Substrate- and Cell Contact-Dependent Inhibitor Affinity of Human

Jun 13, 2013 - 6, 97070 Würzburg, Germany; phone, +49-931-3182700; e-mail, .... a Cobra II Auto-Gamma counter (Packard Instrument Co., Meriden, CT). ...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Substrate- and Cell Contact-Dependent Inhibitor Affinity of Human Organic Cation Transporter 2: Studies with Two Classical Organic Cation Substrates and the Novel Substrate Cd2+ Frank Thévenod,*,† Giuliano Ciarimboli,‡ Marcus Leistner,§ Natascha A. Wolff,† Wing-Kee Lee,† Irina Schatz,§ Thorsten Keller,§ Rouvier Al-Monajjed,‡ Valentin Gorboulev,§ and Hermann Koepsell*,§,∥ †

Institute of Physiology and Pathophysiology, ZBAF, University of Witten/Herdecke, Witten, Germany Experimental Nephrology, Department of Internal Medicine D of the University Hospital Münster, Münster, Germany § Institute of Anatomy and Cell Biology, University of Würzburg, Würzburg, Germany ∥ Department of Molecular Plant Physiology and Biophysics, Julius-von-Sachs-Institute, University of Würzburg, Würzburg, Germany ‡

S Supporting Information *

ABSTRACT: Polyspecific organic cation transporter Oct2 from rat (gene Slc22A2) has been previously shown to transport Cs+. Here we report that human OCT2 (hOCT2) is able to transport Cd2+ showing substrate saturation with a Michaelis−Menten constant (Km) of 54 ± 5.8 μM. Uptake of Cd2+ by hOCT2 was inhibited by typical hOCT2 ligands (unlabeled substrates and inhibitors), and the rate of uptake was decreased by a point mutation in a substrate binding domain of hOCT2. Incubation of hOCT2 overexpressing human embryonic kidney 293 cells (HEK-hOCT2-C) or rat renal proximal tubule cells expressing rOct2 (NRK-52E-C) with Cd2+ resulted in an increased level of apoptosis that was reduced by OCT2 inhibitory ligand cimetidine+. HEK-hOCT2-C exhibited different functional properties when they were confluent or had been dissociated by removal of Ca2+ and Mg2+. Only confluent HEK-hOCT2-C transported Cd2+, and confluent and dissociated cells exhibited different potencies for inhibition of uptake of 1-methyl-4-phenylpyridinium+ (MPP+) by Cd2+, MPP+, tetraethylammonium+, cimetidine+, and corticosterone. In confluent HEK-hOCT2-C, largely different inhibitor potencies were obtained upon comparison of inhibition of Cd2+ uptake, 4-[4-(dimethylamino)styryl]-N-methylpyridinium+ (ASP+) uptake, and MPP+ uptake using substrate concentrations far below the respective Km values. Employing a point mutation in the previously identified substrate binding site of rat Oct1 produced evidence that short distance allosteric effects between binding sites for substrates and inhibitors are involved in substrate-dependent inhibitor potency. Substrate-dependent inhibitor affinity is probably a common property of OCTs. To predict interactions between drugs that are transported by OCTs and inhibitory drugs, it is necessary to employ the specific transported drug rather than a model substrate for in vitro measurements. KEYWORDS: kidney proximal tubule, organic cation transporters, cadmium, toxicity, inhibitor sensitivity

■

INTRODUCTION Renal proximal tubules are major targets for Cd2+ nephrotoxicity. They take up free Cd2+ or Cd2+ bound to thiol-containing biomolecules across the luminal and basolateral plasma membranes.1−3 The activity and capacity of transporters located in the luminal and basolateral membrane that mediate uptake and efflux of free Cd2+ may influence nephrotoxicity. They are potential targets for pharmacological intervention. Previous studies showed that expression of divalent metal transporters ZIP8 and ZIP14 that translocate Cd2+ across the brush-border membrane of renal tubular cells is correlated with Cd2+-induced nephrotoxicity.4 In renal proximal tubules, polyspecific organic cation transporters are expressed and may also be involved in the transport of Cd2+. For example, organic cation transporter © 2013 American Chemical Society

OCT2, which is located in the basolateral membrane of renal proximal tubules, transports various organic cations from the interstitial space into proximal tubular cells.5,6 Because cellular cation transport via OCT2 is energized by the outside positive membrane potential in addition to the inward-directed concentration gradient of the substrate and Oct2 from rat is able to transport Cs+,7 human OCT2 (hOCT2) could be an effective basolateral uptake system for Cd2+. Employing human embryonic kidney (HEK293) cells in which human organic cation transporter OCT1, OCT2, or OCT3 were stably Received: Revised: Accepted: Published: 3045

February 27, 2013 May 20, 2013 June 13, 2013 June 13, 2013 dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

hOCT2-GFP-C), or hOCT2(D475R)-GFP [HEK-hOCT2(D475R)-GFP-C]. Cells were grown at 37 °C in Dulbecco’s modified Eagle’s medium gassed with 5% CO2 containing 3.7 g/L NaHCO3, 1.0 g/L D-glucose, 2 mM L-glutamine, 10% heatinactivated fetal calf serum, 100000 units/L penicillin, 100 mg/ L streptomycin, and geniticin (G418). Geniticin at 0.6 and 0.4 mg/mL was used for selection of positive clones and during cultivation of the cell lines, respectively. Culture medium was exchanged three times per week, and cells were passaged upon reaching confluence. For uptake measurements in confluent cell layers, cells were seeded in 24- or 6-well plates (Cd2+ and MPP+ uptake) or on coverslips (ASP+ uptake) and cultured until they reached confluence. For [3H]MPP+ uptake measurements in dissociated cells, cells were grown to confluence in Petri dishes, washed with Ca2+- and Mg2+-free PBS, removed from the plates, and centrifuged for 10 min (room temperature) at 1000g. The dissociated cells in the pellet were washed twice by low-spin centrifugation in PBS containing 0.5 mM MgCl2 and 1 mM CaCl2 (transport PBS) and suspended in transport PBS. 109 Cd2+ Uptake Measurements in Confluent Cell Layers. The measurements were performed in 24- or 6-well plates. Measurements in 24-well plates were performed as described employing minor modifications.15,16 Cell layers were washed with Hanks’ balanced salt solution (HBSS) and incubated at 37 °C in a shaking water bath with HBSS containing 109CdCl2. 109CdCl2 was added to an activity of 0.019−0.037 MBq/mL, and the total concentration of Cd2+ was adjusted with nonradioactive CdCl2. After different time intervals, the radioactive solution was removed and the cell layers were washed three times with 1 mL of ice-cold HBSS containing 2 mM EGTA. IC50 values for inhibition of Cd2+ uptake were determined by measuring uptake of 10 μM Cd2+ for 10 min in the presence of inhibitors. To determine hOCT2 specific transport, the rate of Cd2+ uptake in HEK-C was subtracted from the rate of Cd2+ uptake in HEK-hOCT2-C. Cd2+ uptake in 6-well plates was assessed in the presence of transport PBS. Cells were grown to confluence, washed three times with transport PBS, and incubated for 10 or 30 min at 37 °C with transport PBS containing 10 or 100 μM CdCl2 with 109 CdCl2 as described above. The cells were washed three times with ice-cold PBS containing 100 μM quinine. Cells were solubilized with 1 M NaOH or 4 M guanidine thiocyanate, and 109 CdCl2 contents in solubilized cell layers were determined using a Cobra II Auto-Gamma counter (Packard Instrument Co., Meriden, CT). [3H]MPP+ Uptake Measurements in Confluent Cell Layers. These measurements were performed in 6-well plates using transport PBS. Cells were grown to confluence, washed three times with transport PBS, and incubated for 2 min at 37 °C with transport PBS containing 0.1 μM MPP+ with a tracer amount of [3H]MPP+. Cells were washed three times with icecold PBS containing 100 μM quinine and solubilized. ASP+ Uptake Measurements in Confluent Cell Layers by Fluorescence. Measurements were performed in the dark as described previously.11,17 Fluorescence was measured with an inverted microscope (Axiovert 135, Zeiss, Oberkochen, Germany) that was equipped with a 100× oil immersion objective. Excitation light (450−490 nm) was reflected by a dichroic mirror (560 nm) to a perfusion chamber. Confluent cell monolayers on coverslips were superfused (10 mL/min) with a HCO3−-free Ringer-like solution (37 °C, pH 7.4) containing 145 mM NaCl, 1.6 mM K2HPO4, 0.4 mM KH2PO4, 5 mM D-glucose, 1 mM MgCl2, and 1.3 mM calcium gluconate

