Synthesis and Characterization of a Phosphate Prodrug of

Article pubs.acs.org/jnp

Synthesis and Characterization of a Phosphate Prodrug of Isoliquiritigenin Kumaraswamy Boyapelly,† Marc-André Bonin,† Hussein Traboulsi,‡ Alexandre Cloutier,‡ Samuel C. Phaneuf,† Daniel Fortin,§ André M. Cantin,†,‡ Martin V. Richter,‡ and Eric Marsault*,† †

Institut de Pharmacologie de Sherbrooke, ‡Centre de Recherche du Centre Hospitalier Universitaire de Sherbrooke, and §X-ray Crystallography Platform, Department of Chemistry, Université de Sherbrooke, 3001,12e Avenue Nord, Sherbrooke, QC, Canada S Supporting Information *

ABSTRACT: Isoliquiritigenin (1) possesses a variety of biological activities in vitro. However, its poor aqueous solubility limits its use for subsequent in vivo experimentation. In order to enable the use of 1 for in vivo studies without the use of toxic carriers or cosolvents, a phosphate prodrug strategy was implemented relying on the availability of phenol groups in the molecule. In this study, a phosphate group was added to position C-4 of 1, leading to the more water-soluble prodrug 2 and its ammonium salt 3, which possesses increased stability compared to 2. Herein are reported the synthesis, characterization, solubility, and stability of phosphate prodrug 3 in biological medium in comparison to 1, as well as new results on its anti-inflammatory properties in vivo. As designed, the solubility of prodrug 3 was superior to that of the parent natural product 1 (9.6 mg/mL as opposed to 3.9 μg/ mL). Prodrug 3 as an ammonium salt was also found to possess excellent stability as a solid and in aqueous solution, as opposed to its phosphoric acid precursor 2.

T

Furthermore, in vitro studies have demonstrated that in addition to its anti-inflammatory properties 1 inhibits neuraminidase of the influenza virus.13,14 Neuraminidase, expressed at the surface of the influenza virus, is required for viral infectivity and spread and is the target of the leading antiinfluenza drugs such as oseltamivir and zanamivir.15 In line with this, we recently reported that isoliquiritigenin and its phosphate prodrug inhibit influenza virus replication in human bronchial epithelial cells (EC50 24.7 μM) and showed that it also inhibits influenza virus-induced expression of many inflammatory cytokines in a PPARγ-dependent manner.16 A full account of the optimization, characterization, stability, and additional biological activity of this phosphate prodrug is given in the present report. In order to make isoliquiritigenin available for broader in vivo validation without the use of toxic carriers or cosolvents, it was considered necessary to find a strategy to enhance its solubility. Given the nonionic character of 1, direct salt formation to improve solubility was not an option.17 On the other hand, phosphate prodrugs typically display excellent water solubility,

he natural product isoliquiritigenin (1, Figure 1) is a chalcone-type flavonoid derived from the roots of the popular herbal medicine Glycyrrhiza spp. (licorice).1 Glycyrrhiza is a genus of about 18 accepted species in the Leguminosae family (Fabaceae). Compound 1 has been associated with a variety of biological activities, including antiinflammatory, antimicrobial, antioxidant, antitumor, hepatoprotective, and cardioprotective effects.2 Isoliquiritigenin also exhibited antineoplastic activity on various cancers including cervical, breast, colon, prostate, and other types of cancers through mechanisms such as cell cycle arrest, apoptosis, or autophagy.3−7 Isoliquiritigenin also possesses anti-inflammatory properties, associated with reduced expression of several inflammatory molecules such as prostaglandin E2 (PGE2), tumor necrosis factor-alpha (TNF-α), and inteurlekin-6 (IL-6).8,9 These effects are mainly due to decreased nuclear factor kappa B (NF-κB) activity, one of the major transcription factors responsible for cytokine production during inflammation.10 Complementarily, 1 was shown to activate important anti-inflammatory pathways such as the peroxisome proliferator-activated receptor gamma (PPARγ) pathway, the target of several nonsteroidal antiinflammatory drugs.11,12 © 2017 American Chemical Society and American Society of Pharmacognosy

Received: August 14, 2016 Published: March 2, 2017 879

DOI: 10.1021/acs.jnatprod.6b00600 J. Nat. Prod. 2017, 80, 879−886

Journal of Natural Products

Article

Figure 1. Structures of isoliquiritigenin (1), phosphate prodrug (2), and ammonium salt (3).

Figure 2. Selected examples of phosphate prodrugs of phenolic natural and synthetic products.

Scheme 1. Synthesis of Prodrug 2 by Regioselective Functionalization

chemical stability, and rapid bioconversion back to the parent drug by phosphatases.18 The formation of phosphate prodrugs has been applied to increase the aqueous solubility of a variety of molecules, including antipeoplastic phenolic natural products and their derivatives, exemplified by combretastatin A-4, stilstatin 1, etoposide, camptothecin, hystatin 1, and tafluposide (Figure 2; nonexhaustive list).18−25 Additionally, some widely prescribed drugs, such as the anesthetic propofol, have been formulated using phosphate or phosphonooxymethyl prodrugs (Figure 2). Interestingly, in the latter case, it was found that the phosphonooxymethyl prodrug of propofol was cleaved more rapidly by phosphatases in vivo than the phosphate prodrug, which oriented the present choice toward the former.18

