Synthesis and Characterization of an Injectable ... - ACS Publications

Subscriber access provided by READING UNIV

Article

Synthesis and characterization of an injectable and hydrophilous expandable bone cement based on PMMA Zhao Yang, Lei Chen, Yuxin Hao, Yuan Zang, Xiong Zhao, Lei Shi, Yang Zhang, Yafei Feng, Chao Xu, Faqi Wang, Xinli Wang, Bowen Wang, Chenxin Liu, Yufei Tang, Zixiang Wu, and Wei Lei ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b12983 • Publication Date (Web): 03 Nov 2017 Downloaded from http://pubs.acs.org on November 4, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Synthesis and characterization of an injectable and hydrophilous expandable bone cement based on PMMA ※

※

※

Author names: Zhao Yang 1 ; Lei Chen 2 ; Yuxin Hao 1 ; Yuan Zang3; Xiong Zhao1; Lei Shi1; Yang Zhang1; Yafei Feng1; Chao Xu1; Faqi Wang1; Xinli Wang1; Bowen Wang1; △

△

Chenxin Liu1; Yufei Tang2 ; Zixiang Wu 1 ; Wei Lei1

△

Author affiliations: 1.

Institute of Orthopaedics, Xijing Hospital, The Fourth Military Medical University,

No. 17 Changle Xi Road, Xi’an, Shaanxi province, 710032, P.R. China. 2.

School of Materials Science and Engineering, Xi’an University of Technology, No. 5

Jinhua South Road, Xi’an, Shaanxi province, 710048, P.R. China. 3. State Key Laboratory of Proteomics, Beijing Proteome Research Center, National Center for Protein Sciences Beijing, Beijing Institute of Lifeomics, Beijing, 102206, P.R. China. ※. These authors contributed equally to this work. △. The corresponding author is Dr. Yufei Tang、Zixiang Wu and Dr. Wei Lei and other information is as following: Address: Institute of Orthopaedics, Xijing Hospital, The Fourth Military Medical University, No. 17 Changle Xi Road, Xi’an, Shaanxi province, 710032，P.R. China. E-mail: [email protected] (Yufei Tang) [email protected]（Zixiang Wu） [email protected]（Wei Lei） Tel: +86-2984771012

Fax: + 86-2984771012

Keywords: Polymethylmethacrylate, Vertebroplasty, Expandable hydrophilous bone cement, Polyacrylic acid, Polystyrene

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Polymethylmethacrylate (PMMA), the most common bone cement, has been used as graft substitutes in orthopedic surgeries such as vertebroplasty. However, undesirable minor crack in the bone-cement interface provoked by shrinkage during polymerization and high elastic modulus of conventional PMMA bone cement dramatically increase the risk of vertebral body re-fracture post-surgery. Thus, herein, a hydrophilous expandable bone cement was synthesized based on PMMA commercial cement (Mendec® Spine Resin), acrylic acid (AA), and styrene (St). The two synthesized cements (PMMA-PAA, PMMA-PAA-PSt) showed excellent volumetric swelling in vitro and cohesive bone-cement contact in rabbit femur cavity defect. The elastic modulus and compressive strength of the new cements were lower than PMMA. Furthermore, the in vitro analysis indicated that the new cements had lower cytotoxicity than PMMA, including superior proliferation and lower apoptotic rates of Sprague-Dawly rat-derived osteoblasts. Western blotting for protein expression and RT-PCR analysis of osteogenesis-specific genes was conducted on SD rat-derived osteoblasts from both PMMA and new cements films’; the results showed that new cements enhanced the expression of osteogenesis-specific genes. Scanning electron microscopy demonstrated improved morphology and attachment of osteoblast on new cement discs than the PMMA discs. Additionally, the histological morphologies of the bone-cement interface from rabbit medial femoral condyle cavity defect model revealed direct and cohesive contact with the bone in the new cement groups in contrast to a minor crack in the PMMA cement group. The sign of new bone growing into the cement has been found in the new cements after 12 weeks, thereby indicating the osteogenic capacity in vivo. In conclusion, the


Page 2 of 40

Page 3 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


synthesized hydrophilous expandable bone cements based on PMMA and polyacrylic acid (PAA) are promising candidates for vertebroplasty. 1. Introduction Polymethyl methacrylate (PMMA) has been used in joint replacement surgeries for over 50 years

