Strong and Heterogeneous Adsorption of ... - ACS Publications

Sep 19, 2007 - Strong and Heterogeneous Adsorption of Infectious Bursal Disease VP2 Subviral Particle with Immobilized Metal Ions Dependent on Two ...
0 downloads 0 Views 426KB Size
Download PDF
Anal. Chem. 2007, 79, 7654-7661

Strong and Heterogeneous Adsorption of Infectious Bursal Disease VP2 Subviral Particle with Immobilized Metal Ions Dependent on Two Surface Histidine Residues Shyue-Ru Doong,† Yi-Huei Chen,‡ Su-Yuan Lai,§ Cheng-Chung Lee,| Yu-Chiang Lin,‡ and Min-Ying Wang*,‡

Department of Chemical and Materials Engineering, National Central University, Taoyuan 32001, Taiwan, Graduate Institute of Biotechnology, National Chung Hsing University, Taichung 40227, Taiwan, Department of Food Science, Central Taiwan University of Science and Technology, Taichung 40605, Taiwan, and Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei 112, Taiwan

VP2, the single outer protein of infectious bursal disease virus capsid, can self-assemble into T ) 1 subviral particle (SVP), which can be efficiently purified by immobilized metal ion affinity chromatography (IMAC). In this study, a systemic investigation of the adsorption behavior of VP2 SVP on Ni-NTA resin was performed to identify that His253 and His249 on the surface of SVP are the key factors accounted for the strong and heterogeneous interaction. First, an untagged VP2-441 SVP was constructed, expressed, and purified by IMAC to demonstrate that SVP can interact with immobilized Ni2+ ions on NTA resin without an inserted His tag. Second, equilibrium adsorption studies were used to demonstrate that SVP has a higher affinity to the immobilized Ni2+ ions than a model protein, bovine serum albumin, although the maximum amount of SVP bound per volume resin is limited by the pore size of the resin as verified by confocal microscopic analysis. Third, based on structural analysis and computer modeling, His253 and His249 on the surface of SVP are responsible for a strong heterogeneous and multiple adsorption with the immobilized Ni2+ ions; and this was confirmed by a point-mutation experiment. This is the first example to elucidate the interaction between the immobilized metal ions and viral particles at molecular level. A detailed understanding of SVP-immobilized metal ion interactions can provide useful strategies for engineering icosahedral protein nanoparticles to achieve a simple and one-step purification by IMAC. Immobilized metal ion affinity chromatography (IMAC), first introduced by Porath et al.,1 employs metal ions as the affinity * To whom correspondence should be addressed, E-mail: mywang@ dragon.nchu.edu.tw. Telephone: +886-4-2285-6697. Fax: 886-4-2285-6697, +8864-2285-3527. † National Central University. ‡ National Chung Hsing University. § Central Taiwan University of Science and Technology. | National Yang-Ming University. (1) Porath, J.; Carlsson, J.; Olsson, I.; Belfrage, G. Nature 1975, 258, 598599.

7654 Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

ligand to achieve protein separation through affinity adsorption, analogous to the biospecific interaction between an enzyme and its coenzyme. Nowadays, IMAC is most frequently used for the purification of recombinant proteins in which a polyhistidine tag is introduced.2-4 IMAC depends on a coordination binding between certain amino acids (e.g., histidine, cysteine) exposed on the protein surface and the metal ions (intermediate and hard metal ions) attached to the chelating ligands that are covalently bound onto the solid chromatographic support (silica or agarose).3,5 Among the possible electron donors, histidine is the primary amino acid binding with metal ions at neutral pH.6 The topography of histidine residues on the protein surface bears important structural information and can be probed using IMAC.7,8 The number, surface accessibility, and microenvironment of histidine residues on the protein surface can affect the extent of the interaction between histidines and immobilized metal ions.7,9 For instance, histidines located in the loops of the protein surface are more flexible and can better accommodate the immobilized metal ions;10 and certain microenvironments causing the histidine to be involved in intramolecular interactions reduced its binding strength. Industrial application of IMAC for large-scale protein purification has a number of advantages, such as ligand stability, high protein loading, mild elution condition, simple regeneration, low cost, etc.3 Although IMAC was introduced two decades ago, it has been used mainly to purify proteins and peptides.5 Recently, this technique was applied for the purification of viruses, such as adeno-associated virus, baculovirus, herpes simplex virus, and (2) Gaberc-Porekar, V.; Menart, V. J. Biochem. Biophys. Methods 2001, 49, 335360. (3) Chaga, G. S. J. Biochem. Biophys. Methods 2001, 49, 313-334. (4) Ueda, E. K.; Gout, P. W.; Morganti, L. J. Chromatogr., A 2003, 988, 1-23. (5) Porath, J. Protein Expression Purif. 1992, 3, 263-281. (6) Todd, R. J.; Johnson, R. D.; Arnold, F. H. J. Chromatogr., A 1994, 662, 13-26. (7) Berna, P. P.; Mrabet, N. T.; Van Beeumen, J.; Devreese, B.; Porath, J.; Vijayalakshmi, M. A. Biochemistry 1997, 36, 6896-6905. (8) Jiang, K. Y.; Pitiot, O.; Anissimova, M.; Adenier, H.; Vijayalakshmi, M. A. Biochim. Biophys. Acta 1999, 1433, 198-209. (9) Pathange, L. P.; Bevan, D. R.; Larson, T. J.; Zhang, C. Anal. Chem. 2006, 78, 4443-4449. (10) Gaberc-Porekar, V.; Menart, V.; Jevsevar, S.; Vidensek, A.; Stalc, A. J. Chromatogr., A 1999, 852, 117-128. 10.1021/ac070745o CCC: $37.00

© 2007 American Chemical Society Published on Web 09/19/2007

retrovirus, with an inserted His tag.11-14 However, the detailed information related to the interaction between viruses and the immobilized metal ions has been elusive. Recombinant virus-like particles (VLPs) have gained much attention in the fields of biotechnology and nanotechnology. VLPs that are morphologically and antigenically similar to native virus are generally developed as vaccines, especially as a safer alternative to attenuated live or inactivated killed virus-based vaccines.15 A remarkable progress in structural virology has also been achieved because of the structural analysis of VLPs by cryoelectron microscopy and X-ray crystallography.16 The T ) 1 subviral particle (SVP) with a size ∼25 nm in diameter self-formed by 60 recombinant VP2 monomers of infectious bursal disease virus (IBDV) is one of the examples.17 IBDV, the causative pathogen of a highly contagious disease in young chickens, belongs to genus Avibirnavirus of the Birnaviridae family. The disease could lead to the destruction of precursors of antibody-producing B cells in Fabricius’ bursa, resulting in a severe immune depression.18-20 This virus is characterized by two double-stranded RNA segments21 with the larger segment A encoding a polypeptide that can be proteolytically processed to yield pVP2, VP2, VP3, and VP4 proteins.22 Among them, VP2 is the single protein to form the capsid of the virus, which is 60-65 nm in size and has a T number of 13,23,24 and reasonably, VP2 protein is the primary hostprotective immunogen with epitopes responsible for eliciting neutralizing antibodies.25-27 A His-tagged recombinant VP2-452H-formed SVP was purified efficiently with a Ni-nitrilotriacetic acid (NTA) column in our previous work,17 in which VP2-452H (or named as rVP2H previously) is a chimeric recombinant VP2-452 protein with 452 amino acid residues plus 6 extra histidine residues at the C-terminus as a His tag of a local strain of IBDV P3009. However, a subsequent study of the crystal structure of this virus found that the appended His tag on the C-terminus was buried inside and inaccessible to the Ni2+ ions,28 and it was assumed that the affinity would depend on the strong negative charge or the histidine residues on the (11) Zhang, H. G.; Xie, J.; Dmitriev, I.; Kashentseva, E.; Curiel, D. T.; Hsu, H. C.; Mountz, J. D. J. Virol. 2002, 76, 12023-12031. (12) Hu, Y.-C.; Tsai, C. T.; Chung, Y.-C.; Lu, J.-T.; Hsu, J. T.-A. Enzyme Microb. Technol. 2003, 33, 445-452. (13) Jiang, C.; Wechuck, J. B.; Goins, W. F.; Krisky, D. M.; Wolfe, D.; Ataai, M. M.; Glorioso, J. C. J. Virol. 2004, 78, 8994-9006. (14) Ye, K.; Jin, S.; Ataai, M. M.; Schultz, J. S.; Ibeh, J. J. Virol. 2004, 78, 98209827. (15) Grgacic, E. V.; Anderson, D. A. Methods 2006, 40, 60-65. (16) Tang, L.; Johnson, J. E. Biochemistry 2002, 41, 11517-11524. (17) Wang, M. Y.; Kuo, Y. Y.; Lee, M. S.; Doong, S. R.; Ho, J. Y.; Lee, L. H. Biotechnol. Bioeng. 2000, 67, 104-111. (18) Muller, H.; Becht, H. J. Virol. 1982, 44, 384-392. (19) Nagarajan, M. M.; Kibenge, F. S. Can. J. Vet. Res. 1997, 61, 81-88. (20) Saif, Y. M. Poult. Sci. 1998, 77, 1186-1189. (21) Dobos, P.; Hill, B. J.; Hallett, R.; Kells, D. T.; Becht, H.; Teninges, D. J. Virol. 1979, 32, 593-605. (22) Hudson, P. J.; McKern, N. M.; Power, B. E.; Azad, A. A. Nucleic Acids Res. 1986, 14, 5001-5012. (23) Coulibaly, F.; Chevalier, C.; Gutsche, I.; Pous, J.; Navaza, J.; Bressanelli, S.; Delmas, B.; Rey, F. A. Cell 2005, 120, 761-772. (24) Saugar, I.; Luque, D.; Ona, A.; Rodriguez, J. F.; Carrascosa, J. L.; Trus, B. L.; Caston, J. R. Structure 2005, 13, 1007-1017. (25) Becht, H.; Muller, H.; Muller, H. K. J. Gen. Virol. 1988, 69, 631-640. (26) Azad, A. A.; Jagadish, M. N.; Brown, M. A.; Hudson, P. J. Virology 1987, 161, 145-152. (27) Fahey, K. J.; Erny, K.; Crooks, J. J. Gen. Virol. 1989, 70, 1473-1481. (28) Lee, C. C.; Ko, T. P.; Chou, C. C.; Yoshimura, M.; Doong, S. R.; Wang, M. Y.; Wang, A. H. J. Struct. Biol. 2006, 155, 74-86.

