Studying potassium induced G-quadruplex DNA folding

Subscriber access provided by Nottingham Trent University

Article

Studying potassium induced G-quadruplex DNA folding process using MicroScale Thermophoresis Ming-Li Zhang, Ya-Peng Xu, Arvind Kumar, Yu Zhang, and Wen-Qiang Wu Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.9b00447 • Publication Date (Web): 30 Aug 2019 Downloaded from pubs.acs.org on August 30, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Studying potassium induced G-quadruplex DNA folding process using MicroScale Thermophoresis Ming-Li Zhang, Ya-Peng Xu, Arvind Kumar, Yu Zhang, Wen-Qiang Wu* School of Life Sciences, Key Laboratory of Plant Stress Biology, State Key Laboratory of Cotton Biology, Henan University, Kaifeng 475001, China. *To whom correspondence should be addressed. Email: [email protected]

1

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 11

ABSTRACT: Guanine (G)-quadruplexes (G4s) can be formed by G-rich sequences when stabilized with the binding of cations (typically K+ or Na+), and play an essential role in replication, recombination, transcription and telomere maintenance. Understanding of G4 folding process is crucial to determine their cellular functions. However, G4-K+ interactions and folding pathways are still not well understood. By using human telomeric G4 (hTG4) as an example, two binding states corresponding to two K+ binding to hTG4 were distinguished clearly and fitted precisely. The basic binding parameters during G4-K+ interactions were measured and calculated taking the advantage of MicroScale Thermophoresis (MST) which monitors the changes of charge and size at the same time. G-hairpin and G-triplex have been suggested as intermediates during G4 folding/unfolding. We further analyzed the equilibrium dissociation constants of ten possible folding intermediates using MST, thus the energetically favorable folding/unfolding pathways were proposed. The results might not only shed new light on G4-K+ interactions and G4 folding pathways, but also give an example to experimentally study DNA-ion interactions.

2


Page 3 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

G4s are four-stranded non-B form secondary nucleic acid structures held together by Hoogsteen-bonded planar G-quartets, and stabilized by cations such as K+ and Na+

1, 2.

Recently, G4s have attracted more attention of researchers due to their importance in replication,

recombination, transcription and telomere maintenance 3, as well as their applications as smart biosensors and molecular devices 4. Human telomeric G4 (hTG4) DNA is one of most studied G4 structure, since its significance in telomere regulation and potential ability in anticancer drug design 5. It is thought that K+ induced G4 structures are more relevant in physiological conditions due to high concentration of K+ among intracellular cations 6. Different methods such as structural 6-8, single-molecule 9-11, computational 12, 13 and kinetic methods 14, 15 have been used to study hTG4 properties 16, resulting in many structural and kinetic details of hTG4 in K+ solution. Regardless of the topological structures, the folding process of hTG4 DNA contains two main steps, which comprises subsequent binding of two K+ to hTG4 sequence (Figure 1A, inset)

12, 14, 17.

However, because the K+ binding and structural changes are difficult to

capture at the same time, the basic binding parameters of K+ with hTG4 in each step, such as equilibrium dissociation constants (KD), standard enthalpy change (CH ), standard entropy change ( S ) and standard Gibbs free energy change (

), which are essential for revealing the

kinetic folding of hTG4, are still not comparatively measured or calculated in one system 17, 18. Understanding of G4 folding intermediates will be helpful in deciphering G4 cellular functions as well as designing of anticancer drugs. Therefore, many theoretical

12, 19, 20

and experimental

14, 21-30

studies have been carried out, which suggests the involvement of G-

hairpin and G-triplex in G4 folding/unfolding pathways. In particular, G-hairpin and G-triplex structures induced by salt and ligand are confirmed directly at single-molecule level using DNA origami and atomic force microscopy (AFM) 22, 23, and also detected by NMR 21, 30. Further, G-hairpin and G-triplex related folding dynamics of intra-strand hTG4 has been studied by us using single-molecule D resonance energy transfer method 9. However, there is possibility of six G-hairpins and four G-triplexes, regardless of the topological structures, which prompts us to speculate 24 kinds of folding/unfolding pathways (Figure 3B). Out of these, are there the energetically favorable folding/unfolding pathways? Table 1. The sequence of hTG4 and the KD values of K+ binding to hTG4 at different temperatures. Substrat e

hTG4

Sequence

(FAM)TGGGTTAGGGTTAGGGTTAGG G

Temperature ( C)

