Substrate Specificity of Clostridial Glucosylating Toxins and Their

Article pubs.acs.org/jpr

Substrate Specificity of Clostridial Glucosylating Toxins and Their Function on Colonocytes Analyzed by Proteomics Techniques Johannes Zeiser, Ralf Gerhard, Ingo Just, and Andreas Pich* Hannover Medical School, Institute of Toxicology, Carl-Neuberg-Str. 1, 30625 Hannover, Germany S Supporting Information *

ABSTRACT: Clostridium dif f icile is the major cause of intestinal infections in hospitals. The major virulence factors are toxin A (TcdA) and toxin B (TcdB), which belong to the group of clostridial glucosylating toxins (CGT) that inactivate small GTPases. After a 24 h incubation period with TcdA or a glucosyltransferase-deficient mutant TcdA (gdTcdA), quantitative changes in the proteome of colonic cells (Caco-2) were analyzed using high-resolution LC−MS/MS and the SILAC technique. The changes in abundance of more than 5100 proteins were quantified. Nearly 800 toxin-responsive proteins were identified that were involved in cell cycle, cell structure, and adhesion as well as metabolic processes. Several proteins localized to mitochondria or involved in lipid metabolism were consistently of higher abundance after TcdA treatment. All changes of protein abundance depended on the glucosyltransferase activity of TcdA. Glucosylation of the known targets of TcdA such as RhoA, RhoC, RhoG was detected by LC−MS/MS. In addition, an almost complete glucosylation of Rap1(A/B), Rap2(A/B/C) and a partial glucosylation of Ral(A/B) and (H/K/N)Ras were detected. The glucosylation pattern of TcdA was compared to that of other CGT like TcdB, the variant TcdB from C. dif f icile strain VPI 1470 (TcdBF), and lethal toxin from C. sordellii (TcsL). KEYWORDS: Clostridium dif f icile, toxin A, toxin B, glucosylation, small GTPases, SILAC, LC−MS

■

INTRODUCTION Clostridia produce a plethora of protein toxins with different functionalities as reviewed by various authors.1−8 One group of these bacterial toxins are the clostridial glucosylating toxins (CGT) that are single-chain, multidomain protein toxins. So far various isoforms of different CGTs have been described: Toxin A (TcdA) and Toxin B (TcdB) from C. dif f icile, lethal toxin (TcsL) and hemorraghic Toxin (TcsH) from C. sordellii, αToxin from C. novyi and TpeL from C. perf ringens. They target specifically members of the Ras superfamily of small GTPases and inactivate them by transferring a glucose or N-acetylglucosamine (GlucNAc) moiety from cellular UDP precursors onto a pivotal threonine residue in the GTP-binding domain.1,9 A varying, sometimes even contradicting substrate specificity of the known CGT isoforms has been reported1,2,4−6,10 (Table 1) applying in vitro experiments with purified, recombinantly expressed substrate GTPases and purified toxins. The specific glucosylation sites have been identified for most substrates by, e.g., autoradiograph,9 mass spectrometry,1 Edman sequencing11 NMR,22 or X-ray crystal structure determination.12 Recently, Pruitt el al. reported on the glucosylation of Rap2 from cellular extracts by mass spectrometry,13 which is the first published direct detection of glucosylated Rap2 from intact cells. Just et al. identified RhoA, Rac1 and Cdc42 as the very first glucosylation targets of the CGTs of TcdA and TcdB and applied electrospray tandem mass spectrometry to identify the glucosylation site of in vitro glucosylated RhoA.2 Subsequent © 2013 American Chemical Society

detailed studies showed that RhoB, RhoC and RhoG are also glucosylated by TcdA and TcdB.4 Chavez-Olarte et al. detected the glucosylation of Rap2 by TcdA.14 This finding, however, has not been considered in most research papers and reviews. Mehlig et al. used C. dif f icile strain C34 for their study and detected glucosylation of Rap by TcdA, as well as glucosylation of Rap and Ral by TcdB.15 A modified form of TcdB from strain 1470 sero group F (TcdBF) consists of a catalytic domain at the N-terminus that is similar to the catalytic domain of TcsL and a receptor-binding C-terminal domain that is similar to TcdB and glucosylates RhoG, Rac1, Cdc42 as well as RRas, Rap1, Rap2 and RalA.4−6 The substrate spectrum is quite similar to TcsL, which glucosylates Rac, Ras, Rap and Ral, but isoforms from different strains exhibit a varying substrate spectrum of the Rho-proteins. TcsL from strain 904817−19 and 60186,11,18 glucosylate RhoG, CDC42 and TC10, while the isoform of strain IP82 does not glucosylate RhoG and TC10.19−21 TcsH and α-Toxin share RhoA, Rac1 and Cdc42 as substrates, while TcsH utilizes UDP-glucose and α-Toxin UDP-GlucNAc as cosubstrate.17,22 Nagahama et al. showed that the catalytic domain (amino acids 1−525) of TpeL from C. perf ringens utilizes both UDP-glucose and UDP-GlucNAc as a cosubstrate to modify HRas, Rap1B and RalA but only UDPReceived: October 16, 2012 Published: February 6, 2013 1604

dx.doi.org/10.1021/pr300973q | J. Proteome Res. 2013, 12, 1604−1618

Journal of Proteome Research

Article

Table 1. Publication Analysis of the Glucosylation Spectra of Different CGTsa Toxin TcdA Toxin A

TcdB Toxin B

TcdBF variantes Toxin B TcsL letal Toxin

TcsH hemorhagic Toxin α-Toxin TpeL (1−525)

Strain

RhoA

C. dif f icile VPI10463 C. dif f icile C34 C. dif f icile C34 C. dif f icile VPI10463 C. dif f icile 1470

4, 10

4

4

4

4, 10

4, 10

12b 12b 1, 4

12b 12b 4

12b 12b 4

12b 12b 4

12 12 1, 4, 13

12 12 1, 4

4

4,6

4−6

4, 6

16 6

14−16 6, 15, 18 16, 19 14

14−16 15

20 21

20

C. C. C. C.

sordellii 9048 sordellii 6018 sordellii IP82 sordellii

C. novyi 6018 C. perfringens MC18

14b 20

RhoB RhoC

14b

14b

RhoG

14b

Rac1

Cdc42

TC10

Rap1 (A/ B)

Rap2 (A/ B/C)

Ral (A/B)

(H/K/N) Ras

RRas

11, 24 12b 12b

12b 12b

12

4, 6

5, 6

5, 6

5, 6

16 6

14−16 6, 15 16

6 19

15 16

14−17 6, 15, 18 16, 19

21

21

5, 6 16 6 16

14

21

a Identification of a glucosylation is indicated by footnote of the cited literature. bThe specific isoform of the GTPase analyzed was not mentioned in the publication but “Rho” and “Rap”.

GlucNAc to modify Rac1.10 Notably, most of the other studies applied full-length toxins in their in vitro studies. In retrospect, a major drawback inherent in previous in vitro studies has been the disregard of the cellular context. The Cterminal farnesylation and geranylgeranylation of the GTPases, for example, which greatly affect their cellular function,24 localization and possibly the accessibility to CGTs has not been considered. The cellular uptake of CGTs is a complex process. The toxins act on their cellular targets after release of the glucosyltransferase domain into the cytosol by an autoproteolytic cleavage depending on intracellular inositol-6-phosphate.25 Pruitt et al. also discuss this aspect in their recently published study.13 The glucosyltransferase activity of the CGT in cellular context has been assessed so far with sequential [14C]-UDPglucosylation or [32P]-ADP-ribosylation in lysed cells using specific CGTs or the C3 exoenzyme from C. botulinum respectively. The transfer of [32P]ADP-ribose to accessible sites, i.e., nonglucoslyated GTPases in the lysate, was used to indirectly quantify the amount of glucosylated substrates by autoradiography from 1D-SDS PAGE gels with a compromised specificity due to the similar molecular weight of the GTPases.9 A monoclonal antibody, which only binds to nonglucosylated Rac1 and Cdc42, has been used to obtain direct information on intracellular glucosylation of these two GTPases.16 As the CGT manipulate several important GTPases in the host cell, a multitude of changes downstream of these targets has to be considered. To investigate these effects on small GTPases and their downstream target molecules, two proteomic studies have recently been carried out. The effects of TcdA on colonic cells were analyzed using either differential two-dimensional gel electrophoresis26 or stable-isotope labeling and quantitative LC-MALDI-MS/MS.27 In both studies the effects of TcdA and a glucosyltransferase mutant TcdA28 (gdTcdA) on colonocytes was investigated. In the 2-D gel approach, about 900 different protein spots were quantified and about 200 were identified, but less than 10 different proteins spots exhibited a significantly changed abundance after 24 h of treatment with TcdA. The proteins responding to the TcdA treatment belonged to abundant cellular proteins and were involved in cytoskeleton assembly, metabolism and stress response. No changes in the proteome of colonic cells were

detected by the inactive mutant. In the LC-MALDI-based approach, gdTcdA exhibited minor effects on the proteome of colonic cells after 5 h but not after 24 h. In this study less than 30 proteins were identified to respond to TcdA treatment. With the work described herein, an improvement of the known effects of CGTs on the proteome of colonic cells was achieved because of the use of the SILAC technique and a highresolution LC−MS system. This untargeted, quantitative, and system-wide proteome analysis revealed a comprehensive data set that will give new answers to cellular events induced by CGT. These high resolution proteome data enabled the identification of the glucosylated peptides of the target GTPases as well as their quantification.