SVP surface.28 VP2 is folded mainly into a shell (S) domain and a protrusion (P) domain, both with the Swiss-roll topology, plus a small helical base (B) domain in both the virion of IBDV and the SVP.23 The surface loops of the P domain of VP2 SVP are responsible for interaction with receptor29 and the recognition by antibody30 is expecting to interact with the immobilized Ni+2 ions. In this study, a systemic investigation of the adsorption behavior of VP2 SVP on Ni-NTA resin was performed to identify the key factors accounting for the strong interaction. First, an untagged VP2-441 SVP was constructed, expressed, and purified by IMAC to demonstrate that SVP can interact with immobilized Ni2+ ions on NTA resin without an inserted His tag. Second, equilibrium adsorption studies were used to quantify the interaction strength between SVP and metal ions. Third, the histidine residues and topography on the surface P domain of the SVP, which could bind with the metal ions on the column, were examined by computer modeling. Finally, point mutation was used to assess the importance of His249 and His253 residues on loop DE of P domain for the efficient purification of VP2 SVP by a nickel-NTA column. MATERIALS AND METHODS Cells and Viruses. High-five (Hi-5) cells (Invitrogen) were routinely cultured and passaged in ESF-921 medium (Expression System LLC, Woodland, CA). Recombinant baculovirus stocks were propagated in Spodoptera frugiperda (Sf 9) cells (American Type Culture Collection 1171) using TNM-FH medium (Sigma) supplemented with 10% fetal bovine serum (Biological Industries, Kibbutz Bet Haemek, Israel) in tissue culture flasks (Corning, NY) at 28 °C. Generation of Recombinant Baculovirus Expressing IBDV VP2-Formed SVP. Generation of the recombinant baculovirus expressing VP2-441-formed subviral particle followed the procedures described previously.17 VP2-452H used herein had been prepared by Wang et al.17 In this study, a VP2 gene fragment VP2441 encoding VP2 with 441 amino acid residues was generated by polymerase chain reaction (PCR), using pBluescript-VP2 as a template31 and a pair of primers: the forward primer P4F 5′CGATCGCTAGCGATGACAAAC3′ and the reverse primer 1323NH: 5′CGAATTCCTATGCTCCTGCAATCTTCAG3′. Following the standard procedures, the recombinant transfer plasmid pBB4∆C11 was obtained by inserting the PCR-generated gene fragment VP2-441 into a transfer vector, pBlueBac4.17 The recombinant baculovirus was obtained by cotransfecting plasmid pBB4∆C11 with linear AcMNPV DNA into Sf 9 cells as described in the manual provided by the supplier (Invitrogen). Then, putative recombinant baculoviruses were plaque-purified. The expression of VP2-441 monomer proteins in Sf 9 or Hi-5 cells was characterized by Western blot using a polyclonal anti-VP2.32 Generation and Expression of VP2 SVP in Escherichia coli. Site-directed mutagenesis was performed using the QuickChange site-directed mutagenesis kit (Stratagene), and plasmid (29) van Loon, A. A.; de Haas, N.; Zeyda, I.; Mundt, E. J. Gen. Virol. 2002, 83, 121-129. (30) Heine, H. G.; Haritou, M.; Failla, P.; Fahey, K.; Azad, A. J. Gen. Virol. 1991, 72, 1835-1843. (31) Chung, Y. T.; Yu, S. L.; Shieh, H. K.; H., L. L. Taiwan J. Vet. Med. Anim. Husbandry 1995, 65, 205-213. (32) Lee, M. S.; Doong, S. R.; Lai, S. Y.; Ho, J. Y.; Wang, M. Y. Biotechnol. Prog. 2006, 22, 763-769.

Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

7655

Table 1. One-Step Purification of VP2-441 SVP by Ni-NTA Column VP2-441 fraction

total protein (mg)a

VP2 (mg)b

VP2 recovery (%)c

purif foldd

lysate flow through pH 7.8 wash pH 6.3 wash pH 4.0 eluate

55.00 50.74 1.84 1.21 1.00

1.00 0.07 0.00 0.00 0.92

92.00

51.00

a Protein concentration was determined by BCA method. b Estimated from band intensity on a membrane was using KODA 1D 3.6 software following Western blot. c The recovery was calculated as the ratio of the quantity of eluent VP2-441 protein to total VP2-441 protein in the cell lysate. d The purification fold was calculated as the ratio of the purity of eluent to the purity of the cell lysate.

TOPO-1323 was used as the DNA template for the expression of VP2-441-H249253A, a mutant of VP2-441 with the mutation of two histidine residues (positions 249 and 253) to alanine. A TOPO1323 mutant (H249253A) thus created was sequenced to confirm this CAC histidine codon of mutated gene. To express the recombinant proteins, i.e., VP2-441 and VP2-441-H249253A, plasmids TOPO-1323 and TOPO-1323H249253A mutant were transformed into E. coli host (BL21(DE3)codonplus-RP) by following the procedures described previously.33 A fresh overnight culture of E. coli BL21(DE3)codonplus-RP carrying pTOPO-1323 or pTOPO-1323H249253A was diluted with 500 mL of fresh LB medium in the presence of ampicillin (200 µg/mL) and grown to OD600 of 0.6 at 37 °C at 250 rpm in a shaker. Protein expression was induced by adding isopropyl β-thiogalactopyranoside to 1 mM for 4 h at 37 °C. After induction, protein preparation and IMAC purification also follow the procedures described previously.33 Production and Purification of Insect Cell-Derived VP2 SVP. SVP formed by VP2-441 or VP2-452H was produced and purified using previously established protocols34 and characterized by SDS-PAGE staining with silver nitrate, Western blot, and negative-stain electron microscopy, and the VP2 SVP concentration was determined by HPLC (BioSys 510, Beckman). The elution volume of VP2 SVP was 7.5 mL through a TSK-GEL G5000PWXL column with a mobile phase of phosphate buffer (pH 7.4) at a flow rate of 0.5 mL/min. Bovine serum albumin (BSA) (Sigma) with a molecular mass of 66 kDa was used as a quantitative standard. Equilibrium Adsorption Isotherm of VP2 SVP. The following experiments were performed within a cool room maintained at 4 °C. A total of 1 mL of VP2-452H, VP2-441 SVP, or BSA solution in buffer (20 mM NaH2PO4, 500 mM NaCl, pH 7.8) was added to 0.1 mL of Ni-NTA agarose resin (Qiagen, Hilden, Germany) suspension in a microcentrifuge tube and was put on an end-over-end rotator (6 rpm); the reaction was terminated by centrifugation at 1000g for 20 s. Preliminary determinations found that a >99% adsorption between VP2 SVP or BSA and Ni-NTA was achieved in 60 min (data not shown); thus, 1 h was set as the optimal equilibrium time for isotherm adsorption experiments. (33) Chen, C. S.; Suen, S. Y.; Lai, S. Y.; Chang, G. R.; Lu, T. C.; Lee, M. S.; Wang, M. Y. J. Virol. Methods 2005, 130, 51-58. (34) Lee, C. C.; Ko, T. P.; Lee, M. S.; Chou, C. C.; Lai, S. Y.; Wang, A. H.; Wang, M. Y. Acta Crystallogr., D: Biol. Crystallogr. 2003, 59, 1234-1237.