Thus, chemical modifications of 1 were focused on the phosphonooxymethyl prodrug (hereafter referred to as a phosphate prodrug for simplicity), designed to be cleavable in vivo by phosphatases. Accordingly, the phosphate prodrug of 1 was prepared as the corresponding phosphoric acid and its ammonium salt (2 and 3, respectively, Figure 1). The water solubility of 3 is considerably higher than that of the parent compound 1, and its stability in biological media is compatible with the intended use. Our group reported recently antiinflammatory and antiviral activities of 3 in mice infected with the influenza A/Puerto Rico/8/34 H1N1 (PR8) virus. These include decreased lung inflammation and recruitment of inflammatory cells such as macrophages and neutrophils and 880



Article

observed. The use of NaH in DMSO produced a mixture of mono- and dialkylated products, along with unreacted 1 (Table 1, entry 5). Change of solvent from DMSO to dimethylformamide (DMF) and use of potassium iodide improved the proportions of the desired monoalkylated product 7 (Scheme 1). The chemical structure of 7 was confirmed by convergent chemical synthesis (Scheme 3). Furthermore, the structure of prodrug 3 was confirmed by X-ray crystallography (Figure 3, see below), which confirms the regiochemistry of substitution and indirectly the structure of its precursor 7. The tBu phosphate ester groups of 7 were then directly cleaved in acidic conditions to generate the desired phosphoric acid monoester 2 (Scheme 1). This was accomplished using trifluoroacetic acid (TFA) in CH2Cl2 to provide 2, which was purified by preparative HPLC using 0.1% TFA in water/ acetonitrile as eluents. Subsequent lyophilization delivered 2 in 43% overall yield. Analysis of 1H and 13C NMR spectra of 2 showed 16% formation of a second regioisomer with respect to 2. The latter was attributed tentatively as the 4′-isomer of 2. Since the HPLC retention times of both isomers were identical under every condition tested, efforts to purify and fully characterize this isomeric product at different stages failed. In order to improve on the purity of 2 and introduce the phosphate group regioselectively, the synthetic strategy was oriented toward the use of a 2′,4′-diprotected analogue of 1 (Scheme 2). Accordingly, Claisen−Schmidt condensation of commercially available 2,4-dimethoxyacetophenone (8) and 4hydroxybenzaldehyde (5) in the presence of aqueous KOH provided 9 in 60% yield.20 The latter was reacted subsequently with di-tert-butyl chloromethyl phosphate (6) to deliver the fully protected phosphate prodrug 10 in 63% yield. The fully protected prodrug 10 was treated with TFA in CH2Cl2 to generate phosphoric acid monoester 11. However, the final deprotection of the aromatic methyl ethers of phosphonic acid 11 to reach the desired prodrug 2 was unsuccessful, despite the use of a diversity of deprotection conditions (NaCN/DMSO, NaI/DMSO, LiCl/DMF).22,23 Under every condition, intractable mixtures were obtained. The same results were obtained using Lewis acid (BBr3) in CH2Cl2 at −78 °C.24 Deprotection studies were also performed on compound 10 under basic

concomitant reduction of viral lung viral titers and morbidity in the infected mice.16

■

RESULTS AND DISCUSSION The synthesis of 2 is depicted in Scheme 1. Initially, the target synthesis was expected to be completed by regioselective functionalization of one of the three phenol groups of 1 with the prodrug moiety, following existing methods.26 Indeed, the 4-phenol moiety of 1 was expected to be more acidic than the 4′-phenol, owing to extended electronic delocalization in the 4phenol through the α,β-unsaturated ketone. Thus, the 4-phenol group could be considered the thermodynamic site of deprotonation leading to the predominant product. Accordingly, 1 was synthesized via Claisen−Schmidt condensation of commercially available 2,4-dihydoxyacetophenone (4) and 4-hydroxybenzaldehyde (5) in the presence of aqueous potassium hydroxide.27a Subsequent regioselective coupling between 1 and di-tert-butyl chloromethyl phosphate 6 (synthesized as described by Mantyla et al.)28 yielded phosphoric ester 7 after optimization of reaction conditions (Table 1). In most cases, unreacted 1 and low conversion were Table 1. Synthesis of Phosphate Prodrug Directly from 1

entry

base

solvent

temperature

1:7:7ab

1 2 3 4 5 6

NaOH DIPEA NaH K2CO3 NaH NaH

H2O CH2Cl2 THF EtOH DMSO DMF

rt rt rt rt 0 °C−rt 0 °C−rt

complex mixture 100:0:0 87:13:0 90:10:0 35:32:23c 12:67:21d

a

7a was tentatively identified as the 4,4′-dialkylated product. bRatios determined by UPLC-MS. cOther impurities were observed. dKI was added.

Scheme 2. Attempted Synthesis of 2 from 2,4-Dimethoxyacetophenone

881



Article

Scheme 3. Synthesis of 2 via Claisen−Schmidt Condensation

Figure 3. X-ray structure of prodrug 3.

in the eluents during purification. In any case, this lack of stability was unacceptable. In order to circumvent this issue, 2 was converted into its ammonium salt 3 (Figure 1) via elution on a basic ion exchange cartridge with 35% acetonitrile/water with 0.025 M NH4HCO3 as an additive (see Experimental Section for details). Through the process, 3 was isolated as a pure substance by lyophilization, and its structure was confirmed by X-ray crystallography (Figure 3). As opposed to 2, compound 3 displayed superior stability in buffer solution (4 and −20 °C for 16 days) and as a solid at ambient temperature for 2 weeks and at −20 °C for more than 6 months. In all conditions, no erosion of purity was observed. As expected as well, the solubility of prodrug 3 in phosphatebuffered saline (PBS) buffer was determined to be 9.6 mg/mL (25 mM), which is significantly superior to the parent molecule 1, which possesses a solubility of 3.9 μg/mL (15.3 μM) (Tables 2 and 3).

conditions using Na2CO3 with LiCl and DMF, unsuccessfully (Scheme 2). Replacement of the methyl protective groups by more labile methoxymethyl and benzoyl groups did not solve the problem (data not shown). With these disappointing results, attention was focused on a Claisen−Schmidt condensation between unprotected ketone 4 and phosphate ester aldehyde 12 (Scheme 3). Accordingly, phosphate ester 12 was obtained upon coupling of di-tert-butyl chloromethyl phosphate (6) and 4-hydroxybenzaldehyde (5) in 65% yield. Subsequent Claisen−Schmidt condensation between 2,4-dihydroxyacetophenone 4 and aldehyde 12 in the presence of 10 equiv of KOH in aqueous ethanol at room temperature for 30 h produced the required compound 13, accompanied by partial cleavage of one tert-butyl group. Given that the subsequent step was the removal of both tert-butyl groups, the crude condensation product was advanced to the next step without intermediate purification, to provide phosphoric acid derivative 2 in 30% yield. The spectroscopic data of the synthesized compound 2 by both synthetic routes (Schemes 1 and 3) were identical, except for the presence of the undesired regiosomer in route 1 (see above). Overall, this new approach, although slightly lower yielding, is devoid of the undesired regioisomer and provided the desired phosphate prodrug in high purity. The chemical stability of 2 was subsequently assessed. Stability of the amorphous solid form was assessed at −20 °C, whereas stability in phosphate buffer solution (pH 7.4, 10 mM) was assessed at 4 and −20 °C for 16 days. In all cases, slow cleavage of the phosphate group was observed, accompanied by the formation of impurities. Indeed, purity decreased from 100% to 80% in the solid form at −20 °C as well as in 10 mM buffer solution at −20 °C and 60% in 4 °C buffer solution. Small amounts of cleavage were also observed during lyophilization. This lack of chemical stability was attributed tentatively to the lability of the methylene linker to the acidity of the phosphoric acid group or the presence of acid additives

Table 2. Solubility of 3 in Phosphate Buffer Solution (pH 7.4)

a

entry

weight (mg)

volume (μL)

concentration (mM)

resulta

1 2 3

3.83 3.83 3.83

100 200 400

100.00 50.00 25.00

partial partial soluble

Visual inspection.

The stability profile of prodrug 3 and parent compound 1 was then assessed in buffer, mouse plasma, and mouse lung extract (Figure S1, Supporting Information). Figure S1A indicates that prodrug 3 is stable for 24 h in PBS buffer (pH 7.4, 37 °C). The prodrug was readily converted into its parent molecule 1 in mouse lung extract with a half-life of 10.8 min (Figure S1B), and 3 was converted to 1 in plasma with a halflife of 100 min (Figure S1C). On the other hand, the parent compound 1 demonstrated excellent stability in plasma (Figure 882



Article

CCL4 expression because it has been shown to be upregulated during influenza infection and CCL4 is an important mediator involved in the recruitment of inflammatory and immune cells to the lung.35,36 An exaggerated recruitment of these immune cells in the lungs of infected individuals is thought to be a major flaw of the host response against the influenza virus, causing massive lung damage.37,38 Accordingly, expression of IL6 and CCL4 was assessed by qPCR from mRNA extracted from lung homogenates of uninfected or infected mice treated with saline buffer (PR8 + saline) or with 3 (PR8 + 3). As shown in Figure 4, expression of the pro-inflammatory cytokine interleukin-6 and the chemokine CCL4 RNA in the lungs was strongly induced on day 3 after infection of mice (PR8 + saline), as expected (Figure 4A and B, respectively). Treatment of mice with 3 significantly reduced the expression of IL6 and CCL4 and chemokines in the lungs compared with that of saline-treated mice. Indeed, the present results show an 80% reduction of the expression of IL-6 and a 62.5% reduction of the expression of CCL4 in the lungs of PR8-infected mice treated with 3 (Figure 4, PR8 + 3 versus PR8 + saline). In summary, reported herein is a phosphate prodrug of isoliquiritigenin (1), a natural product that possesses interesting biological properties, but is limited in terms of its potential applications owing to its very low solubility in biological media. Two synthetic routes to produce prodrug 3 are reported. Prodrug 3 may be easily synthesized in two steps from isoliquiritigenin (1) or three steps from simpler precursors via Claisen−Schmidt condensation. The stability of prodrug 3 as a solid or in phosphate buffer solution is excellent, and 3 is rapidly cleaved to release the desired product 1 in mouse plasma and lung extract. With the data shown herein and the favorable in vivo anti-inflammatory and anti-influenza properties, it may be anticipated that this prodrug will become a widely used tool for subsequent in vivo use of 1, enabling further understanding of its multiple biological roles in animal models of disease.

Table 3. Solubility of 1 in PBS Buffer Solution (pH 7.4)

a

entry

weight (mg)

volume (mL)

concentration (μM)

resulta

1 2 3 4 5 6 7

0.50 0.50 0.50 0.50 0.50 0.50 0.50

2 4 8 16 32 64 128

1000.00 500.00 250.00 125.00 62.50 31.25 15.27

partial partial partial partial partial partial soluble

Visual inspection.

S1D), mouse lung extract (Figure S1E), and mouse plasma (Figure S1F). Overall, these results confirmed that prodrug 3 possesses much higher solubility than 1; yet, as desired, it is rapidly converted into the active natural prodrug 1 in biological media such as mouse lung extract and mouse plasma, and it was found that 1 has an excellent stability in these media. Severe infection by influenza viruses induces excessive inflammatory responses, such as production of high levels of chemokines and cytokines. This causes lung lesions that contribute to morbidity and mortality, as observed in animals and humans.24 As indicated above, we reported previously on the antiviral and anti-inflammatory effects of 3 in mice infected with the PR8/H1N1 influenza virus.16 Herein, we expand on these results, with a focus on IL-6 and CCL4, which were recently demonstrated to be important for the host response to influenza infection. Indeed, IL-6 was recently reported to exhibit pleiotropic effects during acute lung injury with both pro- and antiinflammatory roles.29 Depending on the acute lung injury models, IL-6 had detrimental or protective effects.30,31 IL-6 has also been recently shown to reduce morbidity and mortality of mice infected with influenza virus.31 On the other hand, IL-6 plasma levels correspond to the severity of respiratory symptoms and fever in influenza-infected humans.32 In fact, the lethality of flu is attributed to the immune system overreacting to the virus. Several studies have demonstrated that exaggerated cytokine levels, which include IL-6, are detrimental to individuals during influenza infection. Importantly, IL-6 was recently proposed as a potential biomarker during severe influenza infection.33,34 The latter observation prompted us to determine the effect of treatment with 3 on IL6 lung expression. In addition, we evaluated the impact of 3 on

■

EXPERIMENTAL SECTION

General Experimental Procedures. Melting points were determined on an Elecrothermal MEL-TEMP apparatus. 1H NMR and 13C NMR spectra were recorded on a Bruker 300 spectrometer. Chemical shifts (δ) are expressed in ppm. Signal splitting patterns are described as singlet (s), broad singlet (bs), doublet (d), triplet (t),

Figure 4. Administration of 3 reduces inflammatory cytokine and chemokine gene expression in the lungs of mice infected with the PR8 influenza virus. At 3 days p.i., the lungs were harvested and homogenized in Ribozol RNA extraction reagent. RNA was extracted, and real-time PCRs were performed to quantify the gene expression of IL-6 (A) and CCL4 (B) in the lungs of mice from the different treatment groups. Data represent the nfold changes of gene expression relative to that in uninfected mice after normalization to expression of 18S rRNA for each sample. Data represent the means ± SD from three independent experiments performed with three or four mice per group (unpaired Student’s t test; ****p < 0.0001). 883



Article

EtOH (0.3 mL) and cooled to 0 °C. KOH (245 mg, 4.36 mmol, 10 equiv in 1 mL of water) was added dropwise with continuous stirring. The mixture was stirred at room temperature for 30 h and then poured into ice-cold water. The pH was carefully adjusted to 7.2 using 0.4 N HCl dropwise at 0 °C. The mixture was extracted with ethyl acetate (4 × 30 mL), dried with anhydrous sodium sulfate, and then concentrated to give 150 mg of crude product, which was used as such for the next step. The above crude product (150 mg) was dissolved in CH2Cl2 (4 mL) and cooled to 0 °C; then TFA was added dropwise (71.5 μL in 2 mL of CH2Cl2), and the mixture was stirred at room temperature for 30 min. The nonpolar layer was decanted at room temperature and washed with CH2Cl2 (8 mL) to remove the unreacted 2,4-dihydroxyacetophenone 4. The crude product was purified by preparative HPLC as described above to get light yellow colored 3 (51 mg, 30% yield for two steps). Purification and Characterization. Crude 2 was purified by reversed-phase chromatography using preparative HPLC (Waters; Autosampler 2707, Quaternary gradient module 2535, UV detector 2489, fraction collector WFCIII) equipped with an ACE5 C18 column (250 × 21.2 mm, 5 μm spherical particle size) and water + 0.1% TFA and acetonitrile as eluents. Analytical reversed-phase HPLC was conducted on an Aquity UPLC system using a BEH C18 column (2.1 × 3 mm, 1.7 μm) with a flow rate of 800 μL/min and a gradient of solvent A (water with 0.1% HCOOH) and solvent B (acetonitrile): 0 min 5% B; 0−0.2 min 5% B; 0.2−1.5 min 45% B; 1.5−1.8 min 95% B; 1.8−2.00 min 5% B and UV detection at PDA 200−400 and 356 nm where mentioned. Determination of Solubility. Compound 1 or 3 was suspended in PBS buffer (pH 7.4) (to obtain the final concentrations described in Tables 2 and 3) and sonicated for 5 min, then kept at room temperature for 30 min. It was then diluted 1:1 stepwise (see Tables 2 and 3) until a clear solution was obtained. X-ray Analysis of 3. Crystals of 3 were obtained as follows: 3 mg of 3 was dissolved in a minimal amount of methanol in a small vial. This small vial was placed open in a larger vial containing CH2Cl2, and the larger vial was capped. After 2 days of diffusion at ambient temperature, crystals of 3 were obtained. The X-ray intensity data were measured on a Bruker Apex DUO system equipped with a Cu Kα ImuS microfocus source with MX optics (λ = 1.541 86 Å). A total of 1727 frames were collected. The total exposure time was 3.84 h. The frames were integrated with the Bruker SAINT software package using a wide-frame algorithm. The integration of the data using a monoclinic unit cell yielded a total of 9002 reflections to a maximum θ angle of 71.13° (0.81 Å resolution), of which 3146 were independent (average redundancy 2.861, completeness = 97.9%, Rint = 3.23%, Rsig = 3.36%) and 2723 (86.55%) were greater than 2σ(F2). The final cell constants of a = 6.7863(4) Å, b = 8.0638(4) Å, c = 30.4462(16) Å, β = 94.159(2)°, and volume = 1661.73(15) Å3 are based on the refinement of the XYZ-centroids of 9953 reflections above 20 σ(I) with 10.96° < 2θ < 140.5°. Data were corrected for absorption effects using the multiscan method (SADABS). The ratio of minimum to maximum apparent transmission was 0.701. The calculated minimum and maximum transmission coefficients (based on crystal size) are 0.5229 and 0.9105. The structure was solved and refined using the Bruker SHELXTL software package, using the space group P1 21/n 1, with Z = 4 for the formula unit, C16H18NO8P. The final anisotropic full-matrix least-squares refinement on F2 with 307 variables converged at R1 = 4.70% for the observed data and wR2 = 13.74% for all data. The goodness-of-fit was 1.091. The largest peak in the final difference electron density synthesis was 0.714 e−/Å3, and the largest hole was −0.360 e−/Å3 with an RMS deviation of 0.059 e−/Å3. On the basis of the final model, the calculated density was 1.532 g/cm3 and F(000), 800 e−. The crystal structure of compound 3 was deposited in the Cambridge Crystallography Data Centre, with deposition number CCDC 1492569. These data may be obtained free of charge from the Cambridge Crystallographic Data Center through www.ccdc.cam.ac. uk/data_request/cif. Biology. All experiments were approved by the Institutional Animal Ethics Committee of Université de Sherbrooke, protocol no. 240-148.

quartet (q), multiplet (m), or a combination thereof. The signals of the remaining protons of the deuterated solvents served as internal standard: 1H: δ DMSO-d6 2.49 ppm, CDCl3 7.24 ppm; 13C: DMSO-d6 39.7 ppm, CDCl3 77.0 ppm. HRMS measurements were performed on an electrospray quadrupole time-of-flight (ESI-Q-TOF instrument, Bruker model Maxis 3G). m/z ratios are reported as values in atomic mass units. Mass analysis was done in the ESI mode. All reagents and solvents were reagent grade and used without further purification, unless specified otherwise. Column chromatography was carried out using silica gel (100−200 mesh) packed in glass columns. Synthesis. (E)-Di-tert-butyl((4-(3-(2,4-dihydroxyphenyl)-3-oxoprop-1-en-1-yl)phenoxy)methyl) Phosphate (7). To a mixture of 1 (250.0 mg, 0.97 mmol, 1 equiv), KI (486.5 mg, 2.90 mmol, 3 equiv), and DMF (10 mL) was added NaH (78.0 mg, 1.95 mmol, 2 equiv, 60% in mineral oil). The mixture was stirred for 15 min at room temperature and cooled to 0 °C; then di-tert-butyl chloromethyl phosphate 6 (252.0 mg, 0.97 mmol, 1 equiv) in DMF (3 mL) was added, and the reaction mixture was stirred at the same temperature for 8 h, then at room temperature for 16 h. The reaction mixture was then poured into ice (100 g) and slightly acidified with a saturated ammonium chloride solution (5 mL). A precipitate formed and was collected by filtration, washed with cold water (3 mL), and dried overnight to obtain 7 as a brown powder (400 mg), which was used in the next step without further purification. For analytical purposes, the compound was purified by preparative TLC: purity >95% by UPLC; 1 H NMR (300 MHz, CDCl3) δ 7.64−7.89 (2H, m), 7.29−7.57 (3H, m), 7.06 (2H, d, J = 8.6 Hz), 6.54−6.94 (1H, m), 6.37−6.52 (2H, m), 5.68 (1H, bs), 5.65 (2H, d, J = 12.5 Hz), 1.50 (18H, s); 13C NMR (75 MHz, CDCl3) δ 191.6, 166.6, 164.8, 158.4, 143.5, 131.7, 130.2, 129.6, 119.0, 116.4, 113.8, 108.5, 103.6, 88.5, 84.8, 84.6, 30.0, 29.9. Isoliquiritigenin Phosphate Prodrug Ammonium Salt (3). The above crude 7 (400 mg) was dissolved in CH2Cl2 (20 mL), treated with TFA (192 μL) in DCM (3 mL) at 0 °C, and stirred for 30 min at room temperature. The solvent was decanted to remove the unreacted 1 and provided crude 2, which was purified by preparative HPLC using water + 0.1% TFA and acetonitrile as eluents. The abovecollected HPLC fractions containing 2 were diluted with water and eluted through a cartridge (Silicycle Inc., SiliaSep C18, 25 g, prewashed with 0.1% of TFA in water), washed with water to neutral pH then with 0.025 M NH4HCO3 in water until pH 8, then eluted with 35% CH3CN in 0.025 M NH4HCO3 in water. The collected fractions were lyophilized to produce 3 (160 mg, 43% yield for two steps) as a light yellow powder: mp 189−191 °C; purity >98% by UPLC; 1H NMR (300 MHz, DMSO-d6) δ 8.11 (1H, d, J = 9.2 Hz, Hβ), 7.67−7.96 (4H, m, H-2,6, 6′, Hα), 7.14 (2H, d, J = 8.5 Hz, H-3,5), 6.36−6.70 (1H, m, H-3′), 6.26 (1H, d, J = 2.1 Hz, H-5′), 5.45 (2H, d, J = 9.6 Hz, O− CH2−O−); 13C NMR (DMSO-d6, 75 MHz) δ 191.3 (CO), 165.8 (C-4′), 165.6 (C-2′), 159.3 (C4), 143.4 (Cβ); 132.7 (C1), 130.7 (C-2, C6), 127.8 (Cα), 118.8 (C6′), 115.9 (C3, C5), 112.8 (C1′), 108.3 (C5′), 102.6 (C3′), 87.2 (OCH2O); ESIMS m/z 367.7; HRESIMS m/ z 365.0404 [M − H]− (calcd for C16H15O8P 365.0421). tert-Butyl((4-formylphenoxy)methyl) Phosphate (12). 4-Hydroxybenzaldehyde 5 (500 mg, 4.09 mmol, 1 equiv) was dissolved in DMF (10 mL). Then, NaH 60% in mineral oil (245 mg, 6.14 mmol, 1.5 equiv) was added, and the reaction was stirred for 30 min. Compound 6 (1.3 g, 4.5 mmol, 1.1 equiv) was then added, followed by KI (2.0 g, 12.3 mmol, 3 equiv), and the mixture was stirred at room temperature for 36 h, poured into cold water, acidified with saturated ammonium chloride solution (10 mL), extracted with CH2Cl2 (3 × 40 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude compound was purified on a short bed of silica gel using 15% EtOAc/hexanes, to afford 12 (920 mg, 65%) as a colorless oil: 1H NMR (300 MHz, CDCl3) δ 9.90 (1H, s, CHO), 7.89 (2H, d, J = 8.9 Hz, H2, H6), 7.20 (2H, d, J = 8.9 Hz, H3, H5), 5.71 (2H, d, J = 12.1 Hz, OCH2O), 1.44 (18H, s, 2×tBu); 13C NMR (75.4 MHz, CDCl3) δ 171.3 (CHO), 142.0 (C4), 112.4 (C2, C6), 111.9 (C1), 96.7 (C3, C5), 68.1 (OCH2O), 64.1 [C(CH3)3], 10.3 [C(CH3)3]. Synthesis of 3 by Claisen−Schmidt Condensation (Scheme 2). Compound 12 (150 mg, 0.44 mmol 1 equiv) and 2,4-hydroxy acetophenone 4 (80 mg, 0.52 mmol, 1.2 equiv) were dissolved in 884



