Substrate Stiffness Modulates the Maturation of ... - ACS Publications

Subscriber access provided by Northern Illinois University

Article

Substrate stiffness modulates the maturation of human pluripotent stem cell derived hepatocytes Nikhil Mittal, Farah Tasnim, Cao Yue, Yinghua Qu, Derek Phan, Yukti Choudhury, Min-Han Tan, and Hanry Yu ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.6b00475 • Publication Date (Web): 22 Aug 2016 Downloaded from http://pubs.acs.org on August 31, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Biomaterials Science & Engineering is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Substrate stiffness modulates the maturation of human pluripotent stem cell derived hepatocytes Nikhil Mittal1*, Farah Tasnim1, Cao Yue1,4, Yinghua Qu1, Derek Phan1, Yukti Choudhury1, Min-Han Tan1,2, Hanry Yu1,3,4,5* 1. Institute of Bioengineering and Nanotechnology, Singapore 138669 2. National Cancer Centre Singapore, Singapore 3. Department of Physiology, Yong Loo Lin School of Medicine, National University Health System, Singapore 117597 4. Mechanobiology Institute, 10-01 T-Lab, 5A Engineering Drive, Singapore 117411 5. Singapore-MIT Alliance for Research and Technology, 1 CREATE Way, #10-01 CREATE Tower, Singapore 138602

*Contact: E-mail: [email protected]; [email protected]. Institute of Bioengineering and Nanotechnology, 31 Biopolis Way, Singapore 138669. Tel: +65 68247103. Fax: +65 64789565.

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 25

Abstract Obtaining functional hepatocytes from human pluripotent stem cells (hPSCs) holds great potential for applications in drug safety testing, as well in the field of regenerative medicine. However, developing functionally mature hPSC-derived hepatocytes (hPSC-Heps) remains a challenge. We hypothesized that the cellular microenviroment plays a vital role in the maturation of immature hepatocytes. In this study, we examined the role of mechanical stiffness, a key component of the cellular microenvironment, in the maturation of hPSC-Heps. We cultured hPSC-Heps on collagen-coated polyacrylamide hydrogels with varying elastic moduli. On softer substrates the hPSC-Heps formed compact colonies while on stiffer substrates they formed a diffuse monolayer. We observed an inverse correlation between albumin production and substrate stiffness. The expression of key cytochrome enzymes, which are expressed at higher levels in the adult liver compared to the fetal liver, also correlated inversely with substrate stiffness, while fetal markers such as Cyp3A7 and AFP showed no correlation with stiffness. Culture of hPSC-Heps on soft substrates for 12 days led to 10-30 fold increases in the expression of drug-metabolizing enzymes. These results demonstrate that substrate stiffness similar to that of the liver enables aspects of the maturation of hPSC-Heps.

Keywords: Embryonic stem cell-derived hepatocytes; maturation; stiffness; rigidity

2


Page 3 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Pluripotent stem cells (PSCs) are a renewable source for obtaining any kind of cell present in the adult organism. Indeed, PSCs offer tremendous promise for the generation of patient specific cells for drug screening 1, cell therapy 2, and the in vitro generation of transplantable tissue 3. Over the last decade the focus of the field has been on developing protocols for the directed differentiation of PSCs into specific cell types so as to be able to generate large numbers of the cell of interest, and this effort has largely met with success. Cells thus obtained could be, and to some extent are, used for a multitude of applications – from studying their biology, to testing therapies against disease 1. However, this latter application, especially, suffers from the problem that the cells obtained by differentiating PSCs typically retain an immature neonatal-like phenotype. While work from a number of laboratories has demonstrated the ability to differentiate PSCs into progenitor cells of various types, driving these cells toward a more mature adult-like phenotype remains a major challenge in the field 4. In fact, mature cells only appear to have been demonstrated for neuronal cells such as dopamine neurons 5 and motor neurons 6; and erythrocytes 7. For most cell types, including beta cells 8, cardiomyocytes 4, 9, and hepatocytes 10 differentiated cells obtained from PSCs show an immature phenotype.

Several studies have focused on developing methods for maturing hPSC-Heps. Nagamoto et al. showed that co-culture of hPSC-Heps with Swiss 3T3 fibroblast cells led to their maturation 11. Shan et al. screened 12,480 small molecules for their ability to enable the expansion of, and improve the function of primary hepatocytes and found two such molecules in the library 12. They demonstrated that the addition of these compounds to hPSC-Heps improved aspects of their maturation state 12. Avior et al. hypothesized that since liver maturation occurs postnatally, nutritionally derived cues may drive maturation. They demonstrated that vitamin K2 and lithocholic acid, a by-product of intestinal flora enable the maturation of hPSC-Heps13. Finally, several groups have demonstrated that threedimensional culture assists in the partial maturation of hPSC-Heps 14.