7656 Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

Figure 1. Purity analysis of VP2-441 SVP prepared with gel filtration following IMAC. The elution containing VP2-441 SVP was collected and concentrated through an Amicon Ultra-15 centrifugal filter (100 kDa) and analyzed by electrophoresis, electron microscopy and HPLC. (A) Western blot with anti-VP2 polyclonal antibody. Lane 1 was cell lysates, and lane 2 was the concentrate of pH 4.0 eluate. (B) Electron micrograph with a magnification of 100000×. The concentrate (0.01 mL) was loaded onto the grid using 2% uranyl acetate as negative stain and examined with a transmission electron microscope. (C) Typical HPLC chromatogram. The concentrate (0.1 mL) was applied on TSK-GEL G5000PWXL column with 0.5 mL/ min flow rate, and the elution volume of VP2-441 SVP was 6.9 mL with a purity of 99% as determined by System Gold software of HPLC.

Free SVP or protein in the solution was determined by HPLC, and the amount of bound SVP or protein was calculated by mass balance. FITC Labeling and Batch Adsorption of VP2 SVP. VP2 SVP and BSA were reacted with fluorescein isothiocyanate (FITC) (FITC isomer I, Sigma) at a feed molar ratio of 1:300. Aqueous solution of SVP or protein was incubated with FITC at room temperature for 1 h mixing with reaction buffer (160 mM Na2CO3, 333 mM NaHCO3, pH 9.5). The FITC-labeled SVP or protein was dialyzed with the binding buffer (20 mM NaH2PO4, 0.5 M NaCl, pH 7.8) using 100-kDa Amicon Ultra-15 centrifugal filter (Millipore, NY) to remove unreacted FITC, and again FITC-labeled SVP or protein concentrations were determined by HPLC. The process of fluorescence-labeled VP2 SVP adsorption to Ni-NTA beads followed the same procedures described below. Excessive amount of labeled SVP or protein was used: 0.4 mg/mL SVP or 4 mg/mL BSA was reacted with 0.1 mL of Ni-NTA agarose resin. This agarose resin, with a bead size from 45 to 165 µm and Sepharose CL-6B as support, has a pore size-exclusion of ∼24 nm, a surface area of 25 m2/mL gel,35 and a binding capacity from 5 to 10 mg/mL (300-500 nmol) for the 20-kDa protein. BSA, (35) Suh, C. W.; Choi, G. S.; Lee, E. K. Biotechnol. Appl. Biochem. 2003, 37, 149-155.

Figure 2. Confocal images of Ni-NTA agarose bead incubated with fluorescence-labeled SVP and BSA. Beads were observed using excitation 543 (A, C) and 488 nm (B, D) of visible laser 60 min after binding with BSA (A, B) and VP2-441 SVP (C, D). Fluorescence intensity profiles of cross section of the beads are given in (E) for BSA and (F) for VP2-441 SVP.

the model protein, is ellipsoidal in shape (7.05 × 2.08 × 3.13 nm)36 and has a Stokes diameter of ∼3.55 nm.37 Confocal Laser Microscopy. Confocal microscopic analysis was performed using a LSM510 confocal laser scanning microscope (Carl Zeiss Inc.). Individual beads were visualized by horizontal scanning (sectional scanning), i.e., the acquisition of two-dimensional confocal images perpendicular to the optical axis.38 The pinhole aperture was set to 71 µm, and the helium/ neon laser provided the excitation of FITC at 488 nm. The images were analyzed by the Zeiss LSM Image software. An image of the intraparticle distribution of fluorescent molecules along the horizontal section was translated into a fluorescence intensity profile, which showed the fluorescence spectrum in an arbitrary (36) Viker, V. L.; Colton, C. K.; Smith, K. A. J. Colloid Interface Sci. 1981, 79, 548-566. (37) Suh, C. W.; Kim, M. Y.; Choo, J. B.; Kim, J. K.; Kim, H. K.; Lee, E. K. J. Biotechnol. 2004, 112, 267-277. (38) Ljunglof, A.; Thommes, J. J. Chromatogr., A 1998, 813, 387-395.

unit as a function of the radial position. The amount of the proteins located at each radial position was quantitatively determined from this fluorescence spectrum, and this profile, integrated with respect to the radial distance, would indicate the amount of proteins adsorbed to the pores of the bead. RESULTS AND DISCUSSION Untagged VP2-441 SVP Interacts with Immobilized Ni2+ Ions on NTA resin. In a trial to purify untagged VP2 SVP by a Ni-NTA column, recombinant VP2-441, the mature capsid protein of IBDV with the first 441 amino acid residues of the precursor VP2 (pVP2) and produced by a baculovirus-insect cell expression system, was purified to 92% purity using 1 mL of Ni-NTA resin (Table 1). Subviral particle self-assembled from VP2-441 has a homogeneous morphology which is similar to that of VP2-452H SVP as observed under TEM. This efficacy, comparable to that in purifying His-tagged VP2 (VP2-452H) SVP, has not been attained in works on the purification of other His-tagged Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

7657

viruses.11-13 While many proteins without modification have been successfully purified by IMAC, such as growth hormone and prolactin,4 IBDV VP2 SVP of this study is one of the few viral particles purified by IMAC without any affinity tagging. Pore Size of Ni-NTA Beads Affects VP2 SVP Inner Diffusion. To further investigate the adsorption of SVPs formed by VP2-452H and VP2-441 to the immobilized Ni+2 ions chelated on NTA resin, the SVPs with 99.8% purity (Figure 1) were prepared by a two-step procedure34 and were used for the following experiments on thermodynamic phenomenon. As the concentration of free SVP increased, the adsorption of VP2 SVP to the NiNTA resin (Q), i.e., bound protein per volume of resin, gradually reached saturation (∼9 × 10-10 mol/mL Ni-NTA), a level 500fold smaller than 5 × 10-7 mol/mL Ni-NTA for BSA (Figure S1 in Supporting information and Figure 3A), a comparison model protein. This observation has been noted for the adsorption of adenovirus type 5 to ion-exchange resins very recently.39 Since the pore size of NTA gel, ∼24 nm in diameter,35 is similar to the size of SVP (25 nm), the diffusion of the latter into the pores might be hindered, resulting in this very low binding capacity observed for SVP. The effect of pore size of Ni-NTA gel on SVP adsorption was determined experimentally by confocal microscopic analysis, a powerful tool to quantify the adsorption of proteins to the nanopores of a silica matrix.37 We measured the fluorescence intensity of the Ni-NTA bead cross section 60 min after its adsorption of FITC-labeled BSA and VP2-441 SVP, and Figure 2 shows the confocal images obtained. It is clear that BSA with a Stokes diameter of 3.55 nm was able to diffuse into the center and filled the entire cavity of the bead (Figure 2B). But the fluorescence distribution of FITC-labeled SVP was completely different: one can only see the fluorescence on the rim of the Ni-NTA bead. It is clear that FITC-labeled SVP could not diffuse into the interstitial area (Figure 2D), an observation further verified by cross-sectional fluorescence intensity profiles in Figure 2E and F. The fluorescence intensity across the Ni-NTA bead was conspicuous and remained relatively even for BSA, indicating a free entry of this protein through the pores (Figure 2E). However, SVP with a diameter of 25 nm could not diffuse through the pores of ∼24 nm into the vacant space, leaving only a strong fluorescence on the rim of the cross section of the bead (Figure 2F). It may be stated that the immobilized metal affinity membrane, an alternative technique, could be the optimal adsorbent in the future for SVP or even a larger virus purification.33 Although we employ confocal microscopy to measure diffusion of the VP2 particles into the resin, using other techniques and more complex theoretical approaches is warranted to justify the conclusions that are reached.39,40 VP2 SVP Has a Higher Affinity to Ni-NTA than BSA. Because of the pore size limitation, the affinity between SVP and BSA for Ni-NTA must be compared at low binding capacity, i.e., free SVP concentration lower than 2 × 10-8 M. Figure 3B clearly shows that between 1 × 10-9 and 2 × 10-8 M free SVP, considerably more VP2 SVP than BSA was adsorbed by each unit of Ni-NTA resin (Q), indicating that the adsorption of SVP is strong. The recognition of BSA, which contains two or three (39) Trilisky, E. I.; Lenhoff, A. M. J. Chromatogr., A 2007, 1142, 2-12. (40) Langford, J. F.; Schure, M. R.; Yao, Y.; Maloney, S. F.; Lenhoff, A. M. J. Chromatogr., A 2006, 1126, 95-106.

7658 Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

Figure 3. Comparison of the binding affinity of VP2-441 SVP and BSA for Ni-NTA resin. (B) is an enlarged presentation of (A) for free VP2-441 concentrations lower than 3 × 10-8 M. Both figures are adapted from Figure S-1 (Supporting Information).

histidine residues, by chelated and immobilized transition metals seems to be related to the imidazole side chains41 on the protein surface. The observation that the affinity of SVP to Ni-NTA resin was much stronger than that of BSA implies that a multiple-point interaction via histidine residues could be responsible for SVP binding with Ni-NTA. Structural Analysis and Computer Modeling Suggest That His249 and His253 Are Responsible for Its Heterogeneous Adsorption. The efficient purification by the Ni-NTA column of VP2-441 SVP without His tagging prompts us to search for other elements on the primary sequence of the monomer protein (VP2441) that could bind with the metal ions on the column. Among the amino acid residues that can participate in binding with chelated metal ions, cysteine and histidine are generally considered the more important.42 However, the actual protein retention in IMAC has been proposed to depend primarily on the availability of histidine residues.2 Free cysteines are rarely available on the protein surface, and the two cysteines of the VP2 subunit are located in the inner structure of SVP.28 The adsorption of VP2 SVP toward Ni-NTA is thus expected to rely on a contact of histidine residues on the P domain with the bead surface. Compared with globular proteins in general, VP2-441 has a lower number (five) of histidine residues,42 with two of these five, i.e., His249 and His253, on the P domain of SVP surface and the other three (His36, His71, and His338) buried inside of SVP. We sent (41) Andersson, L.; Sulkowski, E.; Porath, J. Bioseparation 1991, 2, 15-22. (42) Arnold, F. H. Biotechnology (N. Y.) 1991, 9, 151-156.

Figure 4. Surface contour of His249 and His253. (A) The solvent-accessible molecular surface is depicted as a semitransparent surface with green and red colors. The residues His 249 and His 253 are depicted as ball-and-stick models and colored in red. (B) The top view (left) and side view (right) of a VP2-452H trimer (generated from chain B of 2DF7) are shown in surface contour. His249 and His253 on the loop DE were labeled in red.

the PDB file of VP2-452H SVP structure data to the Website of Sealy Center for Structural Biology and Molecular Biophysics to calculate solvent-accessible surface area. The water-accessible surfaces predicted by GETAREA 1.1 software were 44% for His249 and 100% for His253 residues, respectively. Thus, His249 and His253 on the most exposed loop DE (PDE loop) may be the candidate binding sites with the immobilized Ni2+ ions (Figure 4A). Taking into account the 3D structure of SVP, it appears reasonable to assume that His249 and His253 of the VP2 trimers of SVP can interact with the immobilized Ni2+ ions (Figure 4B). These 3 pairs (His249 and His253) of histidine residues in any 1 of 20 SVP trimers (Figure 4B) present a geometry without any secondary structure within it to hinder their coordination interaction with Ni2+ ions; and loop FG or HI of P domain adjacent to this geometry could be bent so that they did not form any steric hindrance that might occur (Figure 4A). Similarly, it has been reported that, by introducing one or two histidine residues onto the flexible loop region of the trimeric molecule of tumor necrosis facter, very good chromatographic characteristics in IMAC matrixes were observed, and the planar clusters of three or six histidine residues on the protein surface were proposed to account for the strong affinity.10 Point Mutation Suggests That His249 and His253 of SVP Are Responsible for Its Heterogeneous Adsorption. A significant body of research has been directed at understanding the role of specific charged amino acid (AA) residues and clusters of AA in adsorption to ion-exchange chromatography, a similar interaction that occurs in IMAC.43-45 For example, a change of a single charge in cytochrome b5 could profoundly alter the

adsorption kinetics of the protein on a variety of different surfaces.46 To further confirm the interaction between SVP and Ni2+ ions dependent on His249 and His253, a point-mutation experiment replacing these two histidine residues of VP2-441 by alanine was carried out. The point-mutation experiment was performed in E. coli because it is convenient and our previous result has confirmed that VP2-441 derived from E. coli can form SVP that could be purified by IMAC (Figure 5A). Expressed in E. coli and polished by 20-40% CsCl gradient centrifugation, the resultant protein VP2-441-H249253A monomer was able to selfassemble into SVP with a size very similar to E. coli-derived VP2441 SVP (Figure 5A). Unlike VP2-441 SVP, VP2-441-H249253A SVP flowed freely through the Ni-NTA column showing no affinity toward the resin (Figure 5B), indicating that the remaining His338, His71, His36, and other residues do not significantly interact with Ni2+ ions when His253 and His249 are absent. A previous assumption that the strong negative charge on the outer surface of the virus particle might account for SVP affinity to the Ni-NTA column at pH 7.828 is incompatible with the findings of this work because the charge on the outer surface of the mutant SVP is not expected to significantly change. It is thus concluded that His249 and His253 appear to be the primary binding sites on top of SVP for the immobilized Ni2+ ions, and the affinity between these two histidine residues and Ni2+ ions is apparently strong enough to (43) Roth, C. M.; Unger, K. K.; Lenhoff, A. M. J. Chromatogr., A 1996, 726, 45-56. (44) Gill, D. S.; Roush, D. J.; Willson, R. C. J. Chromatogr., A 1994, 684, 55-63. (45) Chicz, R. M.; Regnier, F. E. J. Chromatogr. 1988, 443, 193-203. (46) Ramsden, J. J.; Roush, D. J.; Gill, D. S.; Kurrat, R.; Willson, R. C. J. Am. Chem. Soc. 1995, 117, 8511-8516.

Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

7659

Figure 5. Characterization of VP2-441-H249253A SVP. (A) Morphology of IBDV VP2-441-H249253A SVP after CsCl gradient centrifugation. E. coli-derived VP2-441 and VP2-441-H249253A SVPs were partially purified and then were subjected to isopycnic centrifugation on 20-40% CsCl gradients. The 0.01 mL of the fractions with buoyant densities in the range of 1.25-1.29 g/cm3 was loaded onto the grid, stained with 2% uranyl acetate, and examined with a transmission electron microscope with a magnification at 100000×. Bar, 50 nm. (B) Western blot analysis of VP2-441 and VP2-441-H249253A purified by IMAC. Protein was recognized with anti-VP2 polyclonal antibody.

exclude other accessory interactions between SVP and IMAC resin. The topography of histidines as the binding sites can provide important structural information to help elucidate the functional properties of a protein, such as its affinity toward IMAC gel, virulence changes, etc.4,47 While the surface accessibility of amino acids is an important parameter in describing the protein surface structure, it does not necessarily provide insights into some other important aspects.9 For example, His57 in chymotrypsin was a surface-accessible residue and, yet, did not bind to IMAC column packaged with Novarose-IDA-Cu+2 due to its involvement in intramolecular hydrogen bonding.7 Our previous study attempting to locate heavy atom-binding sites on the crystal structure of the VP2-452H-formed SVP found that His253 could bind with the heavy-atom cluster of Ta6Br122+,28 suggesting that it is possible for His253 to interact with Ni+2 ions and this is confirmed by this study. Besides, there are reports that IBDV adaptation to cell culture48,49 and its virulence29,47 were controlled by changes of amino acids at positions His253 (loop PDE), Asp279 (strand PF), and Thr284 (loop PFG) in VP2, suggesting that these residues may engage directly in contacts with a receptor of the target cell.23 These observations imply that His253, with less microenvironment effect and steric hindrance to interaction with other proteins, is possibly the major binding site for the immobilized Ni2+ ions on Ni-NTA resin and this remains to be determined by point mutation only at position His253 or His249. (47) Brandt, M.; Yao, K.; Liu, M.; Heckert, R. A.; Vakharia, V. N. J. Virol. 2001, 75, 11974-11982. (48) Mundt, E. J. Gen. Virol. 1999, 80, 2067-2076. (49) Lim, B. L.; Cao, Y.; Yu, T.; Mo, C. W. J. Virol. 1999, 73, 2854-2862.

7660 Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

CONCLUSIONS A geometry formed by His249 and His253 of three VP2-441 subunits in a trimer of SVP plays a vital role in the strong adsorption of SVP with the immobilized Ni2+ ions. Although not fully characterized, these six histidine residues in this geometry probably interact with several Ni2+ ions, making a very strong binding between SVP and resin. This interaction can be affected by the size (T number) and recombinant variants of SVP, e.g., introducing histidine residues at different loops, and conformational changes related to the microenvironment of histidine residues, producing different binding strength. Significant research has been devoted to the use of computational modeling (including electrostatics) to elucidate the impact of changes in amino acid composition on binding and the impact of topography on interactions.50,51 Our future efforts would focus on studying the effect of these topographic changes of histidine residues on its adsorption with the immobilized metal ions using computational modeling in order to develop a methodology for the simple and one-step purification of icosahedral protein nanoparticles by IMAC. Additionally, the pore size of Ni-NTA resin was found to be a significant factor to limit SVP adsorption, which also needs to be considered when other natural or recombinant viruses are purified by IMAC. ACKNOWLEDGMENT This research was supported by grants from the National Science Council (Grants NSC 93-2313-B-005-070 and 94-2313-B(50) Hlady, V. V.; Buijs, J. Curr. Opin. Biotechnol. 1996, 7, 72-77. (51) Roush, D. J.; Gill, D. S.; Willson, R. C. Biophys. J. 1994, 66, 1290-1300.

005-042). Critical review of the manuscript by Professor ChihNing Sun (Department of Entomology, National Chung-Hsing University) and technical assistance by Ms. Pei-Chi Chao (Laboratory of Electron Microscopy, National Science Council, National Chung Hsing University) is gratefully acknowledged.

SUPPORTING INFORMATION AVAILABLE Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org. Received for review April 14, 2007. Accepted August 3, 2007. AC070745O

Analytical Chemistry, Vol. 79, No. 20, October 15, 2007

7661