■

Mouse Plasma Collection and Lung Homogenate Preparation. Mice (n = 3 per group) were euthanized by injection of Avertin (2,2,2-tribromoethanol; 720 mg/kg). Blood from C57BL/6 mice was collected by cardiac puncture. Blood was collected with a 1.5 mL syringe containing 50 μL of heparin (1000 U/mL) and transferred into a microtube. Plasma was recovered after centrifugation at 2000g, for 10 min at 4 °C. The supernatant was transferred into new microtubes and aliquoted in portions of 100 μL. Plasma samples were kept at −80 °C until the assays. Lungs were removed during mouse euthanasia and were homogenized in saline (NaCl 0.9%) on ice using a Kinematic Polytron PT 10/35 GT homogenizer (Brinkmann Instruments). Lung homogenates were centrifuged at 400g for 5 min to remove lung debris. Supernatants were transferred into microtubes and aliquoted in portions of 100 μL. Lung homogenate samples were kept at −80 °C until used. Mouse Infection and Treatment. Female C57BL/6 mice (n = 3 per group), 6−8 weeks old, were purchased from Charles River Laboratories and housed under specific pathogen-free conditions at the animal care facility of the Faculty of Medicine and Health Sciences of the Université de Sherbrooke. Mouse infections with influenza virus were carried out as previously published.18 Briefly, anesthetized mice were infected intranasally with 50 PFU of PR8 virus in 30 μL of PBS. Compound 3 was diluted in saline buffer, and mice were treated with the prodrug (10 mg/kg) by intraperitoneal (i.p.) injection. Treatment was initiated on the same day as infection (day 0) and continued daily, and the mice were sacrificed at day 3 postinfection (p.i). Real-Time PCR Analysis. For each experimental condition, total RNA was extracted from lung homogenates using Ribozol reagent according to the manufacturer’s protocol. A total of 500 ng of the resulting RNA was then reverse-transcribed using iScript reverse transcription supermix for the reverse transcriptase quantitative PCR (RTqPCR) kit (Bio-Rad). RT-PCRs were performed with the iQ SYBR green supermix (Bio-Rad). Amplification plots were generated using the Rotorgene 6000 Application software version 1.7 (Corbett Research), and fold induction (compared to uninfected mice) was calculated using the threshold cycle (2ΔΔCt) method and using 18S expression for normalization. Primer sequences for IL-6 were FW: TGATGCACTTGCAGAAAACAA and RV: GGTCTTGGTCCTTAGCCACTC. Primer sequences for CCL4 were AAACCTAACCCCGAGCAACA and RV: CCATTGGTGCTGAGAACCCT. Plasma and Lung Extract Stability Studies. Mouse (n = 3) plasma or lung extract (27 μL) and a 1 mM solution of 3 in PBS buffer (pH 7.4, 5 μL) were incubated at 37 °C for 5, 10, 15, and 20 min (for lung extract) and 40, 80, 120, 160, 200, and 240 min (for plasma). The reaction was stopped by adding 70 μL of CH3CN. After vortexing and centrifugation at 13 000 rpm for 20 min at 4 °C, the supernatant was analyzed by UPLC (λ 360 nm). To quantify the conversion of 3 to 1, a 5 mM solution (1:1 CH3CN/H2O) of Fmoc-glycine (5 μL) was added to each sample as a reference standard immediately before UPLC analysis. The percentage of remaining compound was calculated by determining the ratio between the area under the curve (AUC) of 3 and 1. The same protocol was followed for 1 by preparing a 15.3 μM solution of 1 in PBS buffer (pH 7.4) and incubating for 1, 2, 4, 6, and 8 h in both mouse plasma and lung extract.

■

Article

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: +819.821.8000, ext 72433. Fax: +1 819.564.5400. ORCID

Daniel Fortin: 0000-0002-0223-6362 Eric Marsault: 0000-0002-5305-8762 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS B.K. would like to thank Dr. A. Murza for advice regarding stability studies. Dr. R. Gagnon and Mrs A. Doucet are acknowledged for analytical support.

■

REFERENCES

(1) Shibata, S. Yakugaku zasshi: J. Pharm. Soc. Japan 2000, 120, 849− 862. (2) Peng, F.; Du, Q.; Peng, C.; Wang, N.; Tang, H.; Xie, X.; Shen, J.; Chen, J. Phytother. Res. 2015, 29, 969−977. (3) Wang, Z.; Wang, N.; Han, S.; Wang, D.; Mo, S.; Yu, L.; Huang, H.; Tsui, K.; Shen, J.; Chen, J. PLoS One 2013, 8, e68566. (4) Wu, C. P.; Ohnuma, S.; Ambudkar, S. V. Curr. Pharm. Biotechnol. 2011, 12, 609−620. (5) Yoshida, T.; Horinaka, M.; Takara, M.; Tsuchihashi, M.; Mukai, N.; Wakada, M.; Sakai, T. Environ. Health Prev. Med. 2008, 13, 281− 287. (6) Yuan, X.; Zhang, B.; Chen, N.; Chen, X. Y.; Liu, L. L.; Zheng, Q. S.; Wang, Z. P. J. Asian Nat. Prod. Res. 2012, 14, 789−798. (7) Zhang, S. W.; Zhou, S. Y.; Shao, J. C.; Qu, X. W. Chin. J. Integr. Med. 2009, 15, 168−169. (8) Zhao, H.; Zhang, X.; Chen, X.; Li, Y.; Ke, Z.; Tang, T.; Chai, H.; Guo, A. M.; Chen, H.; Yang, J. Toxicol. Appl. Pharmacol. 2014, 279, 311−321. (9) Lee, S. H.; Kim, J. Y.; Seo, G. S.; Kim, Y. C.; Sohn, D. H. Inflammation Res. 2009, 58, 257−262. (10) Kwon, H. M.; Choi, Y. J.; Choi, J. S.; Kang, S. W.; Bae, J. Y.; Kang, I. J.; Jun, J. G.; Lee, S. S.; Lim, S. S.; Kang, Y. H. Exp. Biol. Med. 2007, 232, 235−245. (11) Martin, H. Mutat. Res., Fundam. Mol. Mech. Mutagen. 2010, 690, 57−63. (12) Zhou, L.; Tang, Y. P.; Gao, L.; Fan, X. S.; Liu, C. M.; Wu, D. K. Molecules 2009, 14, 3942−3951. (13) Dao, T. T.; Nguyen, P. H.; Lee, H. S.; Kim, E.; Park, J.; Lim, S. I.; Oh, W. K. Bioorg. Med. Chem. Lett. 2011, 21, 294−298. (14) Ryu, Y. B.; Kim, J. H.; Park, S. J.; Chang, J. S.; Rho, M. C.; Bae, K. H.; Park, K. H.; Lee, W. S. Bioorg. Med. Chem. Lett. 2010, 20, 971− 974. (15) Mendel, D. B.; Sidwell, R. W. Drug Resist. Updates 1998, 1, 184− 189. (16) Traboulsi, H.; Cloutier, A.; Boyapelly, K.; Bonin, M. A.; Marsault, E.; Cantin, A. M.; Richter, M. V. Antimicrob. Agents Chemother. 2015, 59, 6317−6327. (17) Serajuddin, A. T. Adv. Drug Delivery Rev. 2007, 59, 603−616. (18) Rautio, J.; Kumpulainen, H.; Heimbach, T.; Oliyai, R.; Oh, D.; Jarvinen, T.; Savolainen, J. Nat. Rev. Drug Discovery 2008, 7, 255−270. (19) Jaroch, K.; Karolak, M.; Gorski, P.; Jaroch, A.; Krajewski, A.; Ilnicka, A.; Sloderbach, A.; Stefanski, T.; Sobiak, S. Pharmacol. Rep. 2016, 68, 1266−1275. (20) Young, S. L.; Chaplin, D. J. Expert Opin. Invest. Drugs 2004, 13, 1171−1182. (21) Witterland, A. H.; Koks, C. H.; Beijnen, J. H. Pharm. World Sci. 1996, 18, 163−170. (22) Pujol, M. D.; Romero, M.; Sanchez, I. Curr. Med. Chem.: AntiCancer Agents 2005, 5, 215−237.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jnatprod.6b00600. Crystallography coordinates, 1H and 13C NMR, UPLC, mass spectra of synthesized compounds, as well as UPLC spectra associated with stability experiments. (PDF) 885



Article

(23) Pettit, G. R.; Hoffmann, H.; McNulty, J.; Higgs, K. C.; Murphy, A.; Molloy, D. J.; Herald, D. L.; Williams, M. D.; Pettit, R. K.; Doubek, D. L.; Hooper, J. N.; Albright, L.; Schmidt, J. M.; Chapuis, J. C.; Tackett, L. P. J. Nat. Prod. 2004, 67, 506−509. (24) Pettit, G. R.; Thornhill, A.; Melody, N.; Knight, J. C. J. Nat. Prod. 2009, 72, 380−388. (25) Yaegashi, T.; Nokata, K.; Sawada, S.; Furuta, T.; Yokokura, T.; Miyasaka, T. Chem. Pharm. Bull. 1992, 40, 131−135. (26) Acerson, M. J.; Andrus, M. B. Tetrahedron Lett. 2014, 55, 757− 760. (27) Deodhar, M.; Black, D.; Kumar, N. Tetrahedron 2007, 63, 5227−5235. (28) Mäntylä, A.; Vepsäläinen, J.; Järvinen, T.; Nevalainen, T. Tetrahedron Lett. 2002, 43, 3793−3794. (29) Hunter, C. A.; Jones, S. A. Nat. Immunol. 2015, 16, 448−457. (30) Goldman, J. L.; Sammani, S.; Kempf, C.; Saadat, L.; Letsiou, E.; Wang, T.; Moreno-Vinasco, L.; Rizzo, A. N.; Fortman, J. D.; Garcia, J. G. Pulm. Circ. 2014, 4, 280−288. (31) Lauder, S. N.; Jones, E.; Smart, K.; Bloom, A.; Williams, A. S.; Hindley, J. P.; Ondondo, B.; Taylor, P. R.; Clement, M.; Fielding, C.; Godkin, A. J.; Jones, S. A.; Gallimore, A. M. Eur. J. Immunol. 2013, 43, 2613−2625. (32) Kaiser, L.; Fritz, R. S.; Straus, S. E.; Gubareva, L.; Hayden, F. G. J. Med. Virol. 2001, 64, 262−268. (33) de Brito, R. C.; Lucena-Silva, N.; Torres, L. C.; Luna, C. F.; Correia, J. B.; da Silva, G. A. BMC Pulm. Med. 2016, 16, 170−178. (34) Paquette, S. G.; Banner, D.; Zhao, Z.; Fang, Y.; Huang, S. S.; Leomicronn, A. J.; Ng, D. C.; Almansa, R.; Martin-Loeches, I.; Ramirez, P.; Socias, L.; Loza, A.; Blanco, J.; Sansonetti, P.; Rello, J.; Andaluz, D.; Shum, B.; Rubino, S.; de Lejarazu, R. O.; Tran, D.; Delogu, G.; Fadda, G.; Krajden, S.; Rubin, B. B.; Bermejo-Martin, J. F.; Kelvin, A. A.; Kelvin, D. J. PLoS One 2012, 7, e38214. (35) Bermejo-Martin, J. F.; Ortiz de Lejarazu, R.; Pumarola, T.; Rello, J.; Almansa, R.; Ramirez, P.; Martin-Loeches, I.; Varillas, D.; Gallegos, M. C.; Seron, C.; Micheloud, D.; Gomez, J. M.; Tenorio-Abreu, A.; Ramos, M. J.; Molina, M. L.; Huidobro, S.; Sanchez, E.; Gordon, M.; Fernandez, V.; Del Castillo, A.; Marcos, M. A.; Villanueva, B.; Lopez, C. J.; Rodriguez-Dominguez, M.; Galan, J. C.; Canton, R.; Lietor, A.; Rojo, S.; Eiros, J. M.; Hinojosa, C.; Gonzalez, I.; Torner, N.; Banner, D.; Leon, A.; Cuesta, P.; Rowe, T.; Kelvin, D. J. Crit. Care 2009, 13, R201. (36) de Jong, M. D.; Simmons, C. P.; Thanh, T. T.; Hien, V. M.; Smith, G. J.; Chau, T. N.; Hoang, D. M.; Chau, N. V.; Khanh, T. H.; Dong, V. C.; Qui, P. T.; Cam, B. V.; Ha do, Q.; Guan, Y.; Peiris, J. S.; Chinh, N. T.; Hien, T. T.; Farrar, J. Nat. Med. 2006, 12, 1203−1207. (37) Fukuyama, S.; Kawaoka, Y. Curr. Opin. Immunol. 2011, 23, 481− 486. (38) Teijaro, J. R. Curr. Top. Microbiol. Immunol. 2014, 386, 3−22.

886


Synthesis and Characterization of a Phosphate Prodrug of

Recommend Documents