■

EXPERIMENTAL PROCEDURES

Cell Culture and Triplex Metabolic Labeling of Caco-2 Cells

Metabolic labeling of Caco-2 cells was performed in DMEM without arginine, lysine and glutamine (PAA, Austria). Medium was supplemented with 1% (v/v) mL GlutaMAX (Invitrogen/ Life Technologies, Germany), 100 μg/mL of streptomycin and 100 U/mL of penicillin and 5% dialyzed bovine fetal calf serum (Promocell, Germany) that had been checked for absence of residual arginine and lysine by amino acid analysis (data not shown). Three separate cell cultures were differentially isotopelabeled by adding arginine and lysine with either natural isotope composition (R0K0, light), D4-Lys/13C6-Arg (R6K4, medium), or 13C6 15N2-Lys /13C6 15N4-Arg (R10K8, heavy) to the growth medium according to the SILAC29 method. Isotope labeled amino acids of >98% isotopic purity were purchased from Silantes (Munich, Germany). Cells were cultivated at 37 °C and 5% CO2 and passaged every 3−4 days. Full exchange of native to isotope-labeled amino acids in the Caco-2 proteome was checked by LC−MS analysis. Preparation of Toxins and Treatment of Caco-2 Cells

Wild-type TcdA and TcdB were purified from C. dif f icile VPI10463 cultures as described.30−32 Wild-type lethal toxin from C. sordellii strain 6018 (TcsL) and variant Toxin B from C. dif f icile strain 1400 (TcdBF) were purified from culture supernatants as described.33,34 Cloning of TcdA was performed by modification of the multiple cloning site of the expression vector pWH1520. The site was opened by SpeI and BamHI 1605



Article

digestion and filled with oligos coding for 6 × His and a new BamHI recognition sequence in the 5′ region of the His-tag. The oligos had a 5′ SpeI overhang and a 3′ BglII overhang. The resulting modified vector showed a SpeI and BamHI restriction site directly located in 5′ of the His-tag by deletion of the original BamHI site within the mcs. The TcdA gene of C. dif f icile reference strain 10463 (Acc No. X51797) was amplified by PCR with flanking SpeI and BamHI restriction sites, and the SpeI/BamHI digested amplificate was ligated into the vector (Table 2). Base sequence was sequenced for control.

albumin as standard protein. Aliquots of protein extracts were shock-frozen in liquid nitrogen and stored at −80 °C until further use. Three biological replicates were prepared for each treatment with all three labeling states, light, medium and heavy, included. Combination of Protein Extracts, SDS-PAGE and In-Gel Digestion

Protein extracts were thawed on ice and three mixtures were prepared. Every mixture contained each treatment condition so that protein extracts of rTcdA-, gdTcdA-treated and control cells each with a different label were included in each mixture (Figure 1). An equivalent of 200 μg of protein of each mixture

Table 2. Primers Used for PCR primer TcdA sense TcdA antisense TcdA D285/287N mutagenesis sense TcdA D285/287N mutagenesis antisense TcdB sense TcdB antisense

aequence 5′−3′ acgtggatccatgtctttaatatctaaagag acgtggatccgccatatatccc ggcggagtatatttaatgttatatgcttccaggtattcactcc ggagtgaatacctggaagcatattacatttaaatatactccgcc agtcggatccatgagtttagttaatagaaaacagttag agtcggatccttcactaatcactaattgagctgtatc

Mutagenesis of D285/284 to N285/284 was performed using site directed mutagenesis (Stratagene) and selected primers. Mutation was confirmed by sequencing and reverse mutagenesis from N285/287 to D285/287 to regain full cytotoxicity. TcdB from C. dif f icile strain 10463 (Acc. No. X53138) was amplified (Table 2) and cloned into the modified pWH1522 vector in accordance to TcdA except that the vector was modified by inserting new BamHI recognition site and 6 × His TcdB via BsrGI/BglII to delete start codon of the multiple cloning site, allowing expression of toxin starting with its own start codon. TcdB sequence was inserted via BamHI/BamHI. His-tagged TcdA (rTcdA) and TcdB (rTcdB) as well as Histagged, glucosyltransferase-deficient D285/287N double mutant TcdA28 (gdTcdA) were recombinantly overexpressed in a Bacillus megaterium expression system (MoBiTec GmbH, Germany).32 The fusion proteins were purified by Ni2+ affinity chromatography as described before.35 The tcdA gene from C. dif f icile strain VPI 10463 (GenBank accession no. X51797) was used for overexpression.32 Purity, concentration and activity of the overexpressed proteins were controlled as described, and the activity was monitored by toxin-induced cell rounding. The absence of cytotoxic impurities was checked using a cytochrome-c release assay as described.32,36 The experiments were done in triplicate. For each sample cells were grown in 75 cm2 culture flasks until confluence. Sufficient protein amounts between 3 and 5 mg were obtained from each flask. Treatment of confluent Caco-2 cells with TcdA and gdTcdAgd was carried out as described before.26 Briefly, medium was removed and 12 mL of FCS free medium supplemented with 500 ng/mL of rTcdA or 500 ng/mL of gdTcdA was added. The treatment of cells with the same volume DMEM without FCS or toxin was used as control. After 24 h, morphological changes were documented with an Axiovert 200 M phase contrast microscope (Zeiss, Germany), medium was removed, and cells were washed three times with PBS. Cells were harvested in 700 μL of ice cold lysis buffer (8 M urea, 4% CHAPS, 30 mM Tris, pH 8.0, protease inhibitor complete without EDTA (Roche Diagnostics)) and sonicated on ice with 10 cycles, 2 s each at 10% energy. Cell debris was spun down at 16000g and 4 °C for 30 min. Protein content was determined using the Bradford method37 with bovine serum

Figure 1. Workflow of the SILAC-based shotgun proteome analysis. (A) Pretreatment of cells with isotope-labeled amino acids to generate light (L), medium (M), and heavy labeled proteins. (B) Protein extraction. (C) Combination of the differentially labeled samples to form triplex-mixtures. (D) Analysis of samples by SDS-PAGE followed by RSLC-ESI-LTQ-Orbitrap MS of tryptic peptides from in-gel digestion. (E) Processing of raw data with MaxQuant for identification and quantification of peptides and proteins. (F) Statistical analysis of quantitative data for the identification of TcdA-responsive proteins.

was mixed with Laemmli buffer and incubated for 5 min at 95 °C. Proteins were then alkylated by addition of acrylamide up to a concentration of 2% and incubation at RT for 30 min. SDS PAGE was performed on 12% gels in a mini protean cell (Biorad). After electrophoresis, proteins were stained with Coomassie Brilliant Blue (CBB) for 15 min and background staining was reduced with water. Eleven to twelve bands were cut out for each lane and reduced to 1 mm3 gel pieces. These were destained two times with 200 μL of 50% ACN, 50 mM ammonium bicarbonate (ABC) at 37 °C for 30 min and then dehydrated with 100% ACN. Solvent was removed in a vacuum centrifuge, and 100 μL of 6 ng/μL sequencing grade Trypsin (Promega) in 10% ACN, 40 mM ABC were added. Gels were 1606



Article

formed. An unpaired, two-sided, heteroscedastic Student’s t test was applied to compare gdTcdA/control and TcdA/control ratios. A p-value < 0.05 and a relative change of at least 40% were set as thresholds for significant changes of protein intensities, and least two peptides quantified in every biological replicate for each protein were required. To confirm the glucosylation of peptides, the Mascot search engine was used with similar adjustements as for the Andromeda search engine.

rehydrated in trypsin solution for 1 h on ice and then covered with 10% ACN, 40 mM ABC. Digestion was performed overnight at 37 °C and was stopped by adding 100 μL of 50% ACN, 0,1% TFA. After incubation at 37 °C for 1 h the solution was transferred into a fresh sample vial. This step was repeated twice, and extracts were combined and dried in a vacuum centrifuge. Dried peptide extracts were redissolved in 55 μL of 2% ACN, 0.1% TFA with shaking at 800 rpm for 20 min. After centrifugation at 20000g, aliquots of 12.5 μL each were stored at −28 °C.

GO Term Enrichment Analysis

UniProt accession numbers of proteins with a significant change in abundance after TcdA-treatment were processed with the DAVID Bioinformatics Resource40 to identify enriched gene ontology (GO) terms among them. These GO terms were then filtered for high confidence (p > 10−6), and terms that were similar (e.g., “mitochondrion” and “mitochondrial part”) were combined into one entry.

LC−MS Analysis

Peptide samples were separated with a nanoflow ultrahigh pressure liquid chromatography system (RSLC, Thermo Scientific) equipped with a trapping column (3 μm C18 particle, 2 cm length, 75 μm ID, Acclaim PepMap, Thermo Scientific). For the first analysis of each sample a 25 cm separation column was used, and for the second analysis a 50 cm long column (2 μm C18 particle, 75 μm ID, Acclaim PepMap, Thermo Scientific) was used. Peptide mixtures were injected, enriched and desalted on the trapping column at a flow rate of 6 μL/min with 0.1% TFA for 5 min. The trapping column was switched online with the separating column, and peptides were eluted with a multistep binary gradient: linear gradient of buffer B (80% ACN, 0.1% formic acid) in buffer A (0.1% formic acid) from 4 to 25% in 115 min, 25 to 50% in 25 min, 50 to 90% in 5 and 10 min at 90% B. The column was reconditioned to 4% B in 30 min. The flow rate was 300 nL/ min, and the column temperature was set to 40 °C for the 25 cm column, while 250 nL/min and 45 °C were used for the 50 cm column. The RSLC system was coupled online via a Nano Spray Flex Ion Soure II (Thermo Scientific) to an LTQOrbitrap Velos mass spectrometer. Metal-coated fused-silica emitters (SilicaTip, 10 μm i.d., New Objectives) and a voltage of 1.2 kV were used for the electrospray. Overview scans were acquired at a resolution of 60 000 in a mass range of m/z 300− 1600 in the orbitrap analyzer and stored in profile mode. The top 10 most intensive ions of charges two or three and a minimum intensity of 2000 counts were selected for CID fragmentation with a normalized collision energy of 38.0, an activation time of 10 ms and an activation Q of 0.250 in the LTQ. Fragment ion mass spectra were recorded in the LTQ at normal scan rate and stored as centroid m/z value and intensity pairs. Active exclusion was activated so that ions fragmented once were excluded from further fragmentation for 70 s within a mass window of 10 ppm of the specific m/z value.

Protein Network Analysis and Visualization

Gene symbols of TcdA responsive proteins were exported from the MaxQuant result files and analyzed in the web based “Search Tool for the Retrieval of Interacting Genes/Proteins” (STRING, version 9.0, string-db.org).41 A confidence score of 0.4 was required to connect two proteins in the network. The protein network data were downloaded from STRING (PSIxml format) and imported into the free Cytoscape network visualization and analysis software (v. 2.82).42 Proteins of the overrepresented gene ontology (GO) terms “mitochondrion”, “signal transduction”, “glycolysis”, “respiratory chain”, “lipid metabolic process”, “ribosome”, “cell cycle”, “cytoskeletal protein binding” and “cytoskeleton” as well as the substrate GTPases were extracted from the original protein network along with their associations among each other and integrated into a focused network. Targeted Analysis of Glucosylation Sites of the Ras Protein Family

For targeted analyses, Caco-2 cells were treated with 500 ng/ mL of one of the CGTs in FCS-free DMEM for 24 h. As a control, cells grown in DMEM were used. Proteins were extracted, and 50 μg of protein of each sample were prepared and separated by SDS-PAGE as described above. After CBB staining, the area between 15 and 35 kDa was cut out and subjected to tryptic digestion as described above. Peptides were subjected to LC−MS analysis and targeted methods based on an inclusion list was used. The inclusion list contained all supposable masses of glucosylation specific peptides of the known GTPases and was implemented in the LC−MS method to prefer their fragmentation using Pulsed Q dissociation. If no mass of the inclusion list was detected, the top 10 most intense ions were analyzed. The list included the m/z values of all 2-, 3and 4-times protonated ions of the glucosylation site specific peptides with or without glucosylation as well as some peptides with missed tryptic cleavages (see Supporting Information Table S1). To avoid carry-over effects in the chromatographic system, a washing method was applied to purge the tubings, needle, and injection valve of the autosampler as well as the trapping column basically as shown by Mitulović et al.43 along with a sawtooth gradient on the separation column. The full protocol for this method can be found in the Supporting Information provided with this manuscript. After the purging procedure, 1 μL of 0.1% TFA was injected as a blank and analyzed with the same LC−MS method as used for samples to check for residual peptides before the next sample was injected.

Data Processing

Raw data were processed with the MaxQuant proteomics software suite38 version 1.1.1.36 for identification and quantification of proteins as described. Peptides and proteins were identified with the implemented Andromeda39 search engine version 1.1.0.36 and the human entries of the IPI protein database (v. 3.73, >90 000 entries) at a false discovery rate of 1% at both protein and peptide level. One missed cleavage was allowed, and oxidation, N-terminal acetylation, glucosylation at threonine residues were set as variable modifications and propionamidation on cystein residues as fixed modification. Mass tolerance was set to 10 ppm for precursor ions and to 0.6 Da for fragment ions. Known contaminants were excluded from the protein list. Protein identities were confirmed by detection of at least two peptide sequences. Protein ratios were calculated for the treatment of TcdA or gdTcdA compared to the control and log2-trans1607



Article

Figure 2. Protein fold-change ratios in the SILAC-based shotgun proteome analysis. (A) Protein fold-change ratios of TcdA-responsive proteins. Depicted are the log2-transformed fold-change ratios TcdA/control (−) and gdTcdA/control (○) with standard deviations based on three biological replicates. (B) Histograms of the log2-transformed ratios determined for all three treatment conditions are depicted: rTcdA/control, rTcdA/ gdTcdA, and gdTcdA/control.

For the identification of the glucosylated peptides, raw data of all runs were processed with MaxQuant. MS/MS spectra of glucosylated peptides were checked manually for quality and consistency of retention times compared to the peptide identifications of the SILAC-labeled peptides.

substrate (Thermo Scientific), and luminescence was recorded with a Kodak Image station 440 cf. Two technical replicates were performed for each of the three biological replicates per condition.

■

Western Blot Analysis of Rac1 Glucosylation

RESULTS

CGT Treatment of Caco-2 Cells

The glucosylation of Rac1 in rTcdA-, gdTcdA-treated and control cells was analyzed as described before.16,26 Briefly, protein extracts were separated by SDS-PAGE and then transferred to nitrocellulose. A glucosylation-sensitive mAB (mouse anti-Rac1, mAB clone 102, BD Biosciences), that only detects nonglucosylated Rac1 as well as another mAB that detects Rac1 independently of its glucosylation status (mouse anti-Rac1, mAB clone 23A8, Millipore) were utilized. Secondary HRP-conjugated goat antimouse IgG was used for detection with SuperSignal West Femto Maximum Sensitivity

Caco-2 cells were chosen as model system to investigate the effects of CGTs. They were treated with a moderate concentration of TcdA causing a clear cytopathic effect without the induction of apoptosis during the incubation period of 24 h (Supporting Information Figure S1). The cytopathic effect was detected by cell rounding. However, only minor morphological changes were observed after treatment with the toxins TcdBF and TcsL. Uptake of the toxins and cytotoxic effects were confirmed by probing the glucosylation status of Rac1 that can 1608



Article

Figure 3. Condensed STRING protein network. Depicted are the TcdA-responsive proteins of enriched GO-terms and their connection to the glucosylated GTPases. Represented are proteins of the cell cycle, the ribosome, signal transduction, glycolysis as well as many mitochondrial proteins like the mitochondrial ribosome and complex I of the respiratory chain. Proteins displayed in green were of higher abundance and proteins shown in red of lower abundance after TcdA treatment. Intensity of colors corresponds to the extent of the fold-change ratio.

regulator yorkie homologue (r = 1/3.7) and proliferation specific proteins thymidine kinase (r = 1/3.4) and thymidylate synthase (r = 1/3.4). All proteins and peptides that were identified and quantified in this study are listed in Supporting Information Table S1.

be performed by Western Blot analysis using a glucosylation sensitive antibody as well as a glucosylation insensitive antibody that detects total Rac116 (Supporting Information Figure S1). Comprehensive Proteome Analysis

The proteomes of Caco-2 cells incubated with TcdA, gdTcdA or without toxin were analyzed. Protein extracts were combined according to Figure 1, separated by SDS-PAGE and digested with trypsin. The peptides were analyzed by LC−MS/MS analysis. MS data were used for identification and quantification of peptides and their corresponding proteins. Out of the 84 557 peptide sequences that were identified, 6914 unique protein groups were assembled and 5745 of these could be identified in all three biological replicates with at least two razor and/or unique peptides. 5100 proteins were quantified in all three biological replicates, and the threshold set for a significant change of abundance (p < 0.05, fold-change >40%) was passed by 872 proteins (Figure 2A). The fold-change ratios of proteins from gdTcdA treated to control cells were centered on a value of 1, indicating that no change of abundance after treatment is induced by the glucosyltransferase-deficient mutant. The active toxin on the other hand induced major changes, and the distribution had a more bimodal characteristic with maxima at both high and low fold-change protein ratios (Figure 2B). Proteins with the highest TcdA/control fold-change ratio (r) were the extracellular matrix proteins alpha-2-HS-glycoprotein (r = 11.2), Alpha-fetoprotein (r = 10.2), fibrinogen gamma chain (r = 10.2), the small GTPase RhoB (r = 10.1) and apolipoprotein A2 (r = 8.2). The proteins with the lowest foldchange ratio were CDC42 small effector protein 2 (r = 1/6.4) ribonucleoside-diphosphate reductase subunit M2 (r = 1/4.6), Rho-effector protein rhophilin-2 (r = 1/4.0), the transcriptional

STRING Network Analysis of the TcdA-Responsive Proteins

The 875 TcdA-responsive proteins were processed with the STRING41 online tool to provide an overview of central nodes and functional clusters in the resulting protein interaction network. With the STRING confidence setting set to 0.4, 690 proteins were integrated into this network. The proteins with the most links to other proteins in the network were UBA52, Cdc42, Rac1, RhoA, Cyclin B1 (CCNB1), eukaryotic translation termination factor 1 (ETF1), β-actin (ACTB), ribonucleotide reductase M2 (RRM2), hyaluronan-mediated motility receptor (HMMR) and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha-isoform (PIK3CA). Except for Rac1 and Cdc42 all of these central nodes of the protein network were found in lower concentration after TcdA treatment. GO Term Enrichment Analysis of TcdA-Responsive Proteins

An enrichment analysis of the GO terms associated with the TcdA-responsive proteins revealed that specific functional terms could be found especially often among either the higher or lower abundant protein groups (Supporting Information Figure S3). The “biological property” (BP), “molecular function” (MF) and “cellular component” (CC) terms were analyzed. Proteins of the GOBP terms “translation”, “cytoskeleton organization”, “nuclear division”, “organelle fission”, and “cell cycle” and of the GOCC terms “cytosolic ribosome”, “focal adhesion”, “cytosolic part”, “adherence 1609



Article

junction”, “anchoring junction”, “ribosome”, “actin cytoskeleton”, “ribonucleoprotein complex”, “cytoskeleton”, and “nonmembrane-bounded organelle” were overrepresented among the down-regulated proteins. Among the proteins of higher abundance the GOBP terms “oxidation reduction”, “generation of precursor metabolites and energy”, “steroid metabolic process”, “fatty acid metabolic process” and “cholesterol transport”, the GOCC terms “mitochondrion”, “endoplasmic reticulum” and lysosome” as well as the GOMF term “oxidoreductase activity, acting on NADH or NADPH” were overrepresented. Combination of STRING Network Analysis and GO Classification Analysis

Figure 4. Utilization of the triple-SILAC-label for the verification of detected glucosylated peptides. Depicted are the elution profiles of the glucosylation specific peptide of Rap1(A/B), YDPTIDSIER in its glucosylated (lower panel) and not-glucosylated form (upper panel). The m/z value of the glucosylated peptide as well as the gap observed in the triplex of the not-glucosylated peptide depend on the SILACmixture analyzed. The picture were taken from MaxQuant and modified.

Proteins of the overrepresented GO terms as well as the substrate GTPases of TcdA were extracted from the original protein network along with their associations between each other and integrated into a new focused network to depict the interaction with the glucosylation targets of TcdA (Figure 3). Several proteins involved in signal transduction processes were up- or down-regulated upon TcdA treatment and were highly connected. Several of these regulatory proteins possess connections to other groups of proteins that are regulated and thus might be involved in signaling dependent on TcdAinactivated GTPases. In this network a connection between Cdc42 along UBA52 with several down-regulated ribosomal proteins was indicated. KRas was connected via aurora kinase alpha (AURKA) to a cluster of down-regulated proteins involved in cell cycle. RhoB and Rac1 had many links to regulated mitochondrial proteins that were nearly all detected in a higher concentration after TcdA treatment. Proteins that cluster to the respiratory chain and/or to the glycolysis were not directly connected to the substrate GTPases and their localization in the network was farthest away from them.

and TcdB expressed in B. megaterium and native TcdA and TcdB isolated from C. dif f icile culture supernatants were compared. Both TcdA species exhibited essentially the same glucosylation pattern in the experimental settings used. Wildtype TcdB exhibited the same substrate specificity as TcdA; however, for the recombinantly expressed TcdB, no glucosylation of Rap2(A/B/C), (H/K/N)Ras and Ral(A/B) was detected (Table 3). Additionally, protein extracts of Caco-2 cells were treated with wild-type TcdBF as well as wild-type TcsL, which induced glucosylation of the same GTPases (Table 3) except (H/K/N)RAS that was only glucosylated by TcsL. For the first time the glucosylation of Rap1(A/B), Rap2(A/B/ C) and (H/K/N)Ras was shown to be induced by TcdA and TcdB (Table 3). Furthermore known targets of the CGTs were confirmed by the targeted label-free analysis, and the glucosylated peptides of the small GTPases RhoA, RhoC, RhoG, Rap1(A/B), Rap2(A/B/C), Ral(A/B) and (H/K/ N)Ras were identified. In order to avoid false positive identifications of glucosylated peptides due to the sample carry-over that is commonly observed in LC-systems, a purging procedure similar to that introduced by Mitulovic et al. was applied.43 Though certain peptides were identified in blank runs after this cleaning procedure, they had a 3−5 orders of magnitude reduced overall intensity, and glucosylated peptides were not identified in these runs.

Detection of Glucosylated GTPases in the Shotgun Proteome Analysis

In the proteomic screening experiment, glucosylated peptides corresponding to the glucosylation sites of RhoA, RhoC, RhoG, Rap1(A/B), Rap2(A/B/C), (H/K/N)Ras and Ral(A/B) were identified. All spectra used for identification were rich in b- and y-fragment ions (MS spectra, Supporting Information). The occurrence of a glucosylated peptide was always accompanied by a loss of intensity of the corresponding nonglucosylated peptide (Figure 4). Glucosylated peptides including the glucosylated residue Thr35 of the known substrate GTPases Rac1 and Cdc42 were not detected, although both proteins were identified by several peptides in the proteome analysis. Glucosylation of (H/K/N)Ras by TcdA has not been shown before but was detected in this work by tandem mass spectrometry. The detected peptides contained two threonine residues, and both search engines used (Andromeda, Mascot) indicated the known Thr35 but also Thr20 as possible glucosylation sites (Supporting Information Figure S2).

Quantification of the Degree of Glucosylation

The degree of glucosylation was determined for each GTPase after independent quantification of the glucosylation specific peptide from the N-terminal part of a GTPase and unique, unmodified peptides from other domains of the GTPase . The values obtained for peptides from other GTPase domains were used to calculate the general regulation of the GTPase. This regulation factor was used to normalize the quantification of the glucosylation-specific peptide, which was heavily down regulated since TcdA activity resulted in a strong glucosylation of this peptide. Thus, the degree of glucosylation was determined by the change in abundance of the glucosylation specific peptide normalized to the general GTPase regulation. Quantification was possible for Rap1(A/B) (97%, based on Rap1A), Rap2(A/B/C) (93%, based on Rap2A), RhoG (95%), RhoA (84%), RhoC (90%), (H/K/N)Ras (72%, based on

GTPase Glucosylation by Different CGTs

The substrate specificity of recombinant TcdA expressed in B. megaterium and native TcdA isolated from C. dif f icile culture supernatants were compared in further analyses as well as the glucosylation pattern of different CGT. For these experiments the m/z values of all putative glucosylated peptides of the detected small GTPases were calculated for the 2+, 3+ and 4+ charged ions to generate an inclusion list for the LC−MS methods. First, the substrate specificities of recombinant TcdA 1610



Article

Table 3. Glucosylation Sites Identified in the Targeted Analysis gluc

detecteda

blankb

controlc

rTcdA

TcdA

TcdBF

rTcdB

TcdB

TcsL

gluc specific peptided

RAP1(A/B)

+

RAP2(A/B/C)

+

RAL(A/B)

+

(H/K/N)RAS

+

RHOA RHOC RHOG RAP1(A/B)

+ + +

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0

0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1

1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 0 0

1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

1 1 1 1 1 1 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1

1 1 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 0 0

1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0

1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1

YDPTIEDSYR YDPTIEDSYRK YDPTIEDFYR YDPTIEDFYRK SALTLQFMYDEFVEDYEPTK SALTLQFMYDEFVEDYEPTKADSYR SALTIQLIQNHFVDEYDPTIEDSYR SALTIQLIQNHFVDEYDPTIEDSYRK DQFPEVYVPTVFENYVADIEVDGK DQFPEVYVPTVFENYIADIEVDGK EYIPTVFDNYSAQSAVDGR YDPTIEDSYR YDPTIEDSYRK YDPTIEDFYR YDPTIEDFYRK SALTLQFMYDEFVEDYEPTK SALTIQLIQNHFVDEYDPTIEDSYR SALTIQLIQNHFVDEYDPTIEDSYRK DQFPEVYVPTVFENYVADIEVDGK DQFPEVYVPTVFENYIADIEVDGK EYIPTVFDNYSAQSAVDGR

GTPase

RAP2(A/B/C) RAL(A/B) (H/K/N)RAS RHOA RHOC RHOG

a Identified in at least one sample. bInjection of 0.1% TFA after purging of autosampler. cIncubation without any toxin. The qualitative results of the analysis are shown for each glucosylation-sensitive peptide of the GTPases for the different samples. The glucosylation is indicated by a “+”. The entries in the table correspond to the result of the analysis with “1” indicating identification and “0” for no identification. dGlucosylated amino acid residue is indicated in bold.

Figure 5. Relative quantification of glucosylation-specific peptides (gluc site) and unique peptides of substrate GTPases from control, gdTcdA, or rTcdA treated cells. Peptides of the GTPases (H/K/N)Ras, Ral(A/B), Rap1(A/B), Rap2(A/BC), RhoA, RhoC, and RhoG were quantified, and the ratios calculated for rTcdA/control, rTcdA/gdTcdA, and gdTcdA/control are shown. 1611



Article

Figure 6. Changes of protein abundances among functional protein groups after incubation with TcdA in comparison to control and gdTcdA. T/K = rTcdA/control (black colums), T/M = rTcdA/gdTcdA (gray columns), M/K = gdTcdA/control (white columns). (A) Glutathion S transferases GSTA1 and GSTA2. (B) Subunits of the cytochrome C oxidase COX7A2L, COX6B, COX11, COX7A2, COX4, COX5A, COX2 and COX6C. (C) Subunits of complex I of the respiratory chain, NDUFB4, NDUFA10, NDUFS2, NDUFA13, NDUFS6, NDUFB11, NDUFS3, NDUFA2, NDUFS8, NDUFA6, NDUFB8, NDUFA12, NDUFV2, NDUFS7, NDUFS4, NDUFB7 and NDUFS1. (D) Proteins involved in cell cycle control, AURKA, CDK2, CDK6 and CCNB. (E) Tight and adherence junction forming proteins, AF6, TJP1, TJP2, TJP3, CLDN2, CLDN1, CGN, OCLN, JAM1 and CAR.

compared to control cells, confirming recent quantitative proteome analyses based on the DIGE technique26 and LCMALDI-MS.27 It is also in line with previous reports applying gdTcdA to investigate possible glucosyltransferase independent effects of TcdA.44,45 After treatment with recombinant TcdA, 872 proteins exhibited a significant change in abundance (p < 0.05, foldchange >40%) compared to control and gdTcdA treatment, respectively. Three proteins were added to the group of TcdAresponsive proteins because of observations from a previous proteomic experiment based on DIGE with the same cell line and incubation times.26 In this experiment β-actin and ubiquitin were found in lower amounts after toxin treatment. Both βactin and ubiquitin had nearly similar fold-change values as

KRas) and Ral(A/B) (27%, based on RalA) (Figure 5). The glucosylation sensitive peptide of RhoB was only identified in its glucosylated form, so quantification was not possible.