1,2

and is now commonly applied as a cement for percutaneous

vertebroplasty (PVP) and percutaneous kyphoplasty (PKP), which are the most effective approaches of osteoporotic vertebral compression fractures (OVCF).The aim of PMMA implantation in PVP and PKP is to fill the space and play a supporting role. In addition, PMMA can achieve pain relief and stability for the fracture site.3,4,5 However, an undesirable minor crack in the bone-cement interface provoked by shrinkage6,7,8 during polymerization of the conventional PMMA bone cement may lead to aseptic loosening and reduction in the biomechanical strength. Recently, more focus has been placed on the cement-stem interface in aseptic loosening.9 Aseptic loosening can be caused in the bone-cement-implant interface.10,11 Tan et al. showed that when PMMA cement is mixed with blood, the micro-morphology changes to the gap and void the formation in the surface structure may develop, and the shear strength was markedly reduced.12 The linear shrinkage of the cement resulted in most of the interface gaps,6,8,13 initiating damage within the cement mantle.14,15 Another defect caused by commercial PMMA bone cements is high elastic modulus.16 Polikeit et al. revealed that the elastic modulus of the osteoporotic vertebral body was 34 MPa, 804 MPa, and 670 MPa in cancellous bone, cortical bone, and endplate, respectively.17 On the other hand, Lee summarized that the elastic modulus of PMMA was at an average of 2552 MPa, which was significantly higher than that of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

osteoporotic trabecular bone.18 The clinically used PMMA cements with high elastic modulus caused marked changes in the stress transfer.19,20 The load transfer to the surrounding cancellous bone may result in continuous refracturing, while some load transfers to the adjacent vertebral endplate and causes an additional vertebral fracture.21,22 Such drawbacks of PMMA dramatically increase the risk of vertebral body re-fracture after vertebroplasty that limits its efficacy. In order to address these problems, various methods of PMMA modification or improvement have been reported. Improving the porosity of PMMA by blending with other biomaterials is an effective method. Tai et al. showed that Young's modulus and compression strength of PMMA were notably reduced with increasing porosity when modified by combining with castor oil.23 Other porogenic agents such as sodium hyaluronate24 and gelatin25 have also been identified. In addition, polymers such as calcium phosphate cement26 with relatively poor strength was utilized to manufacture the composite PMMA bone cement. These newly synthesized cements exhibited rather optimal mechanical properties. A similar outcome was reported by Persson et al. who developed a low-modulus bone cement, which was based on PMMA cements and oligo trimethylene carbonate.27 Reportedly, the copolymer [poly(methyl methacrylate-acrylic acid allyl methacrylate) or poly (MMA-AA-AMA)] exhibited the capacity for absorbing body fluids and swelling to compensate for shrinkage.28 Moreover, the copolymerization with MMA:AA:AMA formed a roughened surface, which improved the fracture toughness and promoted osteogenesis at the interface of copolymer and bone.29 All these properties indicate that the copolymer might provide a “bridge” to optimize the commercial PMMA cement for


Page 4 of 40

Page 5 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


orthopedic surgery. As a superabsorbent polyelectrolyte, polyacrylic acid (PAA) comprises of abundant intramolecular hydrophilic groups. In addition, PAA has been widely used in tissue engineering for owing to its little antigenic reaction in vivo.30,31 Nevertheless, the studies focus primarily on the mechanical properties of bone cement, since the inadequate mechanical properties of PAA should not be ignored. These are caused by the increased hydrophilicity as compared to neutral materials, and the plasticizing of the solid phase results by the interstitial fluid in vivo.32,33 With respect to the clinical application, changing the expansion performance of the bone cement necessitates intense focus. Polystyrene (PSt) has a wide range of applications due to its favorable mechanical performance and adequate chemical inertness that can improve the strength of the polymer.34,35 Uemura et al. revealed that homopolymerization of PSt and poly(methyl methacrylate) (PMMA) could be successfully obtained from their monomers.36 The present study aims to address the issues of volume shrinkage of the PMMA bone cement by adding the copolymers (PMMA-PAA or PMMA-PAA-PSt) that consist of sufficient hydrophilic groups. PMMA-PAA has been selected as the additive in the initial situation into the solid phase mainly because the acrylic acid (AA) possesses a hydrophilic group which renders the copolymer capable of water absorption and swelling. Moreover, based on the favorable mechanical strength, the PMMA-PAA-PSt copolymer exhibit excellent water absorption and swelling. In this study, we synthesized hydrophilous expandable bone cements based on PMMA commercial cement, AA, and styrene (St). A new copolymer (PMMA-PAA, PMMA-PAA-PSt) was obtained by the radical polymerization method of processing the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

monomer of methyl methacrylate (MMA), AA, and St. Four major aspects have been compared between the new cements and PMMA commercial cement: physical properties, especially the differences in the in vitro volume change, the variation in mechanical capacity, including elastic modulus and compressive strength; the differences in biocompatibility with Sprague-Dawly rat-derived osteoblasts and the expression of osteogenesis-specific genes on different cements, and the injection of cements in the rabbit medial femoral condyle cavity defect model to analyze the different bone-cement interfaces and osteogenic capacities. Therefore, the newly synthesized cements were evaluated for bone tissue engineering and OVCF therapeutic applications. 2. Materials and Methods 2.1 Materials MMA, St, and AA were purchased from the Tianjin Fuchen Chemical Reagents Co., Ltd. (Tianjin, China) in a monomeric form and distilled under reduced pressure before use. Polyvinyl pyrrolidone (PVP) (Mw=1,300,000, Sigma-Aldrich, Shanghai, China) was used as a dispersing agent, the initiator 2,2′-azobisisobutyronitrile (AIBN) without further purification was purchased from Adamas Reagent Co., Ltd, Shanghai, China. N,N'-Methylenebis(acrylamide) