NANO LETTERS
Stabilization of Liposomes through Enzymatic Polymerization of DNA
2006 Vol. 6, No. 12 2755-2757
Tristan Ruysschaert,† Laurent Paquereau,† Mathias Winterhalter,†,‡ and Didier Fournier*,† Institut Pharmacologie et Biologie Structurale, UMR CNRS UniVersite´ Paul Sabatier, 5089 Toulouse, France, and International UniVersity Bremen, D-28725 Bremen, Germany Received July 25, 2006; Revised Manuscript Received October 21, 2006
ABSTRACT Combining supramolecular self-assembly of lipids with enzymatic triggered DNA interfacial polymerization allows construction of composite nanocapsules. Covalent grafting of oligonucleotides functionalizes the surface of liposomes. Subsequent addition of an enzyme called terminal deoxynucleotidyl transferase elongates the single-stranded DNA. The elongated DNA hybridizes, creating a random network. The short segments of double-stranded DNA provides a substrate for the Klenow fragment of E. coli DNA polymerase, which synthesizes a double-strand DNA, reinforcing the network. Alternate action of both enzymes leads to a three-dimensional network anchored on the liposome surface.
Since 1960, liposomes are used in life science as models for cells and have been found to have various applications as a delivery system in cosmetics, gene therapy, or medicine.1 However, their poor chemical and mechanical stability often restricts possible applications. Many approaches for liposome stabilization were suggested. Among them, addition of cholesterol or ABA copolymer to the lipids enhances the mechanical stability.2,3 Coating of various polymers such as poly(acrylic acid) derivatives, chitosan, carboxymethyl chitosan, poloxamer, or carboxymethyl chitin on the outer leaflet of the lipid membrane provided some mechanical stabilization and prolongation of the lifetime in the blood stream.4-10 However, the above-mentioned methods were usually not sufficient. Here, we introduce crosslinked DNA as a polymer coat (Figure 1). DNA offers two interesting properties for building material. First, DNA interacts via the Watson-Crick pairing, a specific and strong interaction. Second, a large variety of highly specific biological tools exists to polymerize, to cut, or to ligate DNA. DNA polymerases allow polymerization with or without template. Cutting DNA may be sequence specific with restriction enzymes: single- or double-strandspecific depending on the DNAse, DNA extremities may be ligated, etc. Enzymes, described in detail by molecular biologists and commercially available, catalyze all of these reactions. Liposomes were prepared using the film hydration technique.11,12 Briefly, 45 µmol of phosphatidyl choline (egg-PC) * Corresponding author. E-mail:
[email protected]. † Institut de Pharmacologie et de Biologie Structurale. ‡ International University Bremen. 10.1021/nl061724x CCC: $33.50 Published on Web 11/01/2006
© 2006 American Chemical Society
Figure 1. (A) Combined action of two polymerases creates a DNA shell on a liposome. Single-strand oligonucleotides step were grafted on lipid heads (magenta). (B) Elongation of single-stranded DNA is catalyzed by terminal deoxynucleotidyl transferase (orange). Depending on the available nucleotides for elongation, the single strands hybridize. (C) Subsequent addition of Klenow DNA polymerase recognizing double-stranded fragments and complements the strands (green).
and 5 µmol maleimide-functionalized lipids (1,2-dipalmitoylsn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidophenyl)butyramide]), product 870013 of Avanti Polar Lipids, Birmingham, AL) dissolved in CHCl3 were placed in a glass tube, dried under a stream of N2, and then placed under vacuum for 3 h to form a lipid film. The film was solubilized by addition of 1 mL 145 mM NaCl, 2.5 mM HEPES, pH
Table 1. Size of the Capsule Along the Different Steps Estimated by DLS Determined in a Medium Devoid of Detergent or Containing 1% Triton X-100 (Mean of 10 Assays)
liposomes + oligonucleotides + polymerization with TdT + polymerization with Klenow
Figure 2. Agarose gel to the polymerization. Samples were boiled in the presence of 0.1% TX-100 to denature double-stranded DNA and placed on a 1.2% agarose gel. The DNA was revealed with ethidium bromide. MW: molecular weight markers in 100 bp steps. Lane A: control of DNA growth after addition of terminal deoxynucleotidyl transferase. Lane B: DNA polymerization on the liposome surface.