■

DISCUSSION

Proteomic Changes after TcdA-Treatment

The quantitative proteome analysis provides a snapshot of the relative abundances of 5100 proteins of Caco-2 cells after 24 h of incubation with either recombinant TcdA (rTcdA), a glucosyltransferase-deficient mutant form of TcdA (gdTcdA) or without toxin (control). This analysis provides the broadest overview of proteomic changes in colonic cells after the treatment with CGT so far. No significant changes were observed after 24 h when cells were treated with gdTcdA and 1612



Article

described. Rac1 was slightly up-regulated in the former study and thus also added to the group of regulated proteins for the STRING analysis. The observed proteomic changes could be referred to wellknown and to novel effects of TcdA. An enrichment analysis based on gene ontology (GO) functional terms depicted the known effects of TcdA, which fit into the context of rearrangement of the cytoskeleton, cell rounding and loss of cell−cell and cell−matrix attachment as well as a cell-cycle arrest. Effects that have not been described so far are changes in abundance of proteins involved in glycolysis in lower and proteins involved in lipid metabolism and mitochondrial respiration in higher amounts after TcdA treatment.

Proteins known to regulate the cell cycle like aurora A kinase (r = 1/2,33, p < 0,01), cyclin dependent kinases CDK2 (r = 1/ 1,50, p < 0,014) and CDK6 (r = 1/1,80, p < 0.003) were all found in lower abundance after TcdA treatment (Figure 6D). Aurora A kinase is known to be of higher abundance during mitosis than during other phases of the cell cycle,55 which further fits to the cell cycle arrest induced by TcdA. CDK2 is essential for the G1/S-transisition,56 and CDK6 is active during mid G1 phase and normally forms a complex with cyclin D to phosphorylate other mediators of the cell cycle.57 As untreated Caco-2 cells still proliferate they consist of subpopulations in different phases of the cell-cycle with specific proteins up- or down-regulated. The change of abundance of these proteins was large enough to be detectable even after blending with the other subpopulations. Detection of cell cycle specific effects could be enhanced by using synchronized cells, e.g. by applying a thymidine block;58 however, this was not the focus of this study.

Impact of TcdA on Tight and Adherence Junctions of Caco-2 Cells

The most obvious effects of TcdA on Caco-2 cells are cell rounding, loss of tight junctions and loss of attachment to the cell culture flask. Key proteins involved in the formation of tight junctions were of significantly different abundance after TcdA treatment (Figure 6E). The tight junction proteins 1, 2, and 3 (TJP1, 2 and 3) as well as claudin 1 and 2 (CLDN1 and 2) and cingulin (CGN) were all found in lower abundance. Two other tight junction-related proteins, occludin and junctional adhesion molecule 1 (Jam1) were detected in higher abundance after TcdA treatment. Afadin (AF-6) is involved in the formation of cell−cell adherens junctions and was found in lower abundance after TcdA treatment. It has two Ras-binding domains and interacts with Rap1 while also binding to profilin, which has been shown to participate in cortical actin assembly.46 Rap1 also has been shown to regulate the Ecadherin-mediated cell−cell adhesion.47 Because Rap1 as well as Rap2 were highly glucosylated after TcdA treatment, and thus were functionally inactive, the loss of cell/matrix as well as cell/cell adhesion is obvious.

Impact of TcdA on Cholesterol Metabolism, Lipid Metabolism, and Endocytosis

Key functional proteins of lipid and cholesterol metabolism were found in higher concentrations after TcdA-treatment. Lipids and cholesterol are taken up by the cell in the form of high- or low density lipoproteins (HDL, LDL) formed with the help of apolipoproteins (Apo). They are transferred into the cytosol via HDL and LDL receptors (HDLR, LDLR). The proteins ApoA1, ApoA2, ApoB-100 and ApoE as well as the low densitity lipoprotein receptor (LDLR) were significantly up-regulated after treatment with TcdA. Highly responsive ApoA1 (r = 4.4, p < 0.005) and ApoA2 (r = 8.2, p < 5 × 10−5) are high density lipoprotein forming proteins and ApoB-100 (r = 2.5, p < 0.05) and ApoE (r = 1.8, p < 0.005) were less responsive and form LDLs. LDLR was 3.3-fold more abundant after TcdA treatment while the protein concentration of HDLR was not significantly changed. Before the lipids can be processed in the mitochondria, phospholipases cleave them, and the resulting fatty acids are activated to Acyl-CoA. The Acyl-CoA-is exchanged with carnitine, and the modified fatty acid is transported into the inner part of the mitochondrion. This is mediated by three different carnitine transferases and a carnitine/acylcarnitine translocase. The two carnitine transferases CPT1 (r = 1.4, p < 0.05) and CAT1: (r = 1.7, p < 0.005) quantified in this study as well as the carnitine/acylcarnitine translocase (r = 1.7, p < 0.01) were all of significantly higher abundance. After entering the mitochondrial matrix, several enzymes degrade the lipid in the process of β-oxidation, which provides Acetyl-CoA, FADH2 and NADH as energy rich compounds for further processing by oxidative phosphorylation by the mitochondrial respiratory chain. 33 proteins of Complex I, the largest of the five complexes involved in oxidative phosphorylation, were identified in the present study with 31 of them quantified in all three biological replicates. All of these quantified subunits were of higher abundance after TcdA treatment and 17 subunits passed the significance threshold (>40% change, p < 0.05, Figure 6C). Complex II and III subunits were also of higher abundance after TcdA treatment as well as 8 subunits of cytochrome c oxidase complex (Figure 6B). These findings clearly indicate increased oxidative processes in the mitochondria that are driven by fatty acid metabolism. Oxidative processes in the mitochondria are accompanied with the formation of reactive oxygen species (ROS) like

Impact of TcdA on the Cell Cycle

TcdB treatment induces cell cycle arrest,48 and a recent study of the transcriptome of the colonic cell line HCT-8 provides similar evidence regarding TcdA.49 A negative regulation of the cell cycle was obvious in this proteomic study as well. A significant number of proteins involved in cell cycle progression were of lower abundance after TcdA-treatment. Thymidylate synthase (r = 1/3.4, p < 0.005) as well as Thymidine kinase (r = 1/3.4, p < 0.0005), whose cellular abundance positively correlates with increased proliferation of cells,50,51 were both among the proteins with the largest decrease after TcdA treatment. Both enzymes are necessary for the de novo synthesis of dTMP, and their low abundance after TcdA treatment clearly depicts the antiproliferative effect of the toxin. Proteins associated with the GO terms “nuclear division” and “ribosome” were enriched among the down-regulated proteins. The ribosomal activity, i.e., the biosynthesis of ribosomal proteins, is typically decreased in less proliferative cells.52 There are several TcdA induced effects that result in cell cycle arrest. Generally, a breakdown of the actin cytoskeleton, which can, e.g., be introduced by inhibition of actin-polymerization with cytochalasin D,53 prevents G1/S transition. In connection with TcdA, the actin polymerization is inhibited by RhoA glucosylation with the same result of an actin cytoskeleton rearrangement. Furthermore, Cdc42, Rac and RhoA as well as KRas were glucosylated. Functional Cdc42, Rac and Rho are essential for cell cycle progression and glucosylation of these GTPases prevents signaling competence.54 1613



Article

Figure 7. Sequence similarities of small GTPases around the gluocsylation site and cladogram of the substrate GTPases. (A) Parts of the amino acid sequences of the GTPases are arranged according to their similarities. The tryptic cleavage sites K and R are highlighted in red. Some isoforms yield identical sequences for tryptic peptides that contain the glucosylation site highlighted in green. (B) Cladogram of the GTPases calculated with ClustalW2 (www.ebi.ac.uk/Tools/msa/clustalw2/).

specific m/z values in the gas-phase for fragmentation in the linear ion trap of the LTQ-Orbitrap Velos mass spectrometer. A unique way of the triplex SILAC approach with a full label switch was applied in the experiment that facilitates a further validation of glucosylated peptides of the small GTPases. The glucosylation of the GTPases can be detected by the correct assignment of fragment mass spectra to the glucosylationspecific peptides. Because of the probabilistic algorithm used by the Andromeda search engine, peptide identifications based on fragment ion spectra can be false. The significance of the identifications is enhanced by the use of high quality MS data, and three additional details of the analysis further support it. First, the occurrence of a glucosylated peptide was always accompanied by a quantitatively corresponding loss of the unmodified counterpart in all three biological replicates. Second, every glucosylated peptide eluted before its unmodified counterpart from the chromatographic column because of increased polarity. Third, all glucosylated peptides of the small GTPases were identified in the gel area that corresponded to their molecular weight.