expressed, we investigated whether the human OCTs mediate Cd2+ uptake. Performing uptake measurements in confluent monolayers, we observed higher rates of uptake of Cd2+ in cells expressing hOCT2 than in vector-transfected cells or cells expressing hOCT1 or hOCT3. Cd2+ uptake in hOCT2expressing monolayers was inhibited by several typical OCT inhibitory ligands; however, the affinities of these inhibitors were different from that of the inhibition of hOCT2-mediated uptake of the classical OCT substrate 1-methyl-4-phenylpyridinium+ (MPP+) in monolayers. For example, the antihistaminic cimetidine+ blocks uptake of Cd2+ by hOCT2 with an affinity 1000-fold higher than that of hOCT2-mediated MPP+ uptake. Measuring the affinities of several inhibitors to block hOCT2-mediated uptake of another established hOCT2 substrate, 4-[4-(dimethylamino)styryl]-N-methylpyridinium+ (ASP+), in confluent monolayers, we obtained a third inhibitor potency profile. A point mutation within the substrate binding site of hOCT2 decreased the rate of turnover for Cd2+, and blockage of Cd2+ uptake in confluent cells expressing hOCT2 by cimetidine+ inhibited apoptosis. Performing uptake measurements in suspended cells that were obtained by dissociation of confluent monolayers, we observed that the expressed transport properties were altered upon dissociation. Whereas the expressed transport activity of hOCT2 for MPP+ remained unaltered, the ability of hOCT2 to transport Cd2+ was lost. In addition, the affinities of several OCT ligands for the inhibition of hOCT2-mediated MPP+ uptake were altered. The data indicate that inhibitor affinities of organic cation transporters are dependent on the employed substrate and may be rapidly altered when confluent cells are dissociated. Some of the data have been reported as an abstract.8

■

EXPERIMENTAL SECTION Materials. [ 3H]MPP + (3.1 TBq/mmol) and [ 14 C]tetraethylammonium+ (TEA+, 1.9 GBq/mmol) were purchased from American Radiolabeled Chemicals (St. Louis, MO), and 109 CdCl2 (1.85−37 MBq/μg) was from Amersham GE Healthcare Europe GmbH (Freiburg, Germany). Fluorescein isothiocyanate (FITC)-labeled annexin V was provided by Becton Dickson Pharmingen (Mountain View, CA). All other chemicals were obtained as described previously.9−11 Cloning. hOCT3 (AJ001417, kindly provided by V. Ganapathy, Augusta, GA) was recloned into the pcDNA3.1(+) plasmid (Invitrogen, Groningen, The Netherlands). For the preparation of hOCT2-GFP, a DNA fragment covering the complete coding region of GFP was prepared by polymerase chain reaction (PCR) and fused in an open reading frame to the C-terminus of hOCT2 applying the overlap extension method.12 The amplification products were digested with NheI (internal site in hOCT2) and NotI (site at the 3′ end of the PCR products) and cloned into the hOCT2/pRcCMV plasmid. 13 The D475R mutation was introduced into hOCT2-EGFP/pRcCMV by the overlap extension method as described previously.14 For expression in oocytes, rOct1 and the rOct1(D475E) mutant were cloned into vector pRSSP as described previously.13 Generation and Cultivation of Stably Transfected HEK293 Cell Lines. HEK293 cells [human embryonic kidney cortex cells, CRL-1573 (American Type Culture Collection, Rockville, MD)] were stably transfected with the pcDNA3.1(+) plasmid [control cell line (HEK-C)] or the pCNA3.1(+) plasmid containing hOCT1 (HEK-hOCT1-C), hOCT2 (HEKhOCT2-C), hOCT3 (HEK-hOCT3-C), hOCT2-GFP (HEK3046

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

without or with ASP+. For uptake measurements, superfusion was switched to solutions containing 1 μM ASP+ or 1 μM ASP+ with different concentrations of Cd2+, MPP+, TEA+, cimetidine+, Cu2+, or corticosterone. Fluorescence emission (575− 640 nm) was measured with a photon counting tube (H 346004, Hamamatsu, Herrsching, Germany). The initial linear slopes of fluorescence increase during the first 10−30 s after switching to the ASP+-containing solutions were evaluated. This initial fluorescence increase represents ASP+ uptake across the plasma membrane and does not appear to be significantly influenced by intracellular compartmentalization and bleaching of the dye.17,18 [3H]MPP+ Uptake Measurements in Dissociated Cells. Uptake was measured as described previously;19 90 μL of the cell suspension in transport PBS containing ∼107 cells was placed at the bottoms of four 2 mL tubes and shaken in a water bath at 37 °C. The transport measurements were performed tube by tube. Ten microliters of transport PBS containing 1 μM MPP+ with a tracer amount of [3H]MPP+ without and with various inhibitors was placed on the inner wall of each tube. Uptake measurement was started by approaching the tube to a turned-on vortexer and stopped after 1 s by adding 1 mL of icecold transport buffer containing 100 μM quinine (stop buffer) from a prepositioned pipet. Exact timing was achieved using a metronome. The standard deviation between four parallel determinations was less than 10%. After two centrifugation/ washing steps with stop buffer, the cells were lysed and solubilized with 4 M guanidine thiocyanate. The amount of [3H]MPP+ was determined by liquid scintillation counting. Reverse Transcription Polymerase Chain Reaction (RT-PCR). HEK-C or HEK-hOCT2-C were seeded at a density of ∼5 × 104 cells/cm2. After 3 days, total RNA was extracted using the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) with on-column DNase digestion according to the manufacturer’s instructions. First-strand cDNA was synthesized with the Omniscript reverse transcriptase (RT) kit (Qiagen), using 2.0 μg of RNA per 20 μL reaction mixture and oligo(dT) primer (Operon Biotechnologies, Huntsville, AL). PCR for various metal transporters or actin was then conducted with the HotStarTaq Master Mix kit (Qiagen), using 1.0 μL of cDNA per 20 μL PCR mixture. The primers, GenBank accession numbers, cycling conditions, and product sizes are given in Table 1 of the Supporting Information. Expression of rOct2 mRNA in NRK-52E-C was detected by RT-PCR using the following primers: forward, 5′ GCCTCCTGATCCTGGCTG 3′; reverse, 5′ GGTGTCAGGTTCTGAAGAGAG 3′. The annealing temperature for PCR was 60 °C. Immunocytochemistry. For immunolocalization of wildtype hOCT2 and the hOCT2(D475R) mutant, HEK-hOCT2GFP- and HEK-hOCT2(D475R)-GFP-expressing cells were grown to confluence on glass coverslips. Antibody staining was performed as described previously.20 After incubation for 60 min with 1% bovine serum albumin (blocking buffer), cells were incubated overnight at 4 °C with a mouse monoclonal antibody against hOCT2 (anti-hOCT2-Ab) diluted 1:100 in blocking buffer.21 Subsequently, the cells were incubated for 2 h at room temperature with Cy3-conjugated donkey anti-mouse antibody (Jackson ImmunoResearch Europe Ltd., Newmarket, Suffolk, U.K.; 1:600 in blocking buffer). Cells were counterstained for 5 min at room temperature with 0.8 μg/mL 2′-(4ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-2,5′-bi-1H-benzimidazole, 3HCl (HOE-33342). Cells were viewed using filters as described previously.20