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 25

It is known that aspects of the cellular environment play an important role in the maturation of immature hepatocytes (in vivo) 15. The above described in vitro studies involving 3-dimensional culture or co-culture of hepatocytes with fibroblast cells also demonstrate that the cellular environment influences maturation. The cellular microenvironment can be thought of as having two primary components – a biochemical component, and a mechanical component. While the role of various biological components has been the source of extensive investigation, only over the last decade has the importance of the mechanical component in instructing cellular fate and maturity started to be explored 16. Additionally, for primary (adult/mature) hepatocytes, several studies have shown that culture on substrates with stiffness similar to that of the liver (~10 kPa) leads to maintenance of their phenotype for longer durations. You et al. 17 determined that primary rat hepatocytes cultured on more compliant heparin gels (with an elastic modulus of 11 kPa) demonstrated higher levels of albumin secretion, and retained their morphology for a longer duration of time as compared to hepatocytes cultured on stiffer heparin gels, or glass. Chen et al. 18 showed that primary rat hepatocytes maintained albumin and urea production, and Cyp1A activity, when cultured on compliant polyelectrolyte multilayers with a stiffness of around 10 kPa. Similar results were obtained for rat hepatocytes cultured on polyacrylamide substrates 19. Li et al. 20 have also demonstrated that mouse ES-derived hepatocytes produce higher levels of albumin on polyacrylamide substrates with stiffness similar to that of the liver, but the expression of detoxification enzymes was not evaluated. It remains unclear whether the maturation of human PSC-Heps can be enhanced via culture on substrates with physiological stiffness.

Based on the above results we decided to investigate the effect of substrate stiffness on the maturation of human PSC-Heps (hPSC-Heps). We observed an inverse correlation between albumin production and substrate stiffness. The expression of key adult cytochrome enzymes CYP1A2 and CYP3A4 also correlated inversely with substrate stiffness, while fetal markers such as CYP3A7 and Alphafetoprotein (AFP) showed no correlation with stiffness. Culture of hPSC-Heps on soft substrates for 12 days led to 10-30 fold increases in the expression of the cytochrome enzymes assayed, while the 4


Page 5 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


expression of AFP decreased. The resulting cells were inducible using paradigm inducers. These results demonstrate that substrate stiffness similar to that of the liver enables key aspects of the maturation of hPSC-Heps.

5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 25

Materials and Methods Cell culture and differentiation H9 hESCs and one line of iPSCs (named HT3) established from EBV-immortalized lymphoblastoid cells were maintained on matrigel-coated plastic dishes in mTeSRTM1 medium (Stemcell Technologies). IRB approval for the study was obtained from the Singhealth Centralized Institutional Review Board and the National University of Singapore. Pluripotency of the HT3 iPSCs was characterized via gene expression analysis and teratoma formation assays (manuscript under preparation). The cells were differentiated into hepatocyte-like cells using a previously published protocol 21. Briefly, the cells were treated sequentially with WNT3A and Activin A for 6 days, FGF-2 and BMP-4 for 4 days, FGF-1, FGF-4 and FGF-8 for 4 days, HGF-4 and Follistatin for 4 days, and finally, HGF-4, Follistatin and Oncostatin M (OSM) for 2 days (20 days total). The medium was changed every 2 days, and within stages only a half medium change was performed. All recombinant proteins were purchased from R&D Systems. The 20 day differentiation resulted in epitheliod cells (Figure S1). Following differentiation, the cells were dissociated into single cells using 3 sequential treatments with 2X TrypleE (Thermo Scientific) for 5 minutes each. The cells were then plated onto the substrates in HGF and OSM containing medium along with 5 µM Y-27632, a ROCK inhibitor that improved the survival of these cells. The plating density was 1-1.5x105 cells/cm2, depending on the number of cells available post-differentiation. After two days the medium used was identical to that used for days 18-20 of the differentiation described above, except that Follistatin was omitted (i.e. HGF and OSM only). For cells plated on the gels, full medium changes were performed every two days, which are equivalent to half medium changes due to the medium contained within the gel. Correspondingly, for TCPS, half medium changes were performed every other day. The cells were cultured on the substrates for 12 days with after which they were either lysed for extraction of RNA, or fixed for immunostaining.

Cell culture substrates 6


Page 7 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Polyacrylamide substrates were prepared as previously described 22. Briefly, the gels were cast in wells of a 24-well plate using 0.25% ammonium persulfate (final concentration) and 0.25% (by volume) Tetramethylethylenediamine (TEMED). 400 µl of pre-polymer was used per well. After polymerization (30 minutes), 200 µl of Sulfo-SANPAH (1 mM in 20 mM HEPES, pH 8.0) was applied to the surface of each gel and the plate was then exposed to UV light from a 30 W germicidal lamp at a distance of 6 inches for 7.5 min22. The darkened Sulfo-SANPAH solution was removed, and the gels were rinsed twice with the above HEPES buffer. Then the gels were incubated at 4ºC overnight with 400 µl of 150 µg/mL collagen I solution (bovine, Advanced Biomatrix) in 20 mM HEPES, pH 8.0. Prior to seeding cells the substrates were washed sequentially with 1.5 ml of phosphate-buffered saline, low glucose Dulbecco’s Modified Eagle’s Medium (DMEM) and hPSCHep basal culture medium for 20 minutes each. For the polystyrene control, wells were treated similarly, except that they did not contain a polyacrylamide gel.

Modulus measurements We cast gel tubes cast in glass culture tubes (6mm diameter, VWR). The tubes were cut into shorter tubes with a length of 10 mm. Elastic modulus measurements were performed using an Instrom 5868 Microtester with a ramp rate of 1 µm/s.