7.4, and vortexed for 1 min. Finally, 10 freeze-thaw cycles followed by 10 fold dilutions and 10 extrusions through a 200 nm polycarbonate cut-off filter resulted in unilamellar vesicles. Oligonucleotides were covalently linked to liposome surfaces as follows (see schema in Figure 1A). First, a 25-mer oligonucleotide (100 µM) with a thiol function in its 5′ end (5′ HS GATCGGTTTAAGCTTTACGGGTCATTT 3′) was reduced by incubation for 1 h in 2 mM of tris[2-carboxyethyl] phosphine, 15 mM EDTA, 72 mM NaCl, 1.25 mM HEPES, pH 7.4. The reducing agent and EDTA were eliminated using size exclusion chromatography (G25, PD10 Amersham). Reduced oligonucleotides were added to the liposome solution in the ratio of 1 oligonucleotide for 20 maleimidefunctionalized lipids (12.5 µM oligonucleotides, 250 µM maleimide-functionalized lipids in 145 mM NaCl, 2.5 mM HEPES, pH 7.4). The solution was incubated at room temperature for 2 h. Remaining free maleimide functions were saturated by adding an excess of cystein (1 mM). The efficiency of the oligonucleotide grafting was probed by agarose gel electrophoresis (Figure 2 line A), which shows that most of the oligonucleotides linked to lipids. Growth of a polymer network on a liposomal surface was performed using terminal deoxynucleotidyl transferase (TdT) and Klenow fragment of E. coli DNA polymerase I (Klenow). Forty units of each enzyme were added to grafted liposomes (1 mL of 0.2 mM lipids) in 145 mM NaCl, 2.5 mM HEPES, pH 7.4 supplemented with 1.25 mM dCTP, 1.25 mM dGTP, 0.25 mM dATP, 0.25 mM dTTP, 5 mM MgCl2, 5 mM CoCl2. TdT polymerizes deoxynucleotides on a single-strand DNA in the 5′-3′ orientation without any template (see schema in Figure 1B). It allows the linear growth of the anchored oligonucleotide with a random sequence depending on the deoxynucleotides present in solution. In Figure 2, we demonstrate the growth of DNA on the liposome surface. Starting with 25 bp, the gel reveals the presence of large single-stranded DNA around 300-500 2756
radius in nm
radius after addition of Triton X-100 in nm
115 128 155 122
163 158
bp. We used higher concentrations of dCTP and dGTP to increase the probability of hybridization between the 3′ end of a DNA molecule with another DNA molecule. This structure forms a primer for Klenow, which polymerizes complementary strands and stabilizes the network (see schema Figure 1C). When Klenow arrives at the end of its template, TdT polymerizes single-strand DNA, which will hybridize to another single-strand DNA. Alternating intervention of both enzymes allows the formation of a crosslinked network. The size of DNA-coated structures were determined by dynamic light scattering (DLS, Table 1). Extrusion through a 200 nm diameter pore filter yielded liposomes with radii around 115 nm. After linking of oligonuclotides on the liposome surface, the liposome appeared slightly larger. Following polymerization by TdT and the action of Klenow, the apparent size of the capsule was around 120-150 nm. This peak appeared as monodisperse and could not be solved as an aggregation of capsules to clusters. Most probably, strong long-range electrostatic repulsion disadvantages hybridization of DNA belonging to different liposomes. Hybridization corresponds to short-range interactions favoring rather junctions between DNA fragments only in close proximity and on the same liposome. Stabilization of nanocapsules by DNA polymerization was tested using detergent resistance. Triton X-100 (1 wt %) was added to nanocapsules in solution. In the absence of DNA polymerization, light scattering revealed a particle distribution around 3.8 nm corresponding to small detergent micelles. Complete solubilization by Triton X-100 was also obtained with liposomes containing grafted oligonucleotides. Oligonucleotides alone did not protect the liposomes from detergent solubilization. In contrast, after DNA polymerization, 5-40% of capsules were resistant to detergent solubilization. A further test on the reversibility