(lipid) peroxides and H2O2. TcdA and TcdB have been shown to act on mitochondria of host cells inducing excess amounts of ROS.36,59,60 Catalase (r = 1.7, p < 5 × 10−5) and mitochondrial superoxide dismutase (SOD2; r = 1.7, p < 0.05) were found in higher abundance. SOD2 transforms superoxide, a byproduct of the mitochondrial electron transport chain, into hydrogen peroxide and oxygen, while catalase catalyzes the decomposition of hydrogen peroxide to water and oxygen. Another protein group involved in the clearance of ROS are glutathion S transferases (GST). All GSTs quantified in this study were of higher abundance after TcdA treatment; however, only for GSTA1 and GSTA2 was this change significant (Figure 6A). These two GSTs are discussed to be involved in the processing of lipid-peroxides.61 Taken together, the proteome analysis provides a detailed view of the lipid metabolic process. Key regulating enzymes were quantified all the way along the metabolic processing chain and clearly show the stimulating impact of TcdA treatment on this cellular process. While lipid metabolism seems to be enhanced after TcdA treatment, major proteins of the glycolysis were found in lower abundance after TcdA treatment. These included phosphofructokinase (PFKM), pyruvate kinase isozymes M2 (PKM2), fructose-bisphosphate aldolase A (ALDOA), 6-phosphofructo2-kinase/fructose-2,6-biphosphatase kinase 4 (PFKFB4), phosphofructo-1-kinase isozyme B (PFKL) and phosphofructo-1kinase isozyme C (PFKP). Additionally, lactate dehydrogenase that is related to glycolysis was also of lower abundance. This finding might indicate that Caco-2 cells switched from glucose to lipid metabolism after treatment with TcdA.

Novel Glucosylation Targets of TcdA

Glucosylated peptides were detected corresponding to known glucosylation sites of Ras-family GTPases that have not been accessible by in vivo analysis before except for Rap2 in a recent study by Pruitt et al.13 They identified the glucosylated peptide of Rap2(A/B/C) but did not provide any quantitative data for glucosylation. All other analyses were done in vitro using purified toxins and GTPases. In the work presented here, the direct identification and localization of the glucose modification of several GTPases was shown for the first time in protein extracts of cells treated with CGTs. However, the glucosylation sites of Rac1 and Cdc42were not detectable with the SDSPAGE/LC−MS analysis. This was most likely due to the size of the corresponding tryptic peptides, which have a length of 50 and 39 amino acids, respectively. Attempts to digest the peptides further with a second endoprotease failed. The identified glucosylated small GTPases comprise RhoA, RhoC and RhoG, and most importantly (H/K/N)Ras was identified as a TcdA target as well as Ral(A/B), Rap1 and Rap2. As indicated in Table 2, Rap2 glucosylation by TcdA from C.

SILAC-Based LC−MS Quantification of GTPase Glucosylation

The described analysis highlights the analytical power of the untargeted SILAC-based shotgun proteomics setup, as it was possible to identify the modified peptides of low abundance proteins without the need of enrichment by, e.g., pull-down techniques. The used workflow includes three stages that enhance sensitivity of detection: (i) 1D-SDS PAGE for fractionation of proteins of different molecular weight, (ii) reversed-phase HPLC for the separation of peptides of different hydrophobicity, and finally (iii) the enrichment of ions of 1614



Article

Figure 8. Intensities of proteins identified in the SILAC-based proteome analysis. Depicted are the summarized peptide intensities of indicated proteins. High abundance proteins (HSP60, KRT18, GAPDH, TUBB2C) identified as TcdA-responsive in a DIGE experiment published recently recently by Zeiser et al.28 (DHE3, EZRIN, AL1A1, DPYL2, FABP1, ACTB and FUBP1) and the small GTPases glucosylated by rTcdA are color coded in black, green, and red, respectively.

dif f icile strain VPI10463 has been detected before by ChavesOlarte et al.14 by in vitro experiments and by Pruitt et al.13 from TcdA treated cells. A glucosylation of Rap by TcdA from strain C34 has been detected by Mehlig et al.15 before.

glucosylation of 97%. The intensity of Rap2C was about 8 times higher than Rap2B and over 10-fold higher than Rap2A. Neglecting Rap2B and Rap2A, a glucosylation of 93% was calculated for Rap2C. The intensity of RalB is higher than RalA; the glucosylation however is quite low compared to the other substrates with a calculated amount of 27%.

Glucosylation of Ral(A/B), Rap1(A/B), Rap2(A/B/C) and (H/K/N)Ras by TcdA

KRas Deactivation and Affected Downstream Target Proteins

The small GTPases quantified in this study have different extents of sequence similarity at their glucosylation sites. Because some glucosylation-specific peptides are identical, it was not possible to directly quantify every single isoform separately. This was the case for Rap1 (isoforms A and B), Rap2 (isoforms A, B and C), Ras (Isoform H, K and N) and Ral (isoforms A and B) (Figure 7). Quantification should be possible if one of the isoforms is much more abundant than the others. In this case also the glucosylated peptide resulting from a tryptic digest of the main isoform would contribute to a higher extent than the other isoforms could do, even after full glucosylation. This means that the other isoforms could be neglected, and quantification should be possible. As the total copy number of each isoform in the Caco-2 cells was unknown, the abundance of the different isoforms could only be estimated by the intensity of the summarized intensities of all identified peptides of a specific isoform (Figure 8). The intensity of KRas was about 10-fold higher than HRAs and NRas, so the latter two isoforms were neglected, and thus the degree of glucosylation of KRas was calculated to be 72%. Rap1B had a 10-fold higher intensity than Rap1A and a calculated degree of

KRas is involved in many signaling pathways affecting the growth of cells and transfers signals, e.g., obtained from epidermal growth factor via its effector Raf.23 Ras activates Raf that further transfers signals to the mitogen-activated protein kinase (MAPK) cascade. Glucosylation of Ras prevents the interaction with Raf. KRas was identified to be only partially glucosylated at about 70%. KRas is located at the plasma membrane as well as in other intracellular membranes including the Golgi apparatus, endoplasmic reticulum, and mitochondria,62 and probably only one part of the whole Ras pool in the cell was accessible to the toxin leading to reduced glucosylation compared to other TcdA targets. Rap1(A/B) and Rap2(A/B/C) Glucosylation

Rap1 is involved in E-cadherin mediated cell−cell adhesion and cell junction formation.47 Rap2 exhibits 60% identity to Rap1. It is regarded as a slower form of the molecular switch of Rap1 and important for long-term effects.63 The deactivation of this GTPase can explain the loss of intracellular junctions and the partial detachment of cells. Recently, Pruitt et al.13 identified 1615



Article

purified from C. dif f icile culture supernatants. The reason for this difference remains obscure. Potentially, the natural toxins are somehow posttranslationally modified by C. dif f icile, and this step does not occur in the expression host B. megaterium. Further analyses are necessary to clarify this point. Analyses of Caco-2 protein extracts of cells incubated with TcsL revealed a glucosylation of Rap2(A/B/C), which had been observed before by Dreger et al.,6 as well as a glucosylation of Ral(A/B), which was not detected in several in vitro experiments6,17,18 but at least in one study by Boehm et al.19 This suggests that this TcsL isoform glucosylates all known substrate GTPases except for RhoA, RhoB and RhoC, which represents the same substrate spectrum as determined for TcsL from strain 6018. However, a toxin-related glucosylation of other proteins was not detected in the generated MS data set underlining the high specificity of the used CGTs

the peptide corresponding to the glucosylation site of Rap2(A/ B/C) after a Rap2 pull-down from cells incubated with TcdA. On the basis of pull-down and Western Blot experiments, they described full inactivation of Rap2 in intact cells but only minor glucosylation in vitro. In the present analysis, a far more sensitive LC−MS/MS system was used, which enabled the identification of the glucosylated peptide of Rap2(A/B/C) as well as Rap1(A/B) from the cellular extracts without the need for a selective enrichment. The MS/MS spectra were rich in yand b-fragment ions covering the whole sequence of the peptide including the glucosylation site. Pruitt et al.13 showed that Rap2A is less efficiently glucosylated in vitro than RhoA, Rac1 and Cdc42 by TcdA. After the 24 h incubation period applied in the present study, more than 90% of Rap1(A/B) and Rap2(A/B/C) were glucosylated in the Caco-2 cells, which is basically as high as for the Rho proteins.

■

Ral Glucosylation

The glucosylated peptide of Ral(A/B) was not identified in the SILAC-based shotgun proteome analysis. However, it was identified in the protein extracts of rTcdA-treated cells in the targeted label-free LC−MS analysis. As the nonglucosylated glucosylation sensitive peptide of Ral(A/B) was identified too, an indirect and rough quantification of the degree of glucosylation was about 25%. Thus, Ral(A/B) is glucosylated in Caco-2 cells by TcdA but seems to be a minor substrate.

CONCLUSION We initially conducted a high resolution proteome analysis with a broad quantitative proteome coverage including 5100 proteins. Because of the sensitivity of the analytical system and unique labeling setup, it was possible to unequivocally identify the glucosylation specific peptides of several substrate GTPases of the clostridial glucosylating toxins including the identification of the specific glucosylation sites. Importantly, our data set provides detailed information on the glucosylation events of the CGT derived from protein extracts of intact cells. The findings are highly important for the field of clostridial toxins as the cellular context neglected in previous studies very likely alters the substrate spectrum of at least Toxin A and B. By picking specific unique tryptic peptides of the GTPases identified in this analysis along with the glucosylation specific peptides, it was possible to quantify the level of glucosylation for RhoA, RhoC, RhoG directly. Because of sequence homologies of protein isoforms of Ral(A/B), Rap1(A/B), Rap2(A/B/C) and (H/K/N)Ras, glucosylation could only be estimated. The GTPases mentioned above had different extents of glucosylation, which makes any prediction of the resulting effects extremely difficult. This emphasizes the advantages of the proteomic analysis that reveals overall changes throughout the whole cellular system in an unbiased way without neglecting any potentially involved pathway. Doing so, it was possible to accurately depict the changes involved in, e.g., the lipid metabolism that seems to be one of the major unknown long-term effects in epithelial cells due to TcdA treatment. The accuracy of the proteomic data is underlined by the many known cellular effects that were observed, like the described upregulation of RhoB, the cytoskeleton rearrangement, the loss of tight and adherence junctions, and the cell cycle arrest. With the used LC−MS method tuned to highest sensitivity by using a targeted Gel-LC−MS method without any labeling, it was possible to identify the glucosylation specific peptides with a high consistency. These qualitative data were in good agreement with known targets of CGTs and provide additional evidence for the glucosylation of Rap1(A/B), Rap2(A/B/C) and (H/K/N)Ras by wild-type TcdA and TcdB with the former also glucosylating Ral(A/B) to some extent. TcsL from strain 9048 had been shown before to glucosylate Ral(A/B), which we in fact confirmed. This indicates that the difference between the variant Toxin B from strain 1470 and TcsL is the glucosylation of (H/K/N)Ras.