Hepatocyte Induction Prior to induction the full medium changes with approximately double the volume of medium (700 µl) was performed with OSM containing differentiation medium with a reduced concentration of dexamethasone (100 nM dexamethasone). These full medium changes were performed on 2 consecutive days prior to induction to reduce the concentration of the dexamethasone in the culture to 100 nM. Induction was performed with 50 µM Beta-naphthoflavone (BNF) or 20 µM rifampicin over a two day period. The medium with inducers was refreshed after 24 hours. 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 25

Gene expression analysis RNA was extracted from cells using a commercially available kit (RNeasy Plus Mini kit, Qiagen). Conversion to cDNA was performed using iScript (Bio-Rad). qPCR was performed on an Applied Biosystems 7500 Fast real time qPCR system using the FastStart Universal SYBR Green Master Mix (Roche). Primers were obtained from Genecopoeia, except for UGT1A6 (see below). Fetal liver RNA was obtained from Thermo Scientific. For primary human hepatocytes, RNA was extracted from 2 lots – HP4239 and HP4248 (Thermo Scientific). Primers for UGT1A6 were Forward:

AGGAGCCCTGTGATTTGGAG, and Reverse: CACCAGCAGCTTGTCACCTA.

Immunostaining Cells were fixed using 4% paraformaldehyde. Antibodies used were as follows: Cyp3A4 (Santa Cruz Biotechnology, Inc. sc-53850 (HL3)), Cyp1A2 (Abcam ab22717 d15 (16VII F10F12)), goat polyclonal to Human Serum Albumin (Abcam ab19182), and a rabbit polyclonal to Lamin A (Abcam ab26300).

Imaging Fluorescence images were acquired using an Olympus IV81 microscope and a Photometrics Cool Snap HQ2 camera. Confocal imaging was performed on an Olympus Fluoview FV1000 using a 60X oil-immersion objective.

Albumin and urea production

8


Page 9 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Albumin secretion was measured using a human albumin enzyme-linked immunosorbent assay (ELISA) quantitation kit (Bethyl Laboratories, Inc., Montgomery, TX, USA) as per the manufacturer’s protocol. Urea production was measured using a commercially available kit (Urea Nitrogen Direct kit, Standbio Laboratory, Boerne, TX, USA). Briefly, the supernatant from cell culture media was heated with a 2:1 mixture of acid reagent: color reagent at 90°C for 30 minutes. The reaction was stopped by cooling on ice and the optical density was measured at 520nm. All functional data was normalized to the number of cells which was quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen, Singapore).

Statistical analysis Statistical analysis was performed using two-sided t-tests. Error bars represent standard error of the mean.

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 25

Results

We differentiated H9 human embryonic stem cells (hESCs) to hepatocyte-like cells (H9-Heps) using a previously published four step protocol 21 that sequentially drives the cells through endoderm and hepatoblast fates to hepatocyte-like cells. Following the 20 day differentiation, H9-Heps were replated onto polyacrylamide substrates of varying stiffness, or tissue culture polystyrene (TCPS). Substrates were coated with collagen I using a hetero-bi-functional linker Sulfo-SANPAH as previously described 22. Chen et al.23and Bhana et al.24 have demonstrated that the collagen density obtained using this method is independent of the substrate stiffness. The elastic moduli of these substrates were measured using compression testing (Figure S2). For the rest of the manuscript we will use the following values to refer to the gels studied: 7% acrylamide: 20 kPa, 9% acrylamide: 45 kPa, 15% acrylamide: 140 kPa.

Morphology and attachment After 4-6 days of culture, we observed that on the softer substrates (20-140 kPa) the H9-Heps formed compact colonies, whereas on TCPS they formed a diffuse monolayer (Figure 1 a-d). These colonies were maintained for up to 12 days (Figure 1 e-g). For substrates with a stiffness less than 20 kPa (10 kPa or less) we obtained poor attachment of H9-Heps and hence these stiffnesses were excluded from the study (see discussion). We observed a small decrease in viability on some of the softer substrates relative to TCPS (Figure 1 i-m). However, high viability (>85% viable cells) was observed across all stiffnesses (Figure 1 i-m). To assess the 3-dimensional (3d) colony morphology we performed confocal imaging of fixed colonies stained with a nuclear dye (4',6-diamidino-2-phenylindole – DAPI). As shown in figure 2a, for 20 kPa substrates, the colonies are “pancake shaped”, with a thickness of about 2 cells layers (20 µm). This thickness is consistent across substrates. Therefore, a majority (59 ± 4%) of the cells are directly in contact with the substrate and experience the stiffness of the substrate. 10


Page 11 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Morphology and viability of H9-Heps as a function of substrate stiffness. a-d. Morphology of H9-Heps at day 6 of culture on hydrogels (a-c) or TCPS (d). e-h. Morphology of H9-Heps at day 12 of culture on hydrogels (e-g) or TCPS (h). i-l. Live-dead staining images of H9-Heps on day 12. m. Viability of H9-Heps cultured on substrates of varying stiffness. Solid lines represent p < 0.05. The scale bar represents 45 µm. Error bars represent standard error.

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 25

Figure 2. Confocal images of a DAPI-stained H9-Hep colony cultured for 12 days on a 20 kPa substrate. The top panel shows the projection along the Y axis. The Y axis is indicated in the top view. The lower panels show individual cross sections along the lines shown on the corresponding top views. 12


Page 13 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Production of urea and albumin Next we assayed the production of urea and albumin by H9-Heps. We observed that while urea production was independent of stiffness (Figure 3b), albumin production correlated inversely with stiffness (Figure 3a). Albumin production was 3.7 ± 1.0, 2.4 ± 0.9, 0.5 ± 0.1 and 0.5± 0.1 fg/cell/48 hr on substrates with moduli of 20 kPa, 45 kPa, 140 kPa and 3.106 kPa (polystyrene), respectively. I.e. albumin production was highest on the stiffness most similar to that of the human liver. Li et al. 20 observed similar results for mouse ES-derived hepatocytes i.e. that urea production was independent of stiffness whereas albumin production correlated inversely with stiffness.