Expression of rOct1 and rOct1(D475E) in Oocyctes. Purified pRSSP plasmids were linearized; RNAs were prepared, and the cRNA concentrations were estimated as reported previously.13 Stage V−VI Xenopus laevis oocytes were obtained by partial ovariectomy, defolliculated by collagenase, and stored in Ori buffer [5 mM MOPS (pH 7.4), 100 mM NaCl, 3 mM KCl, 2 mM CaCl2, and 1 mM MgCl2] supplemented with 50 mg/L gentamicin as described previously.22 The oocytes were injected with 50 nL of H2O/oocyte containing 11 ng of cRNA encoding rOct1 or rOct1(D475E) and incubated for 2−3 days at 16 °C.22 Tracer Uptake Measurements in Oocytes. Measurements were performed as described previously.22 Oocytes expressing rOct1 or rOct1(D475E) and non-injected control oocytes were incubated for 30 min at room temperature with Ori buffer containing 10 μM [14C]TEA+ or 6.3 nM [3H]MPP+ and different concentrations of nonradioactive TEA+, MPP+, or TBuA+ and washed, and the rate of uptake of radioactivity was measured. Uptake rates were corrected for nonspecific uptake measured in non-injected oocytes of the same batch. Surface Biotinylation and Immunoblotting. Biotinylation of cell surface proteins was conducted using the Pierce Cell Surface Protein Isolation Kit (Thermo Scientific, Rockford, IL) following the manufacturer’s instructions with modifications as described previously.23 Briefly, HEK-hOCT2-GFP-C and HEKhOCT2(D475R)-GFP-C were grown to confluence and harvested. They were incubated in freshly dissolved biotin/ PBS (4 mg/mL). Excess biotin was quenched, and cells were lysed by gentle sonification in lysis buffer (Thermo Scientific) containing 10% protease inhibitor cocktail (Sigma). Subsequently, cells were incubated for 30 min on ice. Nonlysed cells were removed by centrifugation at 10000g for 2 min, and the supernatants were transferred to columns containing immobilized NeutrAvidin beads. After incubation for 1 h, biotinylated proteins were eluted by treatment with 1× Laemmli buffer in the presence of 50 mM dithiothreitol and the protein concentration was determined.24 Equal amounts of proteins were separated by sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS−PAGE). hOCT2/ hOCT2(D475R) and the α1 subunit of the Na+,K+-ATPase were immunodetected in Western blots and quantified by densitometry. Immunodetection was performed with antihOCT2-Ab (dilution 1:2000) or rabbit polyclonal antibody against the α1 subunit of Na+,K+-ATPase (Cell Signaling Technology, New England Biolabs GmbH, Frankfurt am Main, Germany, catalog no. 3010S) (1:1000 dilution). Horseradish peroxidase-conjugated antibodies were used as secondary antibodies, and signals were detected as described previously.23 Modified Tetrazolium Test (MTT) for Analysis of Cell Viability. NRK-52E-C, a rat renal proximal tubular cell line, was obtained from American Type Culture Collection and cultured according to the supplier’s instructions. HEK-C, HEKhOCT2-C, and NRK-52E-C were seeded at a density of 2−5 × 104 cells/well in 24- or 48-well plates in serum-containing medium. On day 3 postseeding, Cd2+ treatment was started, using different protocols depending on the length of the incubation period. To assay for short-term Cd2+-induced cytotoxicity, cells were treated for 2.5 h with serum-free medium (HEK-C and HEK-hOCT2-C) or 1% serum (NRK52E-C) without or with 25 or 100 μM Cd2+ in the absence or presence of 10 μM cimetidine+. After incubation, the medium was aspirated, the cells were washed once with serum-free medium, and cell viability was assayed using the MTT adapted 3047

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

Table 1. Affinities of Ligands for Inhibition of Organic Cation Transport in HEK293 Cells Overexpressing hOCT2 Are Dependent on the Transported Cation and Are Different in Confluent versus Dissociated Cellsa IC50 value or apparent Km value (μM) confluent cells competing substrate or inhibitor 2+

Cd MPP+ TEA+ cimetidine+ choline+ corticosterone quinine+ Cu2+ Zn2+

Cd2+ uptake 54.0 0.28 9.93 0.067 558 0.10 0.39 0.51 8.33

± 5.8 ± 0.05 ± 0.52 ± 0.003 ± 72 ± 0.03 ± 0.10 ± 0.13 ± 3.22

ASP+ uptake

dissociated cells MPP+ uptake

MPP+ uptake

a

410 ± 107 74.5 ± 2.27+++ >500 559 ± 156**,++

0.63 ± 0.12a

0.065 ± 0.010bb

12597 ± 457***,+++,### 3.13 ± 0.59+++,### 158 ± 6.1***,+++ 70.0 ± 9.0##,b 1283 ± 236aa 7.83 ± 0.78***,+++,### 11.7 ± 0.95aaa 2441 ± 194***,+++ 6916 ± 450aaa

257 1.55 28.0 27.7

± ± ± ±

103 0.43*** 4.73a 4.41aa

84.7 ± 14.4aa

a

a For affinities for inhibition of Cd2+ uptake in confluent cells, HEK-hOCT2-C and HEK-C were incubated for 10 min at 37 °C with 10 μM Cd2+ in the absence and presence of the indicated inhibitory ligands, and the rate of uptake of Cd2+ was measured as described in the legend of Figure 3. Three independent experiments with duplicate measurements were performed. For affinities for inhibition of ASP+ uptake in confluent cells, the rate of uptake of ASP+ in HEK-hOCT2-C was measured after incubation at 37 °C with 1 μM ASP+ in the absence and presence of the indicated inhibitory ligands as described in the legend of Figure 5. Three to five independent experiments were performed. For affinities for inhibition of MPP+ uptake in confluent cells, the rate of uptake of MPP+ in HEK-hOCT2-C was measured after incubation for 2 min at 37 °C with 0.1 μM MPP+ in the absence and presence of the indicated inhibitory ligands as described in the legend of Figure 4. Three or four independent experiments with quadruplicate measurements were performed. For affinities for inhibition of MPP+ uptake in dissociated cells, the rate of uptake of MPP+ in HEKhOCT2-C was measured after incubation for 1 s at 37 °C with 0.1 μM MPP+ in the absence and presence of the indicated inhibitory ligands as described in the legend of Figure 6. Three to six independent experiments were performed. The Hill equation or Michaelis−Menten equation was fit to individual experiments, and IC50 values or Km values (bold) of individual experiments were determined. Means ± SE of IC50 and Km values determined from individual experiments are given. Comparison with values in the first column: **P < 0.01, ***P < 0.001 (ANOVA with post hoc Tukey comparison between values in one line), aP < 0.05, aaP < 0.01, aaaP < 0.001 (Student’s t test). Comparison to values in the second column: ++P < 0.01, +++P < 0.001 (ANOVA with post hoc Tukey comparison between values in one line), bP < 0.05, bbP < 0.01 (Student’s t test). Comparison between values in the third and fourth columns: ##P < 0.01, ###P < 0.001 (ANOVA with post hoc Tukey comparison between all values in one line).

from the method previously described.16 In brief, the cells were incubated for 3 h at 37 °C in serum-free medium (HEK-C and HEK-hOCT2-C) or serum-containing medium (NRK-52E-C) with 1 mg/mL MTT. Then, 1−2 mL of 2-propanol was added to each well; the solution was mixed thoroughly to dissolve the resulting formazan product, largely indicative of the activity of mitochondrial dehydrogenases, and absorbance was measured at 560 and 690 nm. Long-term Cd2+ treatment was conducted in serum-containing medium, because the cells did not tolerate serum-free medium for extended time periods. Two days after cells had been seeded, the medium was replaced with fresh serum-containing medium without or with Cd2+ (5−100 μM) and the cells were incubated for a further 16 h. Thereafter, the medium was removed and viability tested by MTT as described above. Quantification of Apoptosis by Flow Cytometry. Apoptosis was determined by detecting annexin V binding using flow cytometry as described previously.25 The viability of cells was determined by measuring the rate of uptake of propidium iodide (PI). Positively charged PI is membrane impermeant and excluded from viable cells but accumulates in the nucleus when the integrity of the plasma membrane is compromised. After incubation for 2.5 h in serum-free medium with or without 100 μM Cd2+ or with 100 μM Cd2+ and 10 μM cimetidine+, HEK-hOCT2 and HEK cells were washed and then labeled with annexin V-FITC and PI (5 μg/mL) in staining buffer [containing 1% BSA in 50 mM HEPES buffer (pH 7.4)] for 15 min on ice. FITC-conjugated murine IgG monoclonal antibodies of unrelated specificities were used as controls. After being stained, cells were washed in PBS and analyzed on a FACScan flow cytometer (Becton Dickinson). Calculations and Statistics. In HEK293 cells, uptake rates under different experimental conditions were determined from

at least three different experiments. In each experiment, two (uptake measured in plates) or four (uptake measured in dissociated cells) individual measurements were performed for every experimental condition in the graphs. Apparent Km values were determined by fitting the Michaelis−Menten equation to the data. For the inhibition of tracer cation uptake by nonlabeled cations, IC50 values were calculated by fitting the Hill equation to the data. Because in the inhibition studies the substrate concentrations (Cd2+, ASP+, and MPP+) used for uptake measurements were at least 5 times smaller than the respective Km values,26 the determined IC50 values are basically identical to Ki values. In the graphs, the data of all performed experiments are combined and the curves were fit to the combined data sets. Mean values ± the standard error (SE) are listed. The mean IC50 and Km values listed in Table 1 represent mean values ± SE obtained from at least three individual experiments that had been fit separately. For measurements in oocytes, at least three different batches of oocytes were used. Per experimental condition and oocyte batch, 7−10 oocytes were analyzed. Mean values ± SE are listed. GraphPad Prism version 4.1 (GraphPad Software, San Diego, CA) was used to compute statistical parameters. An analysis of variance test with post hoc Tukey comparison was used to compare more than two different groups. A two-sided Student’s t test was used to prove the statistical significance of differences between two groups.