KD1 (mM)

KD2 (mM)

22

0.7 ± 0.2

35 ± 2

24

0.8 ± 0.1

39 ± 2

26

1.2 ± 0.2

54 ± 4

28

1.9 ± 0.3

59 ± 4

30

2.3 ± 0.4

76 ± 6

MicroScale Thermophoresis (MST) is one kind of molecular interaction quantifying methods, based on the motion differences of molecules in microscopic temperature gradients 31. It is sensitive to molecular properties such as size, charge and hydration shell, and has been widely used to study DNA-DNA, DNA-protein, protein-protein and protein-small molecule interactions

31-34.

In the current study,

taking advantage of MST’s ability to simultaneously detect ion binding (charge change) and structural change, we accurately characterized 3


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 11

the binding kinetics of hTG4 with K+. We not only measured the KD values, but also calculated CH , S and

for each K+ binding.

Furthermore, the most stable intermediates and the energetically favorable folding pathways were dissected out by analyzing the binding constants of ten kinds of possible G-hairpin and G-triplex intermediates. MATERIAL AND METHODS MST preparations. All DNA oligonucleotides labeled with 5’-FAM were purchased from Sangon Biotech (Shanghai, China). The sequences of these oligonucleotides were given in Table 1 and 2. The MST reaction buffer contained 20 mM Tris-HCl (pH 8.0), and different concentrations of KCl (0.03-1000 mM). The substrate concentration (oligonucleotides) annealed in each MST reaction was 1 K , The annealing reaction was performed by incubating at 95 C for 5 min, there after slow cooling to room temperature in about 3 hours. MST data acquisition. The MST assays were performed according to the manufacturer’s protocol using NanoTemper monolith NT.115 (NanoTemper Technologies, Germany). Briefly, different kinds of DNA substrates (20 nM) were incubated with varying concentrations of KCl in MST reaction buffer for 30 min at 22 C. Afterward, the experiments were carried out using 60% LED power and 40% MST, Laser-On time 30 s and Laser-Off time 5 s at specific temperatures (Figure S1). Original fluorescence data was collected from thermophoresis signal via NTAnalysis from three independent experiments. MST data analysis. The KD values were calculated via the mass action equation using Nanotemper Analysis. The CH and CS were fitted using Equation 1 (Note S1 for computation details):

ln

( )=

-

CH RT

+

CS

Equation 1

R

Where c is normal concentration (1 mol·L-1), R is the ideal gas constant (8.314 J·mol-1·K-1), and T is absolute temperature. RESULTS Two subsequent K+ binding progresses can be detected during hTG4 folding using MST. In order to determine the thermodynamic interactions of hTG4 with K+, the D

# ! labeled hTG4 (20 nM) substrate was mixed with increasing concentrations of potassium

chloride (0.03 to 1000 mM). Using MST technology, firstly fluorescence traces were measured at 22 C (Figure S1), thereafter thermophoretic changes were calculated and plotted (Figure 1A). Surprisingly, a biphasic binding pattern was observed. The first and second progresses could correspond to the first and second K+ binding to hTG4 sequence respectively (Figure 1A, inset), because only these two steps of binding can maximally change the charge and structure of hTG4. This finding is also consistent with subsequent binding of two K+ with the increase of KCl concentration 17. Based on the principle of MST, the normalized fluorescence change can be detected due to the thermophoretic movement of the fluorescence labeled molecules out of the heated sample volume 32. Due to the binding of non-fluorescent ligands, the thermophoretic movement of fluorescence-labeled molecules may be faster leading to decreased fluorescence or be lower resulting in increased fluorescence. The change in the migration speed is complex which depends on the combined impact of alterations in size, charge and hydration shell. Here, the first K+ binding could decrease the speed of thermophoretic movement, on the contrary, the second 4