Figure 3. a. Albumin production by H9-Heps cultured on substrates of varying stiffness. b. Urea production by H9-Heps cultured on substrates of varying stiffness. Solid lines represent p < 0.05. Error bars represent standard error.

Expression of detoxification enzymes, alpha-fetoprotein, and other key hepatic genes Since hepatocytes are the main cell type within which drugs are metabolized, a central application of hPSC-Heps is likely to be in the study of drugs - metabolism, interactions, and hepatotoxicity. Thus we next decided to evaluate the expression of key cytochrome enzymes involved in drug metabolism, namely CYP1A2, and CYP3A4. The expression of these enzymes is higher in the adult as compared to 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 25

the fetal liver and thus correlates with hepatocyte maturation 25 (see also Figure 5 – primary hepatocytes). For both these cytochrome enzymes, we observed an inverse correlation between their expression and the stiffness of the substrate (Figure 4 a-b). Expression of CYP3A4 was 23.8 ± 11.9, 13.6 ± 1.6, and 8.2 ± 0.8 fold higher for H9-Heps plated on substrates with moduli of 20, 45, and 140 kPa respectively, relative to H9-Heps plated on polystyrene.

Figure 4. Gene expression as a function of substrate stiffness for key hepatocyte maturation-related genes CYP1A2 (a), CYP3A4 (b), CYP3A7 (c), Alpha-fetoprotein (AFP) (d), UGT1A1 (e), and 14


Page 15 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UGT1A6 (f). Solid lines represent p < 0.05. Dotted lines represent p < 0.1. Error bars represent standard error.

CYP3A7 25b and alpha-fetoprotein (AFP) 26 are species that are more abundantly expressed in the fetal liver relative to the adult liver. For these transcripts we observed no correlation of expression with substrate stiffness (Figure 4c, d). It has been suggested that the CYP3A4/CYP3A7 ratio is a suitable indicator of maturation 27. We indeed found that this ratio correlates negatively with substrate stiffness (Figure S3), indicating that substrate stiffness similar to that of the liver additionally supports this aspect of hepatocyte maturation. Finally, we evaluated the expression of the phase II detoxification enzymes UGT1A1 and UGT1A6 whose expression correlates with hepatocyte maturation 28. We observed an inverse correlation between their expression and the stiffness of the substrate (Figure 4 ef). Expression of UGT1A6 was 14.5 ± 4.4, 7.8 ± 2.6, and 5.8 ± 0.8 fold higher for H9-Heps plated on substrates with moduli of 20, 45, and 140 kPa respectively, relative to H9-Heps plated on polystyrene. Similar results were obtained for an induced pluripotent stem cell (iPSC) line (Table S1).

Recent studies have demonstrated that one pathway by which stiffness may affect gene expression programs is via modulation of Lamin A expression at the protein level 29. We used immuno-staining to quantitate Lamin A levels in the nuclei of H9-Heps grown on polyacrylamide or polystyrene, but did not detect significant differences (Figure S4) (see discussion). We then examined the temporal changes in the expression of cytochrome enzymes in H9-Heps cultured on 20 kPa polyacrylamide substrates, which demonstrated the greatest maturation. The expression of CYP1A2 and CYP3A4 increased by 31 and 17 fold respectively, although the final values after 12 days of culture were still lower than those in primary hepatocytes (Figure 5a-b). Somewhat surprisingly, the expression of the fetal gene CYP3A7 was below even adult levels in Day 20 differentiated ES-Heps (Figure 5c). However, the abundance of this transcript also increased to a more adult-like value following the culture on the 20 kPa substrate (Figure 5c). Expression of the fetal 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 25

marker AFP decreased by ~250 fold to a more adult-like value over the culture period (Figure 5d). Finally, while the expression of the phase II enzyme UGT1A6 did not change appreciably (not shown), the expression of UGT1A1, which was undetectable immediately after differentiation (n = 5 samples), became detectable following culture on 20 kPa polyacrylamide substrates (Figure 5e). Expression of other hepatic genes was typically between 5-15% of values in PHH (Figure S5).

Figure 5. Gene expression of H9-Heps relative to fetal human liver before (Initial) and after (Final) 12 days of culture on a 20 kPa substrate for key hepatocyte maturation-related genes CYP1A2 (a), CYP3A4 (b), CYP3A7 (c), Alpha-fetoprotein (AFP) (d), and UGT1A1 (e). Also presented for comparison are values for primary human hepatocytes (Prim Hep) (n = 2). UD: Undetected. Solid lines represent p < 0.05. Error bars represent standard error.

We performed immuno-staining to confirm the presence of key cytochrome enzymes CYP1A2 and CYP3A4 in H9-Heps cultured on 20 kPa polyacrylamide substrates for 12 days (Figure 6a, b). We also 16


Page 17 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


detected albumin in these cells via immuno-staining (Figure 6c). Finally, we tested the ability of these cells to be induced upon the addition of paradigm hepatic inducers. Perhaps due to the relatively low levels of expression relative to primary hepatocytes, we were unable to detect cytochrome activity in these cells via LC/MS. However, we observed a significant 17.4-fold induction of CYP1A2 mRNA upon addition of β-naphthoflavone (BNF), and a 2.7-fold induction of CYP3A4 mRNA upon addition of rifampicin (Figure 6d).

Figure 6. Immunostaining of H9-Heps cultured on 20 kPa substrates for 12 days for CYP1A2 (a), CYP3A4 (b), and albumin (c). d. Fold induction of CYP1A2 and CYP3A4 (mRNA) upon treatment with β-naphthoflavone (BNF) and rifampicin (Rif) respectively. Error bars represent standard error.

Discussion In this study we investigated the effects of substrate stiffness on the maturation of human embryonic stem cell-derived hepatocytes. We observed that culture on substrates with a stiffness similar to that of the liver resulted in improvement of aspects of the maturity of these cells. However, on substrates with stiffness equal to that of the liver i.e. a modulus of ~10 kPa, the cells failed to attach. This may reflect an inability of the cells to adapt from the earlier differentiation stage which was performed on polystyrene. Further, we (Figure S6), and others14a, have observed that dissociation of cells results in significant down-regulation of certain hepatocyte markers. Although, similar to the results in that study, we did not observe a significant down regulation of cytochrome enzymes. In future studies it would be interesting to differentiate PSCs to hepatocytes on soft substrates from the very beginning of the differentiation process, avoiding the replating step. 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 25

With regard to determining a mechanism underlying the improved maturation, recent studies have demonstrated that one pathway by which stiffness may affect gene expression programs is via modulation of Lamin A expression at the protein level 29. We used immuno-staining to quantitate Lamin A levels in the nuclei of H9-Heps grown on polyacrylamide or polystyrene, but did not detect significant differences (Figure S4) Thus, further work is required to determine the mechanisms by which rigidity modulates this program. Mechanisms by which rigidity modulates cellular phenotype are just starting to be uncovered, and as further pathways are discovered, it would be interesting to test them in hPSC-Heps and other types of cells.The ability to generate mature somatic cells from PSCs has the potential to revolutionize the fields of personalized medicine, regenerative medicine, drug safety assessment, and drug testing. PSC-derived somatic cells, including PSC-derived hepatocytes are typically immature 10. Thus, strategies that will enable the maturation of these cells are critical for realizing the potential of these cells. Hepatocytes perform a multitude of functions. In humans, the pathways associated with these functions take between 0.5 to 12 years to achieve maturity 30, highlighting the challenge associated with obtaining mature cells in vitro. Inevitably, researchers may need to focus on maturing particular pathways depending on their application of interest. Unfortunately while a lot is known about prenatal development of organs, much less is typically known about the biology underlying postnatal development/maturation of organs. From (prenatal) developmental studies it is well established that the microenvironment of cells plays a critical role in determining their fate and maturation 15. For example, for hepatocytes, it has been suggested that oncostatin M secreted by hematopoietic cells in the developing liver leads to the maturation of hepatocytes in the late prenatal period (in mice, E12-birth) 31. Thus, it is likely that the microenvironment will also play a role in the postnatal development of cells in the body. Support for this hypothesis can be found in studies of oocyte maturation 32, and in studies of reprogramming; in one set of studies, cardiac fibroblasts were reprogrammed to cardiac myocytes using a combination of three transcription factors – Gata4, Mef2c, and Tbx5. When this reprogramming was performed in vitro the resulting cells were morphologically and electrophysiologically immature 33. In contrast, 18


Page 19 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


when this reprogramming was performed in vivo 34, the resulting cells were morphologically and electrophysiologically mature, demonstrating that the microenvironment plays a critical role in the maturation of such cells, and suggesting that the microenvironment may play a similar critical role in the maturation of other cell types.

In recent years increasing evidence has demonstrated that tissue stiffness and mechanical stimuli are key components of the cellular microenvironment 16, 35. As discussed in the introduction, culture of primary hepatocytes on substrates with an elastic modulus similar to that of the liver (~10 kPa) has shown to assist in maintaining their phenotype for a longer duration of time as compared to traditional culture on tissue culture polystyrene which has a stiffness of ~ 3 GPa 17-19. Additionally, culture on such substrates improved albumin production in mouse embryonic stem cell-derived hepatocytes 20. In this study we investigated the effects of substrate stiffness on the maturation of human embryonic stem cell-derived hepatocytes. We observed that culture on substrates with a stiffness similar to that of the liver resulted in improvement of aspects of the maturity of these cells. In particular, albumin production and the expression of key cytochrome enzymes were significantly improved via culture on such substrates. These results highlight the advantage of using more physiological substrates for obtaining mature stem cell-derived hepatocytes.

Supporting Information Figure S1. Phase contrast images of H9-Heps prior to replating onto polyacrylamide substrates. Scale bars represent 400 µm (a), and 100 µm (b).

Figure S2. Young’s modulus for the gels used in our study. Figure S3. The ratio of Cyp3A4 gene expression to Cyp3A7 gene expression for H9-Heps cultured on substrates of varying stiffness. Solid lines represent p < 0.05. Dotted lines represent p < 0.1.