of the structure was to incubate capsules with polymerized DNA with DNAse I (1 mg/mL, 20 °C, 16 h). The resulting object had a radius of 170 nm and was completely dissolved by 1% detergent. Thus, we conclude that DNA nanocapsules were formed around a liposome template, and this DNA capsule remained after free lipid removal by detergent. To visualize optically DNA polymerization on the liposome surface, we performed fluorescence microscopy on giant liposomes prepared according Moscho.13 Briefly, 20 µL liposome solution (10 mM egg-PC and about 1 mol % lipids grafted with olignucleotides and 1 mol % labeled with rhodamine-lipid) were dried on the bottom of a round flask Nano Lett., Vol. 6, No. 12, 2006
In conclusion, DNA is known as an extremely rich material for molecular nanofabrication, termed recently as DNA nanotechnology. For example, Rothemund 14 demonstrated that encoding the DNA allows creation of a large variety of 3-D structures in the nano- to micrometer range. Here, the use of enzymes developed by molecular biologists appear as further promising tools to manipulate (synthesis, ligation, or cutting) nucleic acid structure.15 Acknowledgment. This research was supported by AC Nanosciences-Nanotechnologies (NN082) and Volkswagen Initiative Complex Materials (I/80 051). We thank Drs. J. Teissie´ and J. Fritz for helpful discussions and Veronika Ganeva for illustrations. Figure 3. Confocal microscopy images of giant liposomes covered by DNA. The liposomes were labeled with rhodamine-PE (in red), and the DNA growth was visualized by insertion of Cy5-labeled dCTP (in green). Left panels show the liposome membrane, middle pictures show the DNA. Covering of liposomes by DNA is seen by a colocalization of both colors on the right panel. The bar represents 5 µm.
and dissolved by 80 µL of chloroform and 13 µL of methanol. NaCl (700 µL, 14.4. mM), 10 mM MgCl2, 10 mM CoCl2, 0.25 mM HEPES, pH 7.4 were slowly added on the organic phase. The organic solvent was removed in a rotary evaporator under reduced pressure at 40 °C and 40 rpm for 2 min. DNA was then polymerized in presence of both TdT and Klenow in the previous condition in which 5µM Cy5labeled dCTP was added. Figure 3 shows confocal microscopy images. We observed green colocalization around the liposome, confirming DNA polymerization. The background is due to extension of free oligonucleotides, in agreement with Figure 2, and extension of oligonucleotides linked to small invisible liposomes. It is interesting to note that liposomes entrapped inside the giant liposome were not covered with DNA due to the impermeability of the lipid bilayer for protein enzymes and charge nucleotides.
Nano Lett., Vol. 6, No. 12, 2006
References (1) Bangham, A. D.; Horne, R. W. J. Mol. Biol. 1964, 12, 660-668. (2) Khan, T. K.; Chong, P. L. Biophys. J. 2000, 78, 1390-1399. (3) Ruysschaert, T.; Sonnen, A. F.; Haefele, T.; Meier, W.; Winterhalter, M.; Fournier, D. J. Am. Chem. Soc. 2005, 127, 6242-6247. (4) Sunamoto, J.; Iwamoto, K.; Takada, M.; Yuzuriha, T.; Katayama, K. Polym. Sci. Technol. 1983, 23, 167-173. (5) Guo, J.; Ping, Q.; Jiang, G.; Huang, L.; Tong, Y. Int. J. Pharm. 2003, 260, 167-173. (6) Feng, S. S.; Ruan, G.; Li, Q. T. Biomaterials 2004, 25, 51815189. (7) Alamelu, S.; Rao, K. P. J. Microencapsulation 1991, 8, 505-519. (8) Jamshaid, M.; Farr, S. J.; Kearney, P.; Kellaway, I. W. Int. J. Pharm. 1988, 48, 125-131. (9) Seki, K.; Tirrel, D. A. Macromolecules 1984, 17, 1692-1698. (10) Dong, C.; Rogers, J. A. J. Controlled Release 1991, 17, 217224. (11) Lichtenberg, D.; Barenholz, Y. Methods Biochem. Anal. 1988, 33, 337-462. (12) Tirrell, D. A.; Takigawa, D. Y.; Seki, K. Ann. N.Y. Acad. Sci. 1985, 446, 237-248. (13) Moscho, A.; Orwar, O.; Chiu, D. T.; Modi, B. P.; Zare, R. N. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 11443-11447. (14) Rothemund, P. W. Nature 2006, 440, 297-302. (15) O’Neill, P.; Rothemund, P. W.; Kumar, A.; Fygenson, D. K. Nano Lett. 2006, 6, 1379-1383.
NL061724X
2757