Page 5 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 6 of 11

Page 7 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

energetically favorable intermediate. Thus, KD values were used to infer the stability of different intermediates. The fact that 5’ G-hairpin (G1-2) and 5’ G-triplex (G1-2-3) were more stable than 3’ G-hairpin (G3-4) and 5’ G-triplex (G2-3-4) agreed with our single-molecule experiments 9. Moreover, based on the experimental KD values, it can be revealed that G1-2 and G1-4 type G-hairpins as well as G1-2-4 type G-triplex were most stable in the same kind. Therefore, the energetically favorable G4 folding/unfolding pathways were proposed (Figure 3B): The binding of first K+ to hTG4 sequence induces it to fold into G1-2 or G1-4 type G-hairpin, which then folded into G1-2-4 type Gtriplex. The subsequent binding of another K+ leads to the formation of fully folded hTG4 structure. It is noteworthy that the most stable Ghairpin G1-2 and G1-4 further folded into the same G-triplex G1-2-4, which reflects the accuracy of MST technique. To the best of our knowledge, it is the first prediction of energetically favorable G4 folding/unfolding pathways from the comparative stability study of all possible intermediates, and G1-2-4 type G-triplex was not considered before in both theoretical 12, 20 and experimental 14, 21-30 studies. Table 2. The sequence of G4 intermediates at 22 C. Substrate a

Sequence

G1-2-3

(FAM)TGGGTTAGGGTTAGGGTTTTTT

G1-2-4

(FAM)TGGGTTAGGGTTATTTTTTGGG

G1-3-4

(FAM)TGGGTTATTTTTTGGGTTAGGG

G2-3-4

(FAM)TTTTTTTGGGTTAGGGTTAGGG

G1-2

(FAM)TGGGTTAGGGTTTTTTTTTTTT

G1-3

(FAM)TGGGTTATTTTTAGGGTTTTTT

G1-4

(FAM)TGGGTTATTTTTTTTTTTAGGG

G2-3

(FAM)TTTTTTAGGGTTAGGGTTTTTT

G2-4

(FAM)TTTTTTTGGGTTATTTTTAGGG

G3-4

(FAM)TTTTTTTTTTTTAGGGTTAGGG

a. The numbers used represent the sequential presence of GGG repeats in reference to hTG4 in the 5’ to 3’ direction.

DISCUSSION In this study, we used simple and sensitive MST technique 32, 34, attempting to dissect out the basic binding parameters including KD ,CH , C S and CG (Figure 1,2 and Table S1) during G4 folding. Further two energetically favorable folding pathways were revealed from 24 possible pathways using mutated hTG4 (Figure 3 and Table 2). Electrospray mass spectrometry (ESI-MS) has been utilized to determine the number of K+ binding with hTG4 with increasing K+ concentrations 17. The major limitation of ESI-MS experiments is the inability to simulate real binding equilibrium in solution and reflect structural changes. Moreover, CH , CS

and CG were also not considered in this study. Recently, the binding parameters of hTG4 with

K+ were calculated based on thermo and structural changes with K+ binding which were measured respectively via differential scanning calorimeter (DSC) and circular dichroism (CD) spectroscopy 18. The fitting of folding states using global analysis demonstrated there was

7


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 8 of 11

Page 9 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

G-triplex is thought to be the core intermediate. While we found that the most stable G-triplex is G1-2-4, which should be given more consideration in further fundamental and medical studies. ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: XXXX Note S1 and Figure S1-S4 AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] ORCID Wen-Qiang Wu: 0000-0003-3293-1603 Author Contributions W.Q.W designed this work. M.L.Z, Y.P.X, A.K and Y.Z performed the experiments. W.Q.W wrote the manuscript. All authors reviewed the manuscript. Funding This research was supported by the National Natural Science Foundation of China (31800644) and the Key Scientific Research Projects in Colleges and Universities in Henan Province (19A180014). Notes The authors declare no competing financial interests. ACKNOWLEDGMENT We would like to thank Dr. Xi-Miao Hou for suggestions and critical reading of the manuscript. REFERENCES [1] Bochman, M. L., Paeschke, K., and Zakian, V. A. (2012) DNA secondary structures: stability and function of G-quadruplex structures, Nat. Rev. Genet. 13, 770-780. [2] Bhattacharyya, D., Mirihana Arachchilage, G., and Basu, S. (2016) Metal Cations in G-Quadruplex Folding and Stability, Front. Chem. 4, 38. [3] Maizels, N., and Gray, L. T. (2013) The G4 Genome, PLoS Genet. 9, e1003468. [4] Alberti, P., and Mergny, J.-L. (2003) DNA duplex–quadruplex exchange as the basis for a nanomolecular machine, Proc. Natl. Acad. Sci. U. S. A. 100, 1569-1573. [5] Neidle, S. (2009) The structures of quadruplex nucleic acids and their drug complexes, Curr. Opin. Struct. Biol. 19, 239-250. [6] Dai, J., Carver, M., Punchihewa, C., Jones, R. A., and Yang, D. (2007) Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence, Nucleic Acids Res. 35, 4927-4940.