19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 25

Figure S4. a & b. H9-Heps cultured on 20 kPa substrates or PS were fixed in 4% PFA and stained for Lamin A. The samples were imaged using confocal microscopy. Representative images of H9-Hep cultured for on 20 kPa substrates (a) or polystyrene (b). c. Nuclear staining intensity was quantified using ImageJ. N.S. = not significant. N = 2 biological replicates each. 20 kPa – 2053 nuclei, PS – 1356 nuclei. Figure S5. mRNA expression of HNF4A, MRP-2, AAT, and ASGPR in H9-Heps cultured on 20 kPa substrates for 12 days, relative to primary human hepatocytes. Figure S6. Gene expression in replated (green) and non-replated (blue) Heps. Table S1. Relative gene expression for HT3 iPSC-derived hepatocytes cultured on 20 kPa or 3x106 kPa (TCPS) substrates for 12 days.

20


Page 21 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Acknowledgements This work is supported in part by the Institute of Bioengineering and Nanotechnology, Biomedical Research Council, A*STAR, Joint Council Office grant IBN/13-J51002, a Janssen Grant IBN/12E32001, a NMRC grant R-185-000-294-511 and SMART BioSyM and Mechanobiology Institute of Singapore (R-714-001-003-271) funding to HYU. C.Y. is an MBI scholar. We thank Dr Ravindran Kanesvaran and Ms Tan Hui Shan of the National Cancer Centre Singapore for their contributions in coordinating administrative aspects of sample collection for iPSC preparation, and the NUHS Confocal Microscopy Unit for assistance with confocal imaging.

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 25

References 1. Engle, S. J.; Puppala, D., Integrating Human Pluripotent Stem Cells into Drug Development. Cell Stem Cell 2013, 12 (6), 669-677. 2. (a) Schulz, T. C., Concise Review: Manufacturing of Pancreatic Endoderm Cells for Clinical Trials in Type 1 Diabetes. Stem Cells Transl. Med. 2015, 4 (8), 927-931; (b) Schwartz, S. D.; Regillo, C. D.; Lam, B. L.; Eliott, D.; Rosenfeld, P. J.; Gregori, N. Z.; Hubschman, J. P.; Davis, J. L.; Heilwell, G.; Spirn, M.; Maguire, J.; Gay, R.; Bateman, J.; Ostrick, R. M.; Morris, D.; Vincent, M.; Anglade, E.; Del Priore, L. V.; Lanza, R., Human embryonic stem cell-derived retinal pigment epithelium in patients with age-related macular degeneration and Stargardt's macular dystrophy: follow-up of two openlabel phase 1/2 studies. Lancet 2015, 385 (9967), 509-516. 3. Menasche, P.; Vanneaux, V.; Hagege, A.; Bel, A.; Cholley, B.; Cacciapuoti, I.; Parouchev, A.; Benhamouda, N.; Tachdjian, G.; Tosca, L.; Trouvin, J. H.; Fabreguettes, J. R.; Bellamy, V.; Guillemain, R.; Boissel, C. S.; Tartour, E.; Desnos, M.; Larghero, J., Human embryonic stem cell-derived cardiac progenitors for severe heart failure treatment: first clinical case report. Eur. Heart J. 2015, 36 (30), 2011-2017. 4. Yang, X.; Pabon, L.; Murry, C. E., Engineering adolescence: maturation of human pluripotent stem cell-derived cardiomyocytes. Circ Res 2014, 114 (3), 511-23. 5. (a) Kim, J. H.; Auerbach, J. M.; Rodriguez-Gomez, J. A.; Velasco, I.; Gavin, D.; Lumelsky, N.; Lee, S. H.; Nguyen, J.; Sanchez-Pernaute, R.; Bankiewicz, K.; McKay, R., Dopamine neurons derived from embryonic stem cells function in an animal model of Parkinson's disease. Nature 2002, 418 (6893), 50-6; (b) Kriks, S.; Shim, J. W.; Piao, J. H.; Ganat, Y. M.; Wakeman, D. R.; Xie, Z.; Carrillo-Reid, L.; Auyeung, G.; Antonacci, C.; Buch, A.; Yang, L. C.; Beal, M. F.; Surmeier, D. J.; Kordower, J. H.; Tabar, V.; Studer, L., Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson's disease. Nature 2011, 480 (7378), 547-U177. 6. Patani, R.; Hollins, A. J.; Wishart, T. M.; Puddifoot, C. A.; Alvarez, S.; de Lera, A. R.; Wyllie, D. J. A.; Compston, D. A. S.; Pedersen, R. A.; Gillingwater, T. H.; Hardingham, G. E.; Allen, N. D.; Chandran, S., Retinoid-independent motor neurogenesis from human embryonic stem cells reveals a medial columnar ground state. Nat. Commun. 2, 10. 7. Ma, F.; Ebihara, Y.; Umeda, K.; Sakai, H.; Hanada, S.; Zhang, H.; Zaike, Y.; Tsuchida, E.; Nakahata, T.; Nakauchi, H.; Tsuji, K., Generation of functional erythrocytes from human embryonic stem cell-derived definitive hematopoiesis. Proc Natl Acad Sci U S A 2008, 105 (35), 13087-92. 8. Pagliuca, F. W.; Melton, D. A., How to make a functional β-cell. Development 2013, 140, 2472-2483. 9. Robertson, C.; Tran, D. D.; George, S. C., Concise review: maturation phases of human pluripotent stem cell-derived cardiomyocytes. Stem Cells 2013, 31 (5), 829-37. 10. (a) Baxter, M.; Withey, S.; Harrison, S.; Segeritz, C. P.; Zhang, F.; Atkinson-Dell, R.; Rowe, C.; Gerrard, D. T.; Sison-Young, R.; Jenkins, R.; Henry, J.; Berry, A. A.; Mohamet, L.; Best, M.; Fenwick, S. W.; Malik, H.; Kitteringham, N. R.; Goldring, C. E.; Hanley, K. P.; Vallier, L.; Hanley, N. A., Phenotypic and functional analyses show stem cell-derived hepatocyte-like cells better mimic fetal rather than adult hepatocytes. Journal of Hepatology 2015, 62 (3), 581-589; (b) Mann, D. A., Human induced pluripotent stem cell-derived hepatocytes for toxicology testing. Expert Opin. Drug Metab. Toxicol. 2015, 11 (1), 1-5. 11. Nagamoto, Y.; Tashiro, K.; Takayama, K.; Ohashi, K.; Kawabata, K.; Sakurai, F.; Tachibana, M.; Hayakawa, T.; Furue, M. K.; Mizuguchi, H., The promotion of hepatic maturation of human pluripotent stem cells in 3D co-culture using type I collagen and Swiss 3T3 cell sheets. Biomaterials 2012, 33 (18), 4526-34. 12. Shan, J.; Schwartz, R. E.; Ross, N. T.; Logan, D. J.; Thomas, D.; Duncan, S. A.; North, T. E.; Goessling, W.; Carpenter, A. E.; Bhatia, S. N., Identification of small molecules for human hepatocyte expansion and iPS differentiation. Nature Chemical Biology 2013, 9 (8), 514-U77. 22


