P., Proudfoot, A., Geralt, M., Pedrini, B., Herrmann, T., and Wüthrich, K. (2015) J. Biomol. NMR 61, 47−53. (24) Daubner, G. M., Clery, A., and Allain, F. H. T. (2013) Curr. Opin. Struct. Biol. 23, 100−108. (25) Cléry, A., Blatter, M., and Allain, F. H. T. (2008) Curr. Opin. Struct. Biol. 18, 290−298. (26) Wang, H., Zeng, F., Liu, Q., Liu, H., Liu, Z., Niu, L., Teng, M., and Li, X. (2013) Acta Crystallogr., Sect. D: Biol. Crystallogr. 69, 373− 380. (27) de Mollerat, X. J. (2003) Hum. Mol. Genet. 12, 1959−1971. (28) Conte, M., Grüne, T., Ghuman, J., Kelly, G., Ladas, A., Matthews, S., and Curry, S. (2000) EMBO J. 19, 3132−3141. (29) Dominguez, C., Schubert, M., Duss, O., Ravindranathan, S., and Allain, F. H. T. (2011) Prog. Nucl. Magn. Reson. Spectrosc. 58, 1−61. (30) Wang, I., Hennig, J., Jagtap, P. K., Sonntag, M., Valcarcel, J., and Sattler, M. (2014) Nucleic Acids Res. 42, 5949−5966. (31) Tripsianes, K., Friberg, A., Barrandon, C., Brooks, M., van Tilbeurgh, H., Seraphin, B., and Sattler, M. (2014) J. Biol. Chem. 289, 28640−28650. (32) Sutherland, L. C., Rintala-Maki, N. D., White, R. D., and Morin, C. D. (2005) J. Cell. Biochem. 94, 5−24. (33) Kenan, D. J., Query, C. C., and Keene, J. D. (1991) Trends Biochem. Sci. 16, 214−220. (34) Wang, K., Bacon, M. L., Tessier, J. J., Rintala-Maki, N. D., Tang, V., and Sutherland, L. C. (2012) J. Cell Death 5, JCD.S9073. (35) Sutherland, L. C., Wang, K., and Robinson, A. G. (2010) J. Thorac. Oncol. 5, 294−298.

The NMR structures of RBM10, RRM1, ZnF1, and RRM2[V354del] have been deposited as Protein Data Bank entries 2LX1, 2MXV, and 2M2B, respectively.

■

AUTHOR INFORMATION

Corresponding Author

*Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037. E-mail: [email protected]. ORCID

Kurt Wüthrich: 0000-0003-2612-6616 Author Contributions

K.W. and P.S. planned and designed experiments. M.G. expressed and purified recombinant proteins. P.S. and J.A.H. performed RNA binding experiments. P.S. performed NMR structure determinations. The manuscript was written by P.S. and K.W. with contributions from all authors. All authors have given approval to the final version of the manuscript. Funding

Part of this work was supported by the Joint Center for Structural Genomics (JCSG, www.jcsg.org, Grant U54 GM094586). K.W. is the Cecil H. and Ida M. Green Professor at The Scripps Research Institute. Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS APSY, automated projection spectroscopy; ASCAN, software for automated side-chain resonance assignment; ATNOS, software for automated NMR peak picking; CANDID, software for automated NOE assignment; CYANA, software for NMR structure calculation; EDTA, ethylenediaminotetraacetic acid; HSQC, heteronuclear single-quantum coherence spectroscopy; J-UNIO, protocol for automated determination of NMR structures of proteins; MATCH, software used for backbone NMR chemical shift assignments; NOE, nuclear Overhauser effect; NOESY, nuclear Overhauser effect spectroscopy; RMSD, root-mean-square deviation; TEV, tobacco etch virus.

■

REFERENCES

(1) Bonnal, S., Martinez, C., Forch, P., Bachi, A., Wilm, M., and Valcarcel, J. (2008) Mol. Cell 32, 81−95. (2) Bechara, E. G., Sebestyen, E., Bernardis, I., Eyras, E., and Valcarcel, J. (2013) Mol. Cell 52, 720−733. (3) Bielli, P., Bordi, M., Di Biasio, V., and Sette, C. (2014) Nucleic Acids Res. 42, 12070−12081. (4) Inoue, A., Yamamoto, N., Kimura, M., Nishio, K., Yamane, H., and Nakajima, K. (2014) FEBS Lett. 588, 942−947. (5) Rintala-Maki, N. D., and Sutherland, L. C. (2004) Apoptosis 9, 475−484. (6) Imielinski, M., Berger, A. H., Hammerman, P. S., Hernandez, B., Pugh, T. J., Hodis, E., Cho, J., Suh, J., Capelletti, M., Sivachenko, A., Sougnez, C., Auclair, D., Lawrence, M. S., Stojanov, P., Cibulskis, K., Choi, K., de Waal, L., Sharifnia, T., Brooks, A., Greulich, H., Banerji, S., Zander, T., Seidel, D., Leenders, F., Ansen, S., Ludwig, C., EngelRiedel, W., Stoelben, E., Wolf, J., Goparju, C., Thompson, K., Winckler, W., Kwiatkowski, D., Johnson, B. E., Janne, P. A., Miller, V. A., Pao, W., Travis, W. D., Pass, H. I., Gabriel, S. B., Lander, E. S., Thomas, R. K., Garraway, L. A., Getz, G., and Meyerson, M. (2012) Cell 150, 1107−1120. (7) Loiselle, J. J., and Sutherland, L. C. (2014) In Vitro Cell. Dev. Biol.: Anim. 50, 331−339. D


Communication

Biochemistry (36) Herrmann, T., Güntert, P., and Wüthrich, K. (2002) J. Biomol. NMR 24, 171−189. (37) Herrmann, T., Güntert, P., and Wüthrich, K. (2002) J. Mol. Biol. 319, 209−227. (38) Güntert, P., Mumenthaler, C., and Wüthrich, K. (1997) J. Mol. Biol. 273, 283−298. (39) Hammond, J. A., Lamichhane, R., Millar, D. P., and Williamson, J. R. (2017) J. Mol. Biol. 429 (5), 697−714. (40) Hammond, J. A., Rambo, R. P., and Kieft, J. S. (2010) J. Mol. Biol. 399 (3), 450−63.

E


Splicing Site Recognition by Synergy of Three Domains in Splicing

Recommend Documents