9


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 11

[7] Parkinson, G. N., Lee, M. P. H., and Neidle, S. (2002) Crystal structure of parallel quadruplexes from human telomeric DNA, Nature 417, 876-880. [8] Wang, Y., and Patel, D. J. (1993) Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex, Structure 1, 263-282. [9] Hou, X. M., Fu, Y. B., Wu, W. Q., Wang, L., Teng, F. Y., Xie, P., Wang, P. Y., and Xi, X. G. (2017) Involvement of G-triplex and G-hairpin in the multipathway folding of human telomeric G-quadruplex, Nucleic Acids Res. 45, 11401-11412. [10] Tippana, R., Xiao, W., and Myong, S. (2014) G-quadruplex conformation and dynamics are determined by loop length and sequence, Nucleic Acids Res. 42, 8106-8114. [11] You, H., Zeng, X., Xu, Y., Lim, C. J., Efremov, A. K., Phan, A. T., and Yan, J. (2014) Dynamics and stability of polymorphic human telomeric Gquadruplex under tension, Nucleic Acids Res. 42, 8789-8795. [12] Mashimo, T., Yagi, H., Sannohe, Y., Rajendran, A., and Sugiyama, H. (2010) Folding Pathways of Human Telomeric Type-1 and Type-2 G-Quadruplex Structures, J. Am. Chem. Soc. 132, 14910-14918. [13] Kleist, C., Kogut, M., and Czub, J. (2016) Molecular dynamics simulations reveal the balance of forces governing the formation of a guanine tetrad—a common structural unit of G-quadruplex DNA, Nucleic Acids Res. 44, 3020-3030. [14] Zhang, A. Y., and Balasubramanian, S. (2012) The kinetics and folding pathways of intramolecular G-quadruplex nucleic acids, J. Am. Chem. Soc. 134, 19297-19308. [15] You, J., Li, H., Lu, X.-M., Li, W., Wang, P.-Y., Dou, S.-X., and Xi, X.-G. (2017) Effects of monovalent cations on folding kinetics of G-quadruplexes, Biosci. Rep. 37, BSR20170771. [16] Lane, A. N., Chaires, J. B., Gray, R. D., and Trent, J. O. (2008) Stability and kinetics of G-quadruplex structures, Nucleic Acids Res. 36, 5482-5515. [17] Marchand, A., and Gabelica, V. (2016) Folding and misfolding pathways of G-quadruplex DNA, Nucleic Acids Res. 44, 10999-11012. [18] $ X M., Lah, J., Prislan, I., and Vesnaver, G. (2012) Energetic Basis of Human Telomeric DNA Folding into G-Quadruplex Structures, J. Am. Chem. Soc. 134, 9657-9663. [19] Sponer, J., and Spackova, N. (2007) Molecular dynamics simulations and their application to four-stranded DNA, Methods 43, 278-290. [20] Luo, D., and Mu, Y. (2016) Computational Insights into the Stability and Folding Pathways of Human Telomeric DNA G-Quadruplexes, The Journal of Physical Chemistry B 120, 4912-4926. [21] Limongelli, V., De Tito, S., Cerofolini, L., Fragai, M., Pagano, B., Trotta, R., Cosconati, S., Marinelli, L., Novellino, E., and Bertini, I. (2013) The GTriplex DNA, Angew. Chem. Int. Ed. 52, 2269-2273. [22] Rajendran, A., Endo, M., Hidaka, K., and Sugiyama, H. (2014) Direct and Single-Molecule Visualization of the Solution-State Structures of G-Hairpin and G-Triplex Intermediates, Angew. Chem. Int. Ed. 53, 4107-4112. [23] Rajendran, A., Endo, M., Hidaka, K., Teulade-Fichou, M. P., Mergny, J. L., and Sugiyama, H. (2015) Small molecule binding to a G-hairpin and a Gtriplex: a new insight into anticancer drug design targeting G-rich regions, Chem. Commun. 