Page 23 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


13. Avior, Y.; Levy, G.; Zimerman, M.; Kitsberg, D.; Schwartz, R.; Sadeh, R.; Moussaieff, A.; Cohen, M.; Itskovitz-Eldor, J.; Nahmias, Y., Microbial-derived lithocholic acid and vitamin K2 drive the metabolic maturation of pluripotent stem cells-derived and fetal hepatocytes. Hepatology 2015, 62 (1), 265-78. 14. (a) Gieseck, R. L.; Hannan, N. R. F.; Bort, R.; Hanley, N. A.; Drake, R. A. L.; Cameron, G. W. W.; Wynn, T. A.; Vallier, L., Maturation of Induced Pluripotent Stem Cell Derived Hepatocytes by 3DCulture. PLoS One 2014, 9 (1), 7; (b) Ramasamy, T. S.; Yu, J. S.; Selden, C.; Hodgson, H.; Cui, W., Application of three-dimensional culture conditions to human embryonic stem cell-derived definitive endoderm cells enhances hepatocyte differentiation and functionality. Tissue engineering. Part A 2013, 19 (3-4), 360-7; (c) Takayama, K.; Kawabata, K.; Nagamoto, Y.; Kishimoto, K.; Tashiro, K.; Sakurai, F.; Tachibana, M.; Kanda, K.; Hayakawa, T.; Furue, M. K.; Mizuguchi, H., 3D spheroid culture of hESC/hiPSC-derived hepatocyte-like cells for drug toxicity testing. Biomaterials 2013, 34 (7), 17811789; (d) Subramanian, K.; Owens, D. J.; Raju, R.; Firpo, M.; O'Brien, T. D.; Verfaillie, C. M.; Hu, W. S., Spheroid Culture for Enhanced Differentiation of Human Embryonic Stem Cells to Hepatocyte-Like Cells. Stem Cells Dev. 2014, 23 (2), 124-131. 15. Zorn, A. M., Liver development. In StemBook, Girard, L., Ed. Massachusetts General Hospital. 16. (a) Engler, A. J.; Sen, S.; Sweeney, H. L.; Discher, D. E., Matrix elasticity directs stem cell lineage specification. Cell 2006, 126 (4), 677-689; (b) Tallawi, M.; Rai, R.; Boccaccini, A. R.; Aifantis, K. E., Effect of Substrate Mechanics on Cardiomyocyte Maturation and Growth. Tissue Eng. Part B-Rev. 2015, 21 (1), 157-165. 17. You, J.; Park, S. A.; Shin, D. S.; Patel, D.; Raghunathan, V. K.; Kim, M.; Murphy, C. J.; Tae, G.; Revzin, A., Characterizing the effects of heparin gel stiffness on function of primary hepatocytes. Tissue engineering. Part A 2013, 19 (23-24), 2655-63. 18. Chen, A. A.; Khetani, S. R.; Lee, S.; Bhatia, S. N.; Van Vliet, K. J., Modulation of hepatocyte phenotype in vitro via chemomechanical tuning of polyelectrolyte multilayers. Biomaterials 2009, 30 (6), 1113-20. 19. Semler, E. J.; Lancin, P. A.; Dasgupta, A.; Moghe, P. V., Engineering hepatocellular morphogenesis and function via ligand-presenting hydrogels with graded mechanical compliance. Biotechnology and bioengineering 2005, 89 (3), 296-307. 20. Li, L.; Sharma, N.; Chippada, U.; Jiang, X.; Schloss, R.; Yarmush, M. L.; Langrana, N. A., Functional modulation of ES-derived hepatocyte lineage cells via substrate compliance alteration. Annals of biomedical engineering 2008, 36 (5), 865-76. 21. Roelandt, P.; Pauwelyn, K. A.; Sancho-Bru, P.; Subramanian, K.; Ordovas, L.; Vanuytsel, K.; Geraerts, M.; Firpo, M.; De Vos, R.; Fevery, J.; Nevens, F.; Hu, W. S.; Verfaillie, C. M., Human Embryonic and Rat Adult Stem Cells with Primitive Endoderm-Like Phenotype Can Be Fated to Definitive Endoderm, and Finally Hepatocyte-Like Cells. PLoS One 2010, 5 (8), 11. 22. Dembo, M.; Wang, Y. L., Stresses at the cell-to-substrate interface during locomotion of fibroblasts. Biophys. J. 1999, 76 (4), 2307-2316. 23. Chen, W. L.; Likhitpanichkul, M.; Ho, A.; Simmons, C. A., Integration of statistical modeling and high-content microscopy to systematically investigate cell-substrate interactions. Biomaterials 2010, 31 (9), 2489-97. 24. Bhana, B.; Iyer, R. K.; Chen, W. L.; Zhao, R.; Sider, K. L.; Likhitpanichkul, M.; Simmons, C. A.; Radisic, M., Influence of substrate stiffness on the phenotype of heart cells. Biotechnology and bioengineering 2009, 105 (6), 1148-60. 25. (a) Sonnier, M.; Cresteil, T., Delayed ontogenesis of CYP1A2 in the human liver. Eur. J. Biochem. 1998, 251 (3), 893-898; (b) Komori, M.; Nishio, K.; Kitada, M.; Shiramatsu, K.; Muroya, K.; Soma, M.; Nagashima, K.; Kamataki, T., FETUS-SPECIFIC EXPRESSION OF A FORM OF CYTOCHROMEP-450 IN HUMAN LIVERS. Biochemistry 1990, 29 (18), 4430-4433; (c) Tateishi, T.; Nakura, H.; Asoh, M.; Watanabe, M.; Tanaka, M.; Kumai, T.; Takashima, S.; Imaoka, S.; Funae, Y.; Yabusaki, Y.; Kamataki, T.; Kobayashi, S., A comparison of hepatic cytochrome P450 protein expression between infancy and postinfancy. Life Sci. 1997, 61 (26), 2567-2574. 23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 25

