Article pubs.acs.org/crt
Subchronic Exposure of Mice to Cadmium Perturbs Their Hepatic Energy Metabolism and Gut Microbiome Songbin Zhang, Yuanxiang Jin,* Zhaoyang Zeng, Zhenzhen Liu, and Zhengwei Fu* College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou 310032, China
Downloaded via UNIV OF SUSSEX on July 13, 2018 at 04:41:37 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
S Supporting Information *
ABSTRACT: Cadmium (Cd) is an environmental pollutant known to cause liver damage; however, the mechanisms of its hepatotoxicity remain poorly understood. In this study, the effects of subchronic exposure in mice to low doses of Cd on energy metabolism and the gut microbiome were evaluated. The exposure of mice to 10 mg/L Cd supplied in drinking water for 10 weeks increased hepatic triacylglycerol (TG), serum free fatty acid (FFA), and TG levels. The mRNA levels of several key genes involved in both de novo FFA synthesis and transport pathways and in TG synthesis in the liver also increased significantly in the Cd-treated mice, indicating that alterations of these genes may be a possible mechanism to explain subchronic Cd exposure induced hepatic toxicity at a molecular level. As for the gut microbiome, at the phylum level, the amounts of Firmicutes and γ-proteobacteria decreased significantly in the feces after 4 weeks of Cd exposure, and the quantity of Firmicutes decreased significantly in the cecum contents after 10 weeks of Cd exposure. In addition, 16S rRNA gene sequencing further revealed that Cd exposure significantly perturbed the gut microflora structure and richness at family and genus levels. The alteration of gut microbiome composition might result in an increase in serum lipopolysaccharide (LPS) and induce hepatic inflammation, which may indirectly cause perturbations of energy homeostasis after Cd exposure. Taken together, the present study indicated that subchronic Cd exposure caused the dysregulation of energy metabolism and changed the gut microbiome composition in mice. of male rats significantly changed after Cd exposure.13 More importantly, recently, a number of studies have indicated that heavy metals could also lead to gut microbiome imbalances. For example, a striking disturbance in the gut microbiome composition in mice was noted after exposure to 10 ppm arsenic for 4 weeks.14 Liu et al. found that Cd decreased the population of gut bacteria detected by real time qPCR (RTqPCR) as well as the thickness of the inner mucus layer of mouse intestine.15 More importantly, growing evidence has indicated that alterations of intestinal flora provides an important trigger for various changes, such as alterations in fat metabolism, glucose homeostasis, inflammation levels, and others.16−20 Recently, the gut microbiota and its consequent adverse effects have become potential targets of some drugs and environmental chemicals.14,21 However, the potential mechanism of how subchronic Cd exposure impacts energy metabolism and gut bacteria is still unclear. The purpose of this study was to analyze the mRNA levels of several critical genes related to de novo FFA synthesis and transport pathways and to TG synthesis in the liver. We also aimed to study the influence of bacterial changes in feces every week and to study the effects of Cd exposure on the composition of microbiota in
1. INTRODUCTION Cadmium (Cd) is frequently used in many industrial branches such as in batteries, metal plating, pigments, and plastics.1 High concentrations of Cd have been observed in aquatic systems, sediment, and soil in some countries especially in developing countries such as China. For example, Liu et al. observed that the mean concentration of Cd in agricultural soil along the Dong jiang River and in ipomoea leaves in mine tailing spills reached 7.6 mg/kg and 3.3 mg/kg, respectively.2 Zhai et al. reported that the average concentration of Cd varied between 2.72 and 4.83 mg/kg in surface soils in Chenzhou City, China.3 Moreover, Zhang et al. revealed that Cd in the soil even reached 42.3 mg/kg in the vicinity of an abandoned e-waste recycling site in Taizhou in Zhejiang province.4 Today, Cd has become one of the most widespread environmental pollutants,5 and it causes serious risks to humans and wildlife.6 As reported, heavy metals, including Cd, are associated with carcinogenesis, hepatotoxicity, oxidative stress, and immunotoxicity.7−11 Of note, a number of previous studies have demonstrated that Cd can influence energy metabolism. Larregle et al. reported that the administration of 15 ppm of Cd for 8 weeks alters fatty acid synthetase content, total saturated fatty acids in serum and liver lipid metabolism at both the cellular and subcellular levels in rats.12 In addition, a study also revealed that the main lipid compounds (triacylglycerol [TG], cholesterol [TC], and free fatty acids [FFA]) in the sera © 2015 American Chemical Society
Received: June 5, 2015 Published: September 9, 2015 2000
DOI: 10.1021/acs.chemrestox.5b00237 Chem. Res. Toxicol. 2015, 28, 2000−2009
Article
Chemical Research in Toxicology
qPCR was performed in an Eppendorf MasterCyclerep RealPlex2 (Wesseling-Berzdorf, Germany) tube. All oligonucleotide primers that were used are listed in Table S1. The levels of 18sRNA transcripts were determined, which served as a housekeeping gene. The following PCR protocol was adopted: denaturation for 1 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. The relative quantification of gene expression in the treatment groups was performed as previously described.23 2.6. DNA Extraction and RT-qPCR Amplification in the Feces and Cecum Contents. DNA extractions from fecal pellets and cecum contents were performed using an e.Z.N.A. stool DNA kit (OMEGA, USA) according to the manufacturer’s protocol. The RTqPCR was performed to confirm bacterial DNA extractions using 319F/806R bacterial primers for 16S rRNA. PCR was performed according to the protocol described in section 2.5. 2.7. 16S rRNA Gene Sequencing. Because the main compositions of microbiome have been analyzed by RT-qPCR in the feces and cecum contents (n = 8), cecum contents of four mice were randomly selected for 16S rRNA gene sequencing analysis between the control and 10 mg/L Cd-treated group. DNA from the cecum contents was extracted as described above. The DNA was amplified using the universal primers F319 (ACTCCTACGGGAGGCAGCAG) and R806 (GGACTACHVGGGTWTCTAAT) to target the V3 and V4 regions of bacterial 16S rRNA. The amplicon pools were prepared for sequencing with AM Pure XT beads (Beckman Coulter Genomics, Danvers, MA, USA), and the size and quantity of the amplicon library were, respectively, assessed on a Lab Chip GX (PerkinElmer, Waltham, MA, USA) and with a Library Quantification Kit for Illumina (Kapa Biosciences, Woburn, MA, USA) according to previous studies.24,25 2.8. Analysis of 16S rRNA Gene Sequencing Data. Sequence data corresponding to 250PE and 300PE were preprocessed using the MiSeq protocol, QIIME (version 1.6.0), PANDAseq, and FLASH. Concatenated 250 PE (420 to 440 bp long) and assembled 300PE reads were further processed, including denoising by clustering sequences with less than 3% dissimilarity using USEARCH and de novo chimera detection, conducted with UCHIME v5.1. One of the libraries containing 371 samples was sequenced using both the250PE and 300PE MiSeq protocol for further comparison. Taxonomic ranks were assigned to each sequence using Ribosomal Database Project ̈ Bayesian Classifier v.2.2 trained on the Green genes (RDP) Naive database (Oct, 2012 version) with 0.8 confidence values as a cutoff.25,26 2.9. Statistical Analysis of Data. The results of all the measurements are presented as the mean ± SE. The data were evaluated by a one-way ANOVA followed by a Duncan’s Significant Difference test using SPSS 13.0 (Chicago, USA). Differences with pvalues