Glucosylation of RhoA, RhoC, and RhoG

All Rho proteins quantified showed high levels of glucosylation, with less than 5% (RhoG), 10% (RhoC) and 17% (RhoA) remaining unmodified. The majority of these particular proteins are functionally inactivated leading to the known effects on actin cytoskeleton rearrangements (cytopathic effects). RhoB Up-Regulation and Glucosylation

The c-DNA of RhoB has been shown to be highly and continuously up-regulated as an early response to TcdA treatment.35 The same effect can be seen in the present proteomic data, as RhoB is one of the most highly up-regulated proteins even after 24 h of TcdA treatment; it has a 10.1-fold higher abundance in comparison to control cells. RhoB is a tumor suppressor and typically down-regulated in malignant tissue. A missing up-regulation of RhoB under stressful conditions like treatment with anticancer agents64 and heatstress65 is typically associated with apoptosis. A prolonged incubation of colonocytes with sufficient amounts of TcdA has been shown to induce apoptosis.66 The glucosylation/ inactivation of RhoB might enhance these apoptotic processes by preventing any antiapoptotic effects of RhoB. Glucosylation Activity of TcdB and TcsL

The results of the present analysis emphasize the importance of the cellular context for understanding the effects of the clostridial toxins. There are differences between the present findings and previous experiments. As summarized in Table 3, the substrate GTPases identified for TcdBF fit exactly to the known specificity. This is also true for TcsL; however, Rap2(A/ B/C) was also found to be glucosylated. An important result of this analysis is that TcdB and TcdA both glucosylate Rap1(A/ B), Rap2(A/B/C) and (H/K/N)Ras, while TcdA additionally glucosylates Ral(A/B). Regarding the Rho family proteins, the presented data are consistent with all former studies with no new substrates identified. A different glucosylation pattern was detected for the recombinantly expressed TcdB compared to the natural toxin 1616



■

Article

(15) Mehlig, M.; Mos, M.; Braun, V.; Kalt, B.; Mahony, D. E.; et al. Variant toxin B and a functional toxin A produced by Clostridium dif f icile C34. FEMS Microbiol. Lett. 2001, 198, 171−176. (16) Genth, H.; Huelsenbeck, J.; Hartmann, B.; Hofmann, F.; Just, I.; et al. Cellular stability of Rho-GTPases glucosylated by Clostridium dif f icile toxin B. FEBS Lett. 2006, 580, 3565−3569. (17) Genth, H.; Hofmann, F.; Selzer, J.; Rex, G.; Aktories, K.; et al. Difference in protein substrate specificity between hemorrhagic toxin and lethal toxin from Clostridium sordellii. Biochem. Biophys. Res. Commun. 1996, 229, 370−374. (18) Hofmann, F.; Rex, G.; Aktories, K.; Just, I. The Ras-related protein Ral is monoglucosylated by Clostridium sordellii lethal toxin. Biochem. Biophys. Res. Commun. 1996, 227, 77−81. (19) Boehm, C.; Gibert, M.; Geny, B.; Popoff, M. R.; Rodriguez, P. Modification of epithelial cell barrier permeability and intercellular junctions by Clostridium sordellii lethal toxins. Cell. Microbiol. 2006, 8, 1070−1085. (20) Huelsenbeck, S. C.; Klose, I.; Reichenbach, M.; Huelsenbeck, J.; Genth, H. Distinct kinetics of (H/K/N)Ras glucosylation and Rac1 glucosylation catalysed by Clostridium sordellii lethal toxin. FEBS Lett. 2009, 583, 3133−3139. (21) Popoff, M. R.; Chaves-Olarte, E.; Lemichez, E.; von EichelStreiber, C.; Thelestam, M.; et al. Ras, Rap, and Rac small GTPbinding proteins are targets for Clostridium sordellii lethal toxin glucosylation. J. Biol. Chem. 1996, 271, 10217−10224. (22) Geyer, M.; Wilde, C.; Selzer, J.; Aktories, K.; Kalbitzer, H. R. Glucosylation of Ras by Clostridium sordellii lethal toxin: consequences for effector loop conformations observed by NMR spectroscopy. Biochemistry 2003, 42, 11951−11959. (23) Vetter, I. R.; Hofmann, F.; Wohlgemuth, S.; Herrmann, C.; Just, I. Structural consequences of mono-glucosylation of Ha-Ras by Clostridium sordellii lethal toxin. J. Mol. Biol. 2000, 301, 1091−1095. (24) Konstantinopoulos, P. A.; Karamouzis, M. V.; Papavassiliou, A. G. Post-translational modifications and regulation of the RAS superfamily of GTPases as anticancer targets. Nat. Rev. Drug Discovery 2007, 6, 541−555. (25) Reineke, J.; Tenzer, S.; Rupnik, M.; Koschinski, A.; Hasselmayer, O.; et al. Autocatalytic cleavage of Clostridium dif f icile toxin B. Nature 2007, 446, 415−419. (26) Zeiser, J. J.; Klodmann, J.; Braun, H. P.; Gerhard, R.; Just, I.; et al. Effects of Clostridium dif f icile Toxin A on the proteome of colonocytes studied by differential 2D electrophoresis. J. Proteomics 2011, 75, 469−479. (27) Jochim, N.; Gerhard, R.; Just, I.; Pich, A. Impact of clostridial glucosylating toxins on the proteome of colonic cells determined by isotope-coded protein labeling and LC-MALDI. Proteome Sci. 2011, 9, 48−56. (28) Teichert, M.; Tatge, H.; Schoentaube, J.; Just, I.; Gerhard, R. Application of mutated Clostridium dif f icile toxin A for determination of glucosyltransferase-dependent effects. Infect. Immun. 2006, 74, 6006−6010. (29) Ong, S. E.; Blaqoev, B.; Kratchmarova, I.; Kristensen, D. B.; Stehen, H.; et al. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol. Cell. Proteomics 2002, 1, 376−386. (30) Krivan, H. C.; Wilkins, T. D. Purification of Clostridium dif f icile toxin A by affinity chromatography on immobilized thyroglobulin. Infect. Immun. 1987, 55, 1873−1877. (31) Just, I.; Selzer, J.; Hofmann, F.; Aktories, K. Clostridium dif f icile toxin B as a probe for Rho GTPases. In Bacterial Toxins: Tools in Cell Biology and Pharmacology; Wiley: New York, 2002; Chapter 13, pp 159−168. (32) Burger, S.; Tatge, H.; Hofmann, F.; Genth, H.; Just, I. Expression of recombinant Clostridium dif f icile toxin A using the Bacillus megaterium system. Biochem. Biophys. Res. Commun. 2003, 307, 584−588. (33) Genth, H.; Just, I. Functional implications of lethal toxincatalysed glucosylation of (H/K/N)Ras and Rac1 in Clostridium sordellii-associated disease. Eur. J. Cell Biol. 2010, 90, 959−965.

ASSOCIATED CONTENT

S Supporting Information *

Supporting tables, figures, and MS spectra. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +49 511 532 2808. Fax: +49 511 532 2879. E-mail: pich. [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to Karin Agternkamp for excellent technical assistance. This work was supported by a grant from the Deutsche Forschungsgemeinschaft to A.P. and I.J. We thank Harald Genth and Ilona Schelle for providing purified clostridial glucosylating toxins.