26. (a) Gitlin, D.; Perricelli, A.; Gitlin, G. M., Synthesis of -fetoprotein by liver, yolk sac, and gastrointestinal tract of the human conceptus. Cancer research 1972, 32 (5), 979-82; (b) Tilghman, S. M.; Belayew, A., Transcriptional control of the murine albumin/alpha-fetoprotein locus during development. Proc Natl Acad Sci U S A 1982, 79 (17), 5254-7. 27. Davila, J. C.; Xu, J. J.; Hoffmaster, K. A.; O'Brien, P. J.; Strom, S. C., Current In Vitro Models to Study Drug-Induced Liver Injury. In Hepatotoxicity: From Genomics to In Vitro and In Vivo Models, Sahu, S. C., Ed. John Wiley & Sons: 2008. 28. McCarver, D. G.; Hines, R. N., The ontogeny of human drug-metabolizing enzymes: phase II conjugation enzymes and regulatory mechanisms. The Journal of pharmacology and experimental therapeutics 2002, 300 (2), 361-6. 29. Swift, J.; Ivanovska, I. L.; Buxboim, A.; Harada, T.; Dingal, P. C.; Pinter, J.; Pajerowski, J. D.; Spinler, K. R.; Shin, J. W.; Tewari, M.; Rehfeldt, F.; Speicher, D. W.; Discher, D. E., Nuclear lamin-A scales with tissue stiffness and enhances matrix-directed differentiation. Science 2013, 341 (6149), 1240104. 30. (a) Ginsberg, G.; Hattis, D.; Sonawane, B.; Russ, A.; Banati, P.; Kozlak, M.; Smolenski, S.; Goble, R., Evaluation of child/adult pharmacokinetic differences from a database derived from the therapeutic drug literature. Toxicological sciences : an official journal of the Society of Toxicology 2002, 66 (2), 185-200; (b) Pineiro-Carrero, V. M.; Pinero, E. O., Liver. Pediatrics 2004, 113 (4), 10971106. 31. Kamiya, A.; Kinoshita, T.; Ito, Y.; Matsui, T.; Morikawa, Y.; Senba, E.; Nakashima, K.; Taga, T.; Yoshida, K.; Kishimoto, T.; Miyajima, A., Fetal liver development requires a paracrine action of oncostatin M through the gp130 signal transducer. Embo J. 1999, 18 (8), 2127-2136. 32. Matzuk, M. M.; Burns, K. H.; Viveiros, M. M.; Eppig, J. J., Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science 2002, 296 (5576), 2178-80. 33. Ieda, M.; Fu, J. D.; Delgado-Olguin, P.; Vedantham, V.; Hayashi, Y.; Bruneau, B. G.; Srivastava, D., Direct Reprogramming of Fibroblasts into Functional Cardiomyocytes by Defined Factors. Cell 2010, 142 (3), 375-386. 34. Qian, L.; Huang, Y.; Spencer, C. I.; Foley, A.; Vedantham, V.; Liu, L.; Conway, S. J.; Fu, J. D.; Srivastava, D., In vivo reprogramming of murine cardiac fibroblasts into induced cardiomyocytes. Nature 2012, 485 (7400), 593-+. 35. Nelson, C. M.; Gleghorn, J. P., Sculpting Organs: Mechanical Regulation of Tissue Development. Annu. Rev. Biomed. Eng. 2012, 14, 129-154.

24


Page 25 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC graphic

25


Substrate Stiffness Modulates the Maturation of ... - ACS Publications

Recommend Documents