51, 9181-9184. [24] Lu, X. M., Li, H., You, J., Li, W., Wang, P. Y., Li, M., Dou, S. X., and Xi, X. G. (2018) Folding Dynamics of Parallel and Antiparallel G-Triplexes under the Influence of Proximal DNA, J. Phys. Chem. B 122, 9499-9506. [25] Gray, R. D., Trent, J. O., and Chaires, J. B. (2014) Folding and Unfolding Pathways of the Human Telomeric G-Quadruplex, J. Mol. Biol. 426, 16291650. [26] Koirala, D., Mashimo, T., Sannohe, Y., Yu, Z., Mao, H., and Sugiyama, H. (2012) Intramolecular folding in three tandem guanine repeats of human telomeric DNA, Chem. Commun. 48, 2006-2008. [27] Li, W., Hou, X.-M., Wang, P.-Y., Xi, X.-G., and Li, M. (2013) Direct Measurement of Sequential Folding Pathway and Energy Landscape of Human Telomeric G-quadruplex Structures, J. Am. Chem. Soc. 135, 6423-6426. [28] Zhou, R., Zhang, J., Bochman, M. L., Zakian, V. A., and Ha, T. (2014) Periodic DNA patrolling underlies diverse functions of Pif1 on R-loops and Grich DNA, eLife 3, e02190. [29] Wu, W.-Q., Hou, X.-M., Li, M., Dou, S.-X., and Xi, X.-G. (2015) BLM unfolds G-quadruplexes in different structural environments through different mechanisms, Nucleic Acids Res. 43, 4614-4626. [30] Bessi, I., Jonker, H. R. A., Richter, C., and Schwalbe, H. (2015) Involvement of Long-Lived Intermediate States in the Complex Folding Pathway of the Human Telomeric G-Quadruplex, Angewandte Chemie-International Edition 54, 8444-8448. [31] Wienken, C. J., Baaske, P., Rothbauer, U., Braun, D., and Duhr, S. (2010) Protein-binding assays in biological liquids using microscale thermophoresis, Nat. Commun. 1, 100. [32] Jerabek-Willemsen, M., André, T., Wanner, R., Roth, H. M., Duhr, S., Baaske, P., and Breitsprecher, D. (2014) MicroScale Thermophoresis: Interaction analysis and beyond, J. Mol. Struct. 1077, 101-113. [33] Liu, H., Guo, S., Lu, M., Zhang, Y., Li, J., Wang, W., Wang, P., Zhang, J., Hu, Z., Li, L., Si, L., Zhang, J., Qi, Q., Jiang, X., Botella, J. R., Wang, H., and Song, C.-P. (2019) Biosynthesis of DHGA12 and its roles in Arabidopsis seedling establishment, Nat. Commun. 10, 1768. [34] Jerabek-Willemsen, M., Wienken, C. J., Braun, D., Baaske, P., and Duhr, S. (2011) Molecular Interaction Studies Using Microscale Thermophoresis, Assay Drug Dev. Technol. 9, 342-353. [35] Li, Y., Liu, C., Feng, X., Xu, Y., and Liu, B.-F. (2014) Ultrafast Microfluidic Mixer for Tracking the Early Folding Kinetics of Human Telomere GQuadruplex, Anal. Chem. 86, 4333-4339. [36] Schramm, V. L. (2011) Enzymatic Transition States, Transition-State Analogs, Dynamics, Thermodynamics, and Lifetimes, Annu. Rev. Biochem. 80, 703-732.

10


Page 11 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry


Studying potassium induced G-quadruplex DNA folding

Recommend Documents