■

RESULTS Demonstration of Saturable, OCT Inhibitor Sensitive Cd2+ Uptake in Confluent HEK Cells Expressing hOCT2. To determine whether Cd2+ is transported by human organic cation transporters, we compared uptake of Cd2+ in confluent HEK293 cells that were stably transfected with vector (HEK3048

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

C), hOCT1 (HEK-hOCT1-C), hOCT2 (HEK-hOCT2-C), or hOCT3 (HEK-hOCT3-C) in the absence and presence of the OCT substrates choline+ and cimetidine+. Cells were incubated for 10 min with 10 or 100 μM Cd2+ containing 109Cd2+. The measurements were performed in 24-well plates using HBSS (Figure 1A) or in 6-well plates using PBS containing 0.5 mM

Figure 2. Time course and substrate dependence of uptake of Cd2+ by HEK293 cells stably transfected with hOCT2. (A) Rate of uptake of 10 and 100 μM Cd2+ (in HBBS) by confluent HEK-hOCT2-C measured after different incubation times. (B) Rate of uptake of different concentrations of Cd2+ (in HBBS) by confluent HEK-C or HEK-hOCT2-C. Means ± SE of duplicate measurements from three to five different experiments are shown. Figure 1. Uptake of Cd2+ by confluent HEK293 cells that were stably transfected with vector (HEK-C), hOCT1 (HEK-hOCT1-C), hOCT2 (HEK-hOCT2-C), or hOCT3 (HEK-hOCT3-C). Confluent cells were incubated for 10 min at 37 °C in HBBS with 10 or 100 μM Cd2+ containing 109Cd2+. The incubation was performed in the absence or presence of the indicated organic cations. (A) Cells were grown in 24well plates, and the rate of uptake of 100 μM Cd2+ was measured in the presence of HBSS. (B) Cells were grown in 6-well plates, and the rate of uptake of 10 μM Cd2+ was measured in the presence of transport PBS. Means ± SE of duplicate measurements from three to five different experiments are shown. **P < 0.01; ***P < 0.001.

upregulated upon expression of hOCT2, we performed RTPCR to determine whether HEK-C express transporters that may translocate Cd2+ and whether they are upregulated in HEK-hOCT2-C. We tested metal transporters DMT1, CTR1, CTR2, TRPM7, ZIP8, and ZIP14.27 Similar mRNA levels of these transporters were observed in HEK-C and HEK-hOCT2C (Figure 1 and Table 1 of the Supporting Information). Because posttranscriptional upregulation of these transporters could not be excluded in HEK293 cells overexpressing hOCT2, we tried to prove Cd2+ uptake via hOCT2 by investigating the effect of a point mutation in hOCT2 on expression of Cd2+ uptake. To facilitate a comparison of plasma membrane location between cell lines, GFP fusion proteins were employed for these experiments. HEK293 cells that were stably transfected with hOCT2-GFP fusion protein (HEKhOCT2-GFP-C) exhibited rates of uptake of MPP+ and Cd2+ similar to those of HEK-hOCT2-C (data not shown). This is in accordance with experiments showing that fusion of rat Oct1 (rOct1) with GFP did not change membrane targeting and transport properties (V. Gorboulev and H. Koepsell, unpublished data). Cd2+ uptake in confluent HEK-hOCT2-GFP-C confirmed the correlation between hOCT2 expression and the increase in the rate of uptake of Cd2+ in HEK293 cells. We exchanged Asp475 in hOCT2-GFP with arginine. Asp475 is located in a functionally important substrate binding hinge domain that is conserved between OCT1−3 of different species.22 Hence, replacement of Asp475 with arginine in rOct1 resulted in a drastically reduced rate of uptake of TEA+ without decreasing the extent of plasma membrane targeting, whereas the replacement with glutamate resulted in a change in the affinity of one substrate and several inhibitors.14

MgCl2 and 1 mM CaCl2 (transport PBS) (Figure 1B). The rate of uptake of 100 μM Cd2+ measured in confluent HEKhOCT2-C was ∼3-fold higher than in HEK-C, HEK-hOCT1C, and HEK-hOCT3-C (Figure 1A). The increased rate of uptake in HEK-hOCT2-C compared to those of the other cell lines was blocked by the hOCT2 substrates choline+ (10 mM) and cimetidine+ (10 μM).6 In contrast, Cd2+ uptake measured in HEK-C, HEK-hOCT1-C, or HEK-hOCT3-C was not inhibited by these compounds. Cd2+ uptake in confluent HEK-hOCT2-C that was inhibited by OCT substrates and inhibitors was also observed when the transport was measured in presence of transport PBS (Figure 1B). Uptake of 10 or 100 μM Cd2+ was linear for 60 min (Figure 2A). Via measurement of the substrate dependence of hOCT2-expressed uptake of Cd2+ in confluent HEK-hOCT2-C, a Km value of 54 ± 5.8 μM and a Vmax value of 60.3 ± 4.0 nmol (mg of protein)−1 min−1 were determined (Figure 2B). A Point Mutation in hOCT2 Leads to a Decrease in the Cd2+ Transport Rate. Considering the possibility that a choline + and cimetidine + sensitive Cd2+ transporter is endogenously expressed at a low level in HEK293 cells and 3049

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

dissociated cells amounted to ∼20% of the level of uptake in HEK-hOCT2-GFP cells or HEK-hOCT2 cells (data not shown). The Km for MPP+ measured was increased by the Asp475Arg mutation [3.1 ± 1.0 μM for HEK-hOCT2-GFP-C (n = 3) and 8.3 ± 2.1 μM for HEK-hOCT2(D475R)-GFP-C (n = 4) (P < 0.05 for difference)]. We compared uptake rates of 10 or 100 μM Cd2+ in confluent HEK-hOCT2-GFP-C, HEKhOCT2(D475R)-GFP-C, and HEK-C by measuring uptake after incubation for 10, 30, or 60 min and calculating rates of uptake by linear regression analysis. Subtracting the uptake rate measured in HEK-C (1.8 ± 0.2 pmol well−1 min−1 for 10 μM Cd2+ and 15.5 ± 2.0 pmol well−1 min−1 for 100 μM Cd2+), we obtained the expressed uptake rates (Figure 3D). The data indicate that the uptake rates expressed by hOCT2(D475R)GFP-C amounted to 30 ± 9% (10 μM Cd2+) or 37 ± 15% (100 μM Cd2+) of the uptake rate expressed by hOCT2-GFP-C. Because the extent of plasma membrane targeting was not reduced, the data confirm that hOCT2 is a transporter for Cd2+. OCT Ligands Inhibit Uptake of Different Substrates in Confluent HEK-hOCT2 Cells with Different Affinities. We measured the IC50 values of previously described hOCT2 ligands26 for inhibition of uptake of 10 μM Cd2+, 0.1 μM MPP+ and 1 μM ASP+ into confluent HEK-OCT2-C (Figures 4−6 and Table 1). The uptake measurements were performed within the initial linear uptake phases of the three substrates (10 min for Cd2+ uptake, 2 min for MPP+ uptake, and 30 s for ASP+ uptake). Whereas uptake of 10 μM Cd2+ could be inhibited only ∼60% by MPP+ or corticosterone, nearly complete inhibition was achieved by tetraethylammonium (TEA+), choline+, Cu2+, Zn2+, quinine+, and cimetidine+ (Figure 4 and Table 1). The rank order of Km or IC50 values for Cd2+ uptake or inhibition of Cd2+ uptake was as follows: choline+ > Cd2+ > TEA+ ≈ Zn2+ > Cu2+ ≈ quinine ≈ MPP+ > corticosterone ≈ cimetidine+ (Figures 2 and 4 and Table 1). For replacement of [3H]MPP+ by nonradioactive MPP+ (Km) and for the inhibition of MPP+ (0.1 μM) uptake by Cd2+, TEA+, cimetidine+, or corticosterone in confluent cells, lower affinities were observed than for replacement of 109Cd2+ with nonradioactive Cd2+ (Km) or for the inhibition of Cd2+ (10 μM) uptake (Figure 5 and Table 1). The apparent Km value for MPP+ was ∼270 times higher than the IC50 value for the inhibition of uptake of Cd2+ by MPP+; the IC50 value for the inhibition of uptake of MPP+ by TEA+ was more than 50 times higher than the IC50 value for the inhibition of Cd2+ uptake, and the IC50 value for the inhibition of uptake of MPP+ by cimetidine+ was 8000 times higher. The IC50 value for the inhibition of uptake of MPP+ by Cd2+ was ∼7.6 times higher than the Km value for Cd2+. The rank order of Km or IC50 values was as follows: TEA+ > cimetidine+ ≈ Cd2+ > MPP+ ≫ corticosterone. We also determined IC50 values of several compounds for the inhibition of ASP+ uptake in confluent HEK-hOCT2-C using a fluorescent assay (Figure 6 and Table 1). Cd2+ had a similar IC50 value for the inhibition of MPP+ and ASP+ uptake. Corticosterone had a higher IC50 value for the inhibition of MPP+ uptake than that of ASP+ uptake. The Km value for MPP+ was higher than the IC50 value for the inhibition of uptake of Cd2+ by MPP+. TEA+ and cimetidine+ had higher IC50 values for the inhibition of MPP+ uptake than for that of ASP+ uptake. The rank order of the IC50 or Km values was as follows: Cd2+ > Cu2+ > TEA+ ≈ cimetidine+ > MPP+ > corticosterone. Mutation of an Amino Acid in the Substrate Binding Hinge Domain of rOct1 Alters the Substrate-Dependent