■

REFERENCES

(1) Just, I.; Selzer, J.; Wilm, M.; Eichel-Streiber, C.; Mann, M.; et al. Glucosylation of Rho proteins by Clostridium dif f icile toxin B. Nature 1995, 375, 500−503. (2) Just, I.; Wilm, M.; Selzer, J.; Eichel-Streiber, C.; Mann, M.; et al. The enterotoxin from Clostridium dif f icile (ToxA) monoglucosylates the Rho proteins. J. Biol. Chem. 1995, 270, 13932−14001. (3) Ong, S. E.; Mann, M. A practical recipe for stable isotope labeling by amino acids in cell culture (SILAC). Nat. Protoc. 2006, 1, 2650− 2660. (4) Genth, H.; Dreger, S. C.; Huelsenbeck, J.; Just, I. Clostridium dif f icile toxins: more than mere inhibitors of Rho proteins. Int. J. Biochem. Cell Biol. 2008, 40, 592−597. (5) Chaves-Olarte, E.; Löw, P.; Freer, E.; Norlin, T.; Weidmann, M.; et al. A novel cytotoxin from Clostridium dif f icile serogroup F is a functional hybrid between two other large clostridial cytotoxins. J. Biol. Chem. 1999, 274, 11046−11052. (6) Dreger, S. C.; Schulz, F.; Huelsenbeck, J.; Gerhard, R.; Hofmann, F.; et al. Killing of rat basophilic leukemia cells by lethal toxin from Clostridium sordellii: critical role of phosphatidylinositide 3′-OH kinase/Akt signaling. Biochemistry 2009, 48, 1785−1792. (7) Lemonnier, M.; Landraud, L.; Lemichez, E. Rho GTPaseactivating bacterial toxins: from bacterial virulence regulation to eukaryotic cell biology. FEMS Microbiol. Rev. 2007, 31, 515−534. (8) Popoff, M. R.; Bouvet, P. Clostridial toxins. Future Microbiol. 2009, 4, 1021−1064. (9) Just, I.; Fritz, G.; Aktories, K.; Giry, M.; Popoff, M.; et al. Clostridium dif f icile toxin B acts on the GTP-binding protein Rho. J. Biol. Chem. 1994, 269, 10706−10712. (10) Nagahama, M.; Ohkubo, A.; Oda, M.; Kobayashi, K.; Amimoto, K.; et al. Clostridium perf ringens TpeL glycosylates the Rac and Ras subfamily proteins. Infect. Immun. 2011, 79, 905−910. (11) Just, I.; Selzer, J.; Hofmann, F.; Green, G.; Aktories, K. Inactivation of Ras by Clostridium sordellii lethal toxin-catalyzed glucosylation. J. Biol. Chem. 1996, 271, 10149−10153. (12) Busch, C.; Schömig, K.; Hofmann, F.; Aktories, K. Characterization of the catalytic domain of Clostridium novyi alpha-toxin. Infect. Immun. 2000, 68, 6378−6383. (13) Pruitt, R. N.; Chumbler, N. M.; Rutherford, S. A.; Farrow, M. A.; Friedmann, D. B.; et al. Structural determinants of the Clostridium dif f icile toxin A glucosyltransferase activity. J. Biol. Chem. 2012, 287, 8013−8020. (14) Chaves-Olarte, E.; Weidmann, M.; Eichel-Streiber, C.; Thelestam, M. Toxins A and B from Clostridium dif f icile differ with respect to enzymatic potencies, cellular substrate specificities, and surface binding to cultured cells. J. Clin. Invest. 1997, 100, 1734−1741. 1617



Article

(34) Huelsenbeck, J.; Dreger, S.; Gerhard, R.; Barth, H.; Just, I.; et al. Difference in the cytotoxic effects of toxin B from Clostridium dif f icile strain VPI 10463 and toxin B from variant Clostridium dif f icile strain 1470. Infect. Immun. 2007, 75, 801−809. (35) Gerhard, R.; Tatge, H.; Genth, H.; Thum, T.; Borlak, J.; et al. Clostridium dif f icile toxin A induces expression of the stress-induced early gene product RhoB. J. Biol. Chem. 2005, 280, 1499−1505. (36) He, D.; Hagen, S. J.; Pothoulakis, C.; Chen, M.; Medina, N. D.; et al. Clostridium dif f icile Toxin A causes early damage to mitochondria in cultured cells. Gastroenterology 2000, 119, 139−150. (37) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254. (38) Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367−1372. (39) Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R. A.; Olsen, J. V.; et al. Andromeda: a peptide search engine integrated into the MaxQuant environment. J. Proteome Res. 2008, 10, 1794−1805. (40) Huang, D. W.; Sherman, B. T.; Lempicki, R. A Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44−57. (41) Jensen, L. J.; Kuhn, M.; Stark, N.; Chaffron, S.; Creevey, C.; et al. STRING 8a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res. 2009, 37, D412− D416. (42) Smoot, M. E.; Ono, K.; Ruscheinski, J.; Wang, P. L.; Ideker, T. Cytoscape 2.8: new features for data integration and network visualization. Bioinformatics 2011, 27, 431−432. (43) Mitulović, G.; Stingl, C.; Steinmacher, I.; Hudecz, O.; Hutchins, J. R.; et al. Preventing carryover of peptides and proteins in nano LC− MS separations. Anal. Chem. 2009, 81, 5955−5960. (44) Nottrott, S.; Schoentaube, J.; Genth, H.; Just, I. Clostridium dif f icile toxin A-induced apoptosis is p53-independent but depends on glucosylation of Rho GTPases. Apoptosis 2007, 12, 1443−1453. (45) Sun, X.; He, X.; Tzipori, S.; Gerhard, R. Essential role of the glucosyltransferase activity in Clostridium dif f icile toxin-induced secretion of TNF- by macrophages. Microb. Pathog. 2009, 46, 298− 305. (46) Boettner, B.; Govek, E. E.; Cross, J.; Van Aelst, L. The junctional multidomain protein AF-6 is a binding partner of the Rap1A GTPase and associates with the actin cytoskeletal regulator profilin. Proc. Nat. Acad. Sci. U. S. A. 2000, 97, 9064−9069. (47) Price, L. S.; Hajdo-Milasinovic, A.; Zhao, J.; Zwartkruis, F. J.; Collard, J. G.; et al. Rap1 regulates E-cadherin-mediated cell-cell adhesion. J. Biol. Chem. 2004, 279, 35127−35132. (48) Ando, Y.; Yasuda, S.; Oceguera-Yanez, F.; Narumiya, S. Inactivation of Rho GTPases with Clostridium dif f icile toxin B impairs centrosomal activation of Aurora-A in G2/M transition of HeLa cells. Mol. Biol. Cell 2007, 18, 3752−3763. (49) D’Auria, K. M.; Donato, G. M.; Gray, M. C.; Kolling, G. L.; Warren, C. A.; et al. Systems analysis of the transcriptional response of human ileocecal epithelial cells to Clostridium dif f icile toxins and effects on cell cycle control. BMC Syst. Biol. 2012, 6, 2−8. (50) Pestalozzi, B. C.; McGinn, C. J.; Klinsella, T. J.; Drake, J. C.; Glennon, M. C.; et al. Increased thymidylate synthase protein levels are principally associated with proliferation but not cell cycle phase in asynchronous human cancer cells. Br. J. Cancer 1995, 71, 1151−1157. (51) Sakamoto, S.; Ebuchi, M.; Iwama, T. Relative activities of thymidylate synthetase and thymidine kinase in human mammary tumours. Anticancer Res. 1993, 13, 205−207. (52) Thomas, G. An encore for ribosome biogenesis in the control of cell proliferation. Nat. Cell Biol. 2000, 2, 71−72. (53) Casella, J. F.; Flanagan, M. D.; Lin, S. Cytochalasin D inhibits actin polymerization and induces depolymerization of actin filaments formed during platelet shape change. Nature 1981, 293, 302−305. (54) Olson, M. F.; Ashworth, A.; Hall, A. An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1. Science 1995, 269, 1270−1272.

(55) Bischoff, J. R.; Anderson, L.; Zhu, Y.; Mossie, N. Q.; Souza, B.; et al. A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J. 1998, 17, 3052−3065. (56) Yasuda, H.; Kamijo, M.; Ohba, Y. The characterization of human cdc2 kinase and CDK2. J. Pharm. Soc. Jpn. 1993, 113, 829− 846. (57) Meyerson, M.; Enders, G. H.; Wu, C. L.; Su, L. K.; Gorka, C.; et al. A family of human cdc2-related protein kinases. EMBO J. 1992, 11, 2909−2917. (58) Bootsma, D.; Budke, L.; Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidine. Exp. Cell Res. 1964, 33, 301−309. (59) He, D.; Souqioultzis, S.; Hagen, S.; Liiu, J.; Keates, S.; et al. Clostridium dif f icile toxin A triggers human colonocyte IL-8 release via mitochondrial oxygen radical generation. Gastroenterology 2002, 122, 1048−1057. (60) Matarrese, P.; Falzano, L.; Fabbri, A.; Gambardella, L.; Frank, C.; et al. Clostridium dif f icile toxin B causes apoptosis in epithelial cells by thrilling mitochondria. Involvement of ATP-sensitive mitochondrial potassium channels. J. Biol. Chem. 2007, 282, 9029−9041. (61) Yang, Y.; Chenq, J. Z.; Singhal, S. S.; Saini, M.; Pandya, U.; et al. Role of glutathione S-transferases in protection against lipid peroxidation. Overexpression of hGSTA2-2 in K562 cells protects against hydrogen peroxide-induced apoptosis and inhibits JNK and caspase 3 activation. J. Biol. Chem. 2011, 276, 19220−19230. (62) Mor, A.; Philips, M. R. Compartmentalized Ras/MAPK signaling. Annu. Rev. Immunol. 2006, 24, 771−800. (63) Ohba, Y.; Mochizuki, N.; Matsuo, K.; Yamashita, S.; Nakaya, M.; et al. Rap2 as a slowly responding molecular switch in the Rap1 signaling cascade. Mol. Cell. Biol. 2000, 20, 6074−6083. (64) Kim, B. K.; Kim, H. M.; Chung, K. S.; Kim, D. M.; Park, S. K.; et al. Upregulation of RhoB via c-Jun N-terminal kinase signaling induces apoptosis of the human gastric carcinoma NUGC-3 cells treated with NSC12618. Carcinogenesis 2011, 32, 254−261. (65) Li, Y. D.; Liu, Y. P.; Cao, D. M.; Yan, Y. M.; Hou, Y. N.; et al. Induction of small G protein RhoB by non-genotoxic stress inhibits apoptosis and activates NF-κB. J. Cell. Physiol. 2011, 226, 729−738. (66) Gerhard, R.; Nottrott, S.; Schoentaube, J.; Tatge, H.; Olling, A.; et al. Glucosylation of Rho GTPases by Clostridium dif f icile toxin A triggers apoptosis in intestinal epithelial cells. J. Med. Microbiol. 2008, 57, 765−770.

1618


Substrate Specificity of Clostridial Glucosylating Toxins and Their

Recommend Documents