HEK293 cells were stably transfected with hOCT2(D475R)GFP [HEK-hOCT2(D475R)-GFP-C]. Visual inspection of GFP fluorescence and of staining with a hOCT2 specific monoclonal antibody showed similar plasma membrane locations of hOCT2-GFP and hOCT2(D475R)-GFP in the two cell lines (Figure 4A,B). For quantification, we affinitypurified the surface-biotinylated plasma membrane, visualized the transporters by immunodetection, and quantified the amounts by densitometry (Figure 3C). The data indicate that

Figure 3. Expression, plasma membrane location, and activity of mutant hOCT2(D475R)-GFP in comparison to those of hOCT2GFP. (A) Comparison of GFP immunofluorescence of confluent HEK-hOCT2-GFP-C and confluent HEK-hOCT2(D475R)-C. (B) Comparison of immunofluorescence staining of HEK-hOCT2-GFP-C and confluent HEK-hOCT2(D475R)-C with the anti-hOCT2 antibody. Bars in panels A and B are 20 μm. (C) Quantification of hOCT2-GFP and hOCT2(D475E)-GFP in the plasma membranes of the stably transfected HEK293 cell lines. Confluent cells were surface biotinylated, and the plasma membranes were affinity-purified, separated by SDS−PAGE, immunoblotted, and stained with the anti-hOCT2 antibody or the antibody against the α-subunit of the Na+,K+-ATPase. Staining was quantified by densitometry. Staining of hOCT2-GFP or hOCT2(D475R)-GFP in the plasma membrane of the respective preparation was normalized against staining of the Na+,K+-ATPase. Means ± SE of four separate experiments are shown. n.s., not significant. (D) Comparison of expressed Cd2+ uptake in confluent HEK-hOCT2-GFP-C and HEK-hOCT2(D475R)-GFP-C. Uptake was assessed after incubation of confluent HEK-C, HEKhOCT2-GFP-C, and HEK-hOCT2(D475R)-C for 10 min with 10 or 100 μM Cd2+. With each cell line, three separate experiments with three parallel uptake measurements were performed. Uptake measured in HEK-hOCT2-GFP-C and HEK-hOCT2(D475R)-C was corrected for uptake in HEK-C. Means ± SE. ***P < 0.001.

the Asp475Arg exchange did not decrease the extent of targeting of the transporter to the plasma membrane. To verify that the Asp475Arg mutation in hOCT2-GFP modifies transport function as in rOct1, we measured the rate of uptake of the prototypic OCT substrate MPP+. The level of transport of 0.1 μM MPP+ in HEK-hOCT2(D475R)-GFP-C measured in 3050

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

Figure 5. Inhibition of uptake of MPP+ into confluent HEK-hOCT2-C by previously identified inhibitors of hOCT2 and Cd2+. Confluent HEK-hOCT2-C were incubated for 2 min at 37 °C in transport PBS with 0.1 μM MPP+ containing [3H]MPP+ in the absence and presence of different inhibitor concentrations. Because the rate of uptake in HEK-C was Zn2+ > Cu2+ > choline2+ > TEA+ > cimetidine+ > quinine+ ≈ corticosterone > MPP+. The data indicate that hOCT2 has largely different functional properties in confluent and dissociated HEK293 cells. Cd2+ Toxicity Is Partially Due to hOCT2-Mediated Cd2+ Uptake and Can Be Decreased by Blockage of hOCT2 with Cimetidine+. To determine whether hOCT2-mediated Cd2+ uptake is relevant for Cd2+-induced toxicity, we compared the effects of Cd2+ on cell viability in HEK-C versus HEKhOCT2-C using the modified tetrazolium (MTT) test.29 When 100 μM Cd2+ was applied for 2.5 h to confluent cells in serum-

Figure 7. Inhibition of uptake of MPP+ by dissociated HEK-hOCT2-C by previously identified inhibitors of hOCT2, Cd2+, Cu2+, and Zn2+. Confluent HEK-hOCT2-C were dissociated by incubation in the absence of Ca2+ and Mg2+ and suspended in transport PBS containing 0.5 mM MgCl2 and 1 mM CaCl2. Uptake of 0.1 μM MPP+ containing [3H]MPP+ by dissociated cells was assessed in the absence and presence of different inhibitor concentrations. For uptake measurements, cells were incubated for 1 s at 37 °C and the uptake was stopped with ice-cold buffer containing 100 μM quinine. Because the rate of uptake of 0.1 μM MPP+ in dissociated HEK-C was less than 5% compared to that in HEK-hOCT2-C, no correction for nonspecific uptake was made. Uptake in the presence of inhibitors was normalized against the uptake measured in the absence of inhibitors. Mean values ± SE of three to six independent experiments in quadruplicate are given. The curves were obtained by fitting the Hill equation to the compiled data sets.

free medium at 37 °C, the cell viability of HEK-hOCT2-C (47.2 ± 1.8%) was significantly lower than that of HEK cells (90.5 ± 3.7%; P < 0.01) (Figure 8A). To evaluate whether blockage of hOCT2 may be employed to reduce Cd2+ nephrotoxicity, we tested the effect of cimetidine+, which had been identified as a high-affinity blocker of Cd2+ uptake in confluent HEK-hOCT2-C. After incubation of HEK-hOCT2-C with 100 μM Cd2+ for 2.5 h in the presence of 10 μM cimetidine+ (at 37 °C in serum-free medium), the sensitivity of HEK-hOCT2-C to Cd2+ was abolished (Figure 8A). In the absence of Cd2+, 10 μM cimetidine+ did not affect the viability of HEK-hOCT2-C or HEK-C. Cimetidine+, at 10 μM, also did not significantly influence the viability of HEK-C in the presence of 100 μM Cd2+. 3052

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

Figure 8. continued incubated for 16 h in serum-containing medium without or with 5− 100 μM Cd2+, and the cell viability was determined with the MTT. (D) Effects of Cd2+ and cimetidine+ on cell viability of NRK-52E rat renal proximal tubule cells. ∼80% confluent NRK-522E-C were incubated for 3 h in 1% serum without Cd2+ ± 10 μM cimetidine+ or with 25 μM Cd2+ ± 10 μM cimetidine+ and cell viability was determined with the MTT. Data were normalized to measurements performed in the absence of Cd2+ and cimetidine+. Means ± SE of three to six independent experiments are shown. *P < 0.05; **P < 0.01.

To determine whether Cd 2+ induces apoptosis, we performed FACS analysis employing the apoptosis marker annexin V25 and measuring the rate of uptake of propidium iodide (PI) by nonpermeabilized cells. Cell sorting was performed after incubation at 37 °C with 100 μM Cd2+ for 2.5 h in serum-free medium as described in the legend of Figure 8A. The number of PI impermeable cells expressing annexin V that are in the early apoptosis state was increased by Cd2+ (10.9 ± 1.2% with Cd2+ vs 6.7 ± 0.5% without Cd2+; n = 5 each; P < 0.01) (Figure 8B). Simultaneous incubation with 100 μM Cd2+ and 10 μM cimetidine+ completely suppressed the Cd2+induced increase of early apoptosis (6.7 ± 0.3%; n = 5 with Cd2+ and cimetidine+). Cd2+ also increased the number of PI permeable annexin V-expressing cells that are in a state of late apoptosis (42.3 ± 3.9% with Cd2+ vs 18.4 ± 1.8% without Cd2+; n = 5 each; P < 0.01) (Figure 8B). Cimetidine+, at 10 μM, reduced the amount of late apoptotic cells observed in the presence of Cd2+ (Figure 8B). In contrast, 10 μM cimetidine+ had no effect on the percentage of normal, early, or late apoptotic cells in the absence of Cd2+ (Figure 8B). The data indicate that hOCT2-mediated Cd2+ uptake induces early apoptosis and promotes late apoptosis. Trying to evaluate whether hOCT2 may also influence the toxicity of lower Cd2+ concentrations, we also incubated confluent HEK293 cells with Cd2+ concentrations below the Km for Cd2+ transport by hOCT2. Because prolonged incubation times were required to achieve significant cell death and HEK293 cells do not tolerate long incubation in serum-free medium, we performed these experiments in the presence of serum. Because of the binding of Cd2+ to serum proteins, the free Cd 2+ concentration was lower than the nominal concentration. After incubation with 5−100 μM Cd2+ at 37 °C for 16 h, the viability of HEK-hOCT2-C was significantly lower at all concentrations tested, with the exception of 100 μM Cd2+, than that of HEK-C (Figure 8C). The data suggest that uptake of Cd2+ by hOCT2 may be relevant for the chronic nephrotoxicity of Cd2+. Moreover, Cd2+ toxicity was determined in a cell culture model of the renal proximal tubule, which is the major target of chronic Cd2+ toxicity.1−3 NRK-52E-C, which expressed rOct2 mRNA (RT-PCR data not shown), were exposed to 25 μM Cd2+ for 3 h in the absence of presence of 10 μM cimetidine+. As shown in Figure 8D, cimetidine+ alone had no effect. Cd2+, at 25 μM, decreased cell viability to 86.9 ± 0.8% of controls after 3 h (n = 6 each; P < 0.01), and co-incubation with cimetidine+ (10 μM) significantly reduced the toxicity in NRK52E-C (92.4 ± 0.2%; n = 6 each; P < 0.05 when compared to Cd2+ alone) (Figure 8D). These data support the assumption that Cd2+ transport via OCT2 contributes to Cd2+ toxicity in renal proximal tubules, as already proposed by others.30

Figure 8. Cd2+-induced cell apoptosis in hOCT2-overexpressing HEK293 cells and NRK-52E cells is cimetidine+ sensitive. (A) Effects of Cd2+ and cimetidine+ on cell viability. Approximately 80% confluent HEK-C and HEK-hOCT2-C were incubated for 2.5 h in serum-free medium without Cd2+ with or without 10 μM cimetidine+ or with 100 μM Cd2+ with or without 10 μM cimetidine+, and cell viability was determined with the modified tetrazolium test (MTT). (B) Effects of Cd2+ and cimetidine+ on apoptosis. Approximately 80% confluent HEK-C and HEK-hOCT2-C were incubated for 2.5 h in serum-free medium with or without 10 μM cimetidine+ and with or without 100 μM Cd2+. FACS analysis was performed. Annexin V binding and propidium iodide impermeant (“early apoptotic”) and annexin V binding and propidium iodide permeant (“late apoptotic”) cells were quantified. (C) Concentration dependence of Cd2+ toxicity in HEK-C and HEK-hOCT2-C. Approximately 80% confluent cells were 3053

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

■

Article

of protein)−1 min−1. Thus, the Vmax for hOCT2 is 667 times higher than that for ZIP8 and the Km value for hOCT2 is 90 times higher. Assuming similar expression levels of ZIP8 and hOCT2 in the employed overexpressing cells and in kidney, we found rates of uptake of 0.6 μM Cd2+ by ZIP8 of 0.045 nmol (mg of protein)−1 and by hOCT2 of 0.33 nmol (mg of protein)−1. In the case in which the level of expression of ZIP8 after overexpression was 7 times higher than that of hOCT2 and the expression levels of ZIP8 and hOCT2 in the proximal tubules are similar, the rate of Cd2+ uptake mediated by both systems is of a similar order of magnitude. Because hOCT2 is also located in the luminal membrane of human airways,35 Cd2+ uptake via hOCT2 may also represent an important route of entry of Cd2+ from tobacco smoke into lungs.36 Inhaled Cd2+ partly dissolves in the respiratory tract lining fluid, and ∼50% is absorbed by the lungs.36 Characterizing the interaction of Cd2+ with hOCT2, we made two unexpected observations. First, we observed that uptake of Cd2+ by hOCT2-expressing HEK293 cells measured in confluent cell layers was abolished when the confluent cells had been dissociated by removal of Ca2+ and Mg2+ and that the affinities of ligands for inhibiting hOCT2-mediated uptake of 0.1 μM MPP+ were different when the measurements were performed in confluent versus dissociated cells. Second, we found that ligand affinities for the inhibition of uptake of Cd2+ by confluent cells overexpressing hOCT2 were different than ligand affinities for inhibition of hOCT2-mediated uptake of ASP+ or MPP+. Because Ca2+ removal activates protein kinases, including PKC,37 and substrate affinities of OCTs are regulated by protein kinases, including PKC,21,38,39 the regulatory state of hOCT2 in confluent cells is likely to be different compared to that in dissociated cells, showing different affinities of inhibitory ligands and allowing Cd2+ uptake. Hence, for future testing of the translocation of drugs by OCTs and/or their inhibitory effects on transport activities, the in vivo regulatory states of the respective transporters will have to be considered. An important finding of this work was that the inhibitor potency of OCT ligands is highly dependent on the substrate employed for uptake measurements. Measuring the IC50 values of a panel of OCT ligands for inhibition of hOCT2-mediated uptake of three substrates at concentrations far below the respective Km values, we obtained different affinity profiles. Considering the detailed knowledge derived from extensive mutagenesis of rOct1 from homology modeling of the outwardopen and inward-open conformations of OCTs and from ligand-induced movements in rOct1 measured by voltage clamp fluorometry,22,28,40,41 hypotheses concerning the interaction of organic cations and their translocation have been proposed.28 Our previous data suggested that OCTs acquire at least three conformational states: one state with an outward-open binding cleft containing an innermost binding pocket where transported cations bind and additional more peripherally localized binding sites for organic cations that may overlap with domains in the innermost binding pocket. During translocation, the transporter reaches a second state in which the transported cation is occluded. This occluded state prevents passive movements of small ions during translocation.42 The occluded state opens to the intracellular side so that the transported cation can be released into the cytosol. This state develops an inward-open binding cleft that shares amino acids with the outward-open cleft.43 Although the transport of organic cations requires transitions between the basic conformational states, it is expected that structurally different transported cations induce

DISCUSSION This paper provides evidence that Cd2+ is transported by hOCT2 but not by hOCT1 and hOCT3 and that the uptake pathway via hOCT2 can be relevant for Cd2+-induced apoptosis. Earlier transport of Cd2+ by OCT1 and OCT2 from rabbit has been suggested; however, the provided experimental evidence for transport was equivocal.30 After incubation of Chinese hamster ovary cells for 3 h with Cd2+, the authors observed higher intracellular Cd2+ concentrations when OCT1 or OCT2 from rabbit had been overexpressed and that TEA+ blunted the increase in the Cd2+ concentration in the overexpressing cells. They did not provide evidence that the increased intracellular Cd2+ concentration reflected increased uptake rates and did not demonstrate substrate saturation. Performing a more detailed investigation, we demonstrated substrate saturation of Cd2+ uptake of HEK293 cells expressing hOCT2 (HEK-hOCT2-C), showed that various hOCT2 substrates and inhibitors inhibited Cd2+ transport in HEKhOCT2-C, and demonstrated that a point mutation in the hinge domain of hOCT2 decreased the rate of Cd2+ uptake. Cd2+ intoxication causes severe human diseases, including renal dysfunction, osteoporosis, and adenocarcinoma of the lung. During acute and chronic intoxication, Cd2+ accumulates primarily in kidney. Because Cd2+ is eliminated with a half-time of 15−20 years,27 it is very important to provide optimal treatment after poisoning. Thus, detailed knowledge of the mechanisms mediating cellular Cd2+ uptake and release and Cd2+ excretion in kidney is required. Renal proximal tubular cells contain uptake and efflux systems in the brush border membrane (BBM) and an uptake system(s) in the basolateral membrane (BLM). In addition to receptors that mediate endocytosis of Cd2+ complexes, the BBM contains metal ion transporter ZIP8 (SLC39A8) that accepts Cd2+ as a substrate.31 Providing evidence that hOCT2 that is strongly expressed in the BLM32 transports Cd2+, we identified the first Cd2+ uptake system in the BLM. So far, the impact of transporters on chronic Cd2+ intoxication has not been studied; however, evidence has been provided that ZIP8 in the BBM is relevant for nephrotoxicity after acute poisoning.31 In the recent study of Soodvilai and co-workers, they reported that acute nephrotoxicity after intravenous injection of CdCl2 in rats was significantly reduced with TEA+.30 Because TEA+ inhibits OCT1 and OCT2 and Cd2+ is not transported by hOCT1, this result suggests the pathophysiological relevance of hOCT2. Comparing the impact of ZIP8 in the BBM and hOCT2 in the BLM for cellular Cd2+ uptake, we must consider the Cd2+ concentrations at the two sides of proximal tubular cells, levels of transporter expression, and transport properties. Most Cd2+ in the blood is complexed to proteins, e.g., metallothionein, which results in relatively low free Cd2+ concentrations in the systemic circulation and thereby protects the body from harmful effects of free Cd2+.1,27 However, after acute poisoning, the free Cd2+ concentration in the blood, which is similar to the concentration at the BLM containing hOCT2, may increase to 0.25 μM.33 Because of the concentration of the glomerular filtrate, the luminal concentration in the distal part of the proximal tubule that is relevant for ZIP8-mediated uptake may approach 2.5 μM. After overexpression of ZIP8 in mouse fetal fibroblasts, a Km value of 0.6 μM and a Vmax value of 0.09 nmol (mg of protein)−1 min−1 were determined for Cd2+ uptake.34 For Cd2+ uptake in HEK293 cells transfected with hOCT2, we obtained a Km value of 54 μM and a Vmax value of 60 nmol (mg 3054

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics substates due to the interaction of different substrates with partially different amino acids. Performing voltage-clamp fluorometry after fluorescence labeling of rOct1 at different positions, we provided evidence of substrate-dependent conformational differences of rOct1.22 These differences were supposed to reflect substrate-dependent substates of rOct1. The data reported in this work indicate that substratedependent substates during transport include structural differences within the binding cleft. Trying to determine the molecular mechanism that is responsible for the substratedependent inhibitor affinities, we employed mutagenesis experiments in rOct1, which has been studied in large detail.28 We investigated the effect of a point mutation in the substrate binding hinge domain of rOct1 that is critically involved in the binding of transported cations and in subsequent transportrelated conformational changes in substrate-dependent differences in the affinity of the nontransported inhibitor TBuA+. Similar to the inhibitors tested on hOCT2, TBuA+ showed substrate-dependent affinity. It inhibited rOct1-mediated uptake of TEA+ with an affinity higher than that of uptake of MPP+. Importantly, the situation was changed after replacement of Asp475 with glutamate. In this mutant, TBuA+ inhibited the uptake of TEA+ with the same affinity as the uptake of MPP+. These data indicate that short distance allosteric effects between the binding sites for transported organic cations and nontransported inhibitory cations are involved in substrate-dependent affinities of inhibitors. This implies that cationic inhibitors can interact with the transporter after the substrate has bound and may thereby block substrate translocation. The observed substrate selective inhibitor potency has an important biomedical impact. For the prediction of interactions of drugs with endogenous substrates of OCTs or for the prediction of drug−drug interactions, it is not sufficient to test the affinity for inhibition of model substrates. The affinities of a new drug for inhibition of a panel of relevant drugs and endogenous substrates must be determined to exclude potential side effects. Drug−drug interactions can be excluded only if the drugs in question are employed for testing. The observed substrate dependence of inhibitor affinities also highlights a serious limitation of previous pharmacophore models that were based on measurements of the inhibition of transport of one substrate by various inhibitors.

■

ACKNOWLEDGMENTS

■

ABBREVIATIONS

■

REFERENCES

We thank Michael Christof for preparing the figures. This work was supported by Deutsche Forschungsgemeinschaft Grants FT 345/11-1, CI 107/4-2, and KO 872/6-1.

OCT, organic cation transporter; hOCT2, human organic cation transporter 2; hOCT1, hOCT3, and rOct1, human OCT1, human OCT3, and rat Oct1, respectively; HEK, human embryonic kidney; GFP, green fluorescent protein; HEK-C, HEK-hOCT2-C, HEK-hOCT2-GFP-C, and HEK-hOCT2(D475R)-GFP-C, HEK cells stably transfected with control vector, hOCT2, hOCT2-GFP, and hOCT2(D475R)-GFP, respectively; NRK-52-E-C, “normal rat kidney” proximal tubule cells; MPP+, 1-methyl-4-phenylpyridinium+; ASP+, 4-[4(dimethylamino)styryl]-N-methylpyridinium+; TEA+, tetraethylammonium+; MTT, modified tetrazolium test; TBuA +, tetrabutylammonium+.

(1) Thévenod, F. Nephrotoxicity and the proximal tubule. Insights from cadmium. Nephron Physiol. 2003, 93, 87−93. (2) Zalups, R. K. Evidence for basolateral uptake of cadmium in the kidneys of rats. Toxicol. Appl. Pharmacol. 2000, 164, 15−23. (3) Bridges, C. C.; Zalups, R. K. Molecular and ionic mimicry and the transport of toxic metals. Toxicol. Appl. Pharmacol. 2005, 204, 274− 308. (4) He, L.; Wang, B.; Hay, E. B.; Nebert, D. W. Discovery of ZIP transporters that participate in cadmium damage to testis and kidney. Toxicol. Appl. Pharmacol. 2009, 238, 250−257. (5) Koepsell, H. The SLC22 drug transporter family. Mol. Aspects Med. 2013, 34, 413−435. (6) Koepsell, H.; Lips, K.; Volk, C. Polyspecific organic cation transporters: Structure, function, physiological roles, and biopharmaceutical implications. Pharm. Res. 2007, 24, 1227−1251. (7) Schmitt, B. M.; Koepsell, H. Alkali cation binding and permeation in the rat organic cation transporter rOCT2. J. Biol. Chem. 2005, 280, 24481−24490. (8) Thévenod, F.; Ciarimboli, G.; Wolff, N. A.; Schlatter, E.; Koepsell, H. The human organic cation transporter 2 (hOCT2) transports cadmium (Cd2+) and mediates Cd2+ induced cell death. FASEB J. 2008, 22, 1202.6. (9) Lee, W. K.; Reichold, M.; Edemir, B.; Ciarimboli, G.; Warth, R.; Koepsell, H.; Thevenod, F. Organic cation transporters OCT1, 2, and 3 mediate high-affinity transport of the mutagenic vital dye ethidium in the kidney proximal tubule. Am. J. Physiol. 2009, 296, F1504−F1513. (10) Ciarimboli, G.; Struwe, K.; Arndt, P.; Gorboulev, V.; Koepsell, H.; Schlatter, E.; Hirsch, J. R. Regulation of the human organic cation transporter hOCT1. J. Cell. Physiol. 2004, 201, 420−428. (11) Cetinkaya, I.; Ciarimboli, G.; Yalcinkaya, G.; Mehrens, T.; Velic, A.; Hirsch, J. R.; Gorboulev, V.; Koepsell, H.; Schlatter, E. Regulation of human organic cation transporter hOCT2 by PKA, PI3K, and calmodulin-dependent kinases. Am. J. Physiol. 2003, 284, F293−F302. (12) Ho, S. N.; Hunt, H. D.; Horton, R. M.; Pullen, J. K.; Pease, L. R. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989, 77, 51−59. (13) Busch, A. E.; Karbach, U.; Miska, D.; Gorboulev, V.; Akhoundova, A.; Volk, C.; Arndt, P.; Ulzheimer, J. C.; Sonders, M. S.; Baumann, C.; Waldegger, S.; Lang, F.; Koepsell, H. Human neurons express the polyspecific cation transporter hOCT2, which translocates monoamine neurotransmitters, amantadine, and memantine. Mol. Pharmacol. 1998, 54, 342−352. (14) Gorboulev, V.; Volk, C.; Arndt, P.; Akhoundova, A.; Koepsell, H. Selectivity of the polyspecific cation transporter rOCT1 is changed by mutation of aspartate 475 to glutamate. Mol. Pharmacol. 1999, 56, 1254−1261.

ASSOCIATED CONTENT

S Supporting Information *

Primers employed for RT-PCRs, GenBank accession numbers, cycling conditions, and product sizes as well as measurements of mRNAs of metal transporters in HEK-C and HEK-hOCT2C. This material is available free of charge via the Internet at http://pubs.acs.org.

■

■

Article

AUTHOR INFORMATION

Corresponding Author

*F.T.: Institute of Physiology and Pathophysiology, ZBAF, University of Witten/Herdecke, Stockumer Str. 12, 58453 Witen, Germany; telephone, +49-2302-926221; e-mail, frank. [email protected]. H.K.: Institute of Anatomy and Cell Biology, Koellikerstr. 6, 97070 Würzburg, Germany; phone, +49-931-3182700; e-mail, [email protected]. Notes

The authors declare no competing financial interest. 3055

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056

Molecular Pharmaceutics

Article

(15) Erfurt, C.; Roussa, E.; Thevenod, F. Apoptosis by Cd2+ or CdMT in proximal tubule cells: Different uptake routes and permissive role of endo/lysosomal CdMT uptake. Am. J. Physiol. 2003, 285, C1367−C1376. (16) Lee, W. K.; Torchalski, B.; Kohistani, N.; Thevenod, F. ABCB1 protects kidney proximal tubule cells against cadmium-induced apoptosis: Roles of cadmium and ceramide transport. Toxicol. Sci. 2011, 121, 343−356. (17) Mehrens, T.; Lelleck, S.; Cetinkaya, I.; Knollmann, M.; Hohage, H.; Gorboulev, V.; Boknik, P.; Koepsell, H.; Schlatter, E. The affinity of the organic cation transporter rOCT1 is increased by protein kinase C-dependent phosphorylation. J. Am. Soc. Nephrol. 2000, 11, 1216− 1224. (18) Pietig, G.; Mehrens, T.; Hirsch, J. R.; Cetinkaya, I.; Piechota, H.; Schlatter, E. Properties and regulation of organic cation transport in freshly isolated human proximal tubules. J. Biol. Chem. 2001, 276, 33741−33746. (19) Minuesa, G.; Volk, C.; Molina-Arcas, M.; Gorboulev, V.; Erkizia, I.; Arndt, P.; Clotet, B.; Pastor-Anglada, M.; Koepsell, H.; MartinezPicado, J. Transport of lamivudine [(−)-β-L-2′,3′-dideoxy-3′-thiacytidine] and high-affinity interaction of nucleoside reverse transcriptase inhibitors with human organic cation transporters 1, 2, and 3. J. Pharmacol. Exp. Ther. 2009, 329, 252−261. (20) Wolff, N. A.; Lee, W. K.; Thevenod, F. Role of Arf1 in endosomal trafficking of protein-metal complexes and cadmiummetallothionein-1 toxicity in kidney proximal tubule cells. Toxicol. Lett. 2011, 203, 210−218. (21) Biermann, J.; Lang, D.; Gorboulev, V.; Koepsell, H.; Sindic, A.; Schroter, R.; Zvirbliene, A.; Pavenstadt, H.; Schlatter, E.; Ciarimboli, G. Characterization of regulatory mechanisms and states of human organic cation transporter 2. Am. J. Physiol. 2006, 290, C1521−C1531. (22) Egenberger, B.; Gorboulev, V.; Keller, T.; Gorbunov, D.; Gottlieb, N.; Geiger, D.; Mueller, T. D.; Koepsell, H. A substrate binding hinge domain is critical for transport-related structural changes of organic cation transporter 1. J. Biol. Chem. 2012, 287, 31561− 31573. (23) Wolff, N. A.; Liu, W.; Fenton, R. A.; Lee, W. K.; Thevenod, F.; Smith, C. P. Ferroportin 1 is expressed basolaterally in rat kidney proximal tubule cells and iron excess increases its membrane trafficking. J. Cell. Mol. Med. 2011, 15, 209−219. (24) Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265−275. (25) Lang, D.; Dohle, F.; Terstesse, M.; Bangen, P.; August, C.; Pauels, H. G.; Heidenreich, S. Down-regulation of monocyte apoptosis by phagocytosis of platelets: Involvement of a caspase-9, caspase-3, and heat shock protein 70-dependent pathway. J. Immunol. 2002, 168, 6152−6158. (26) Nies, A. T.; Koepsell, H.; Damme, K.; Schwab, M. Organic cation transporters (OCTs, MATEs), in vitro and in vivo evidence for the importance in drug therapy. Handb. Exp. Pharmacol. 2011, 105− 167. (27) Thévenod, F. Catch me if you can! Novel aspects of cadmium transport in mammalian cells. BioMetals 2010, 23, 857−875. (28) Koepsell, H. Substrate recognition and translocation by polyspecific organic cation transporters. Biol. Chem. 2011, 392, 95− 101. (29) Denizot, F.; Lang, R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J. Immunol. Methods 1986, 89, 271−277. (30) Soodvilai, S.; Nantavishit, J.; Muanprasat, C.; Chatsudthipong, V. Renal organic cation transporters mediated cadmium-induced nephrotoxicity. Toxicol. Lett. 2011, 204, 38−42. (31) Wang, B.; Schneider, S. N.; Dragin, N.; Girijashanker, K.; Dalton, T. P.; He, L.; Miller, M. L.; Stringer, K. F.; Soleimani, M.; Richardson, D. D.; Nebert, D. W. Enhanced cadmium-induced testicular necrosis and renal proximal tubule damage caused by

gene-dose increase in a Slc39a8-transgenic mouse line. Am. J. Physiol. 2007, 292, C1523−C1535. (32) Motohashi, H.; Sakurai, Y.; Saito, H.; Masuda, S.; Urakami, Y.; Goto, M.; Fukatsu, A.; Ogawa, O.; Inui, K. Gene expression levels and immunolocalization of organic ion transporters in the human kidney. J. Am. Soc. Nephrol. 2002, 13, 866−874. (33) Hung, Y. M.; Chung, H. M. Acute self-poisoning by ingestion of cadmium and barium. Nephrol., Dial., Transplant. 2004, 19, 1308− 1309. (34) Girijashanker, K.; He, L.; Soleimani, M.; Reed, J. M.; Li, H.; Liu, Z.; Wang, B.; Dalton, T. P.; Nebert, D. W. Slc39a14 gene encodes ZIP14, a metal/bicarbonate symporter: Similarities to the ZIP8 transporter. Mol. Pharmacol. 2008, 73, 1413−1423. (35) Lips, K. S.; Volk, C.; Schmitt, B. M.; Pfeil, U.; Arndt, P.; Miska, D.; Ermert, L.; Kummer, W.; Koepsell, H. Polyspecific cation transporters mediate luminal release of acetylcholine from bronchial epithelium. Am. J. Respir. Cell Mol. Biol. 2005, 33, 79−88. (36) Nawrot, T. S.; Staessen, J. A.; Roels, H. A.; Munters, E.; Cuypers, A.; Richart, T.; Ruttens, A.; Smeets, K.; Clijsters, H.; Vangronsveld, J. Cadmium exposure in the population: From health risks to strategies of prevention. BioMetals 2010, 23, 769−782. (37) Lacaz-Vieira, F.; Jaeger, M. M. Protein kinase inhibitors and the dynamics of tight junction opening and closing in A6 cell monolayers. J. Membr. Biol. 2001, 184, 185−196. (38) Ciarimboli, G.; Koepsell, H.; Iordanova, M.; Gorboulev, V.; Durner, B.; Lang, D.; Edemir, B.; Schroter, R.; Van Le, T.; Schlatter, E. Individual PKC-phosphorylation sites in organic cation transporter 1 determine substrate selectivity and transport regulation. J. Am. Soc. Nephrol. 2005, 16, 1562−1570. (39) Ciarimboli, G.; Schlatter, E. Regulation of organic cation transport. Pfluegers Arch. 2005, 449, 423−441. (40) Popp, C.; Gorboulev, V.; Muller, T. D.; Gorbunov, D.; Shatskaya, N.; Koepsell, H. Amino acids critical for substrate affinity of rat organic cation transporter 1 line the substrate binding region in a model derived from the tertiary structure of lactose permease. Mol. Pharmacol. 2005, 67, 1600−1611. (41) Gorbunov, D.; Gorboulev, V.; Shatskaya, N.; Mueller, T.; Bamberg, E.; Friedrich, T.; Koepsell, H. High-affinity cation binding to organic cation transporter 1 induces movement of helix 11 and blocks transport after mutations in a modeled interaction domain between two helices. Mol. Pharmacol. 2008, 73, 50−61. (42) Schmitt, B. M.; Gorbunov, D.; Schlachtbauer, P.; Egenberger, B.; Gorboulev, V.; Wischmeyer, E.; Muller, T.; Koepsell, H. Charge-tosubstrate ratio during organic cation uptake by rat OCT2 is voltage dependent and altered by exchange of glutamate 448 with glutamine. Am. J. Physiol. 2009, 296, F709−F722. (43) Volk, C.; Gorboulev, V.; Kotzsch, A.; Muller, T. D.; Koepsell, H. Five amino acids in the innermost cavity of the substrate binding cleft of organic cation transporter 1 interact with extracellular and intracellular corticosterone. Mol. Pharmacol. 2009, 76, 275−289.

3056

dx.doi.org/10.1021/mp400113d | Mol. Pharmaceutics 2013, 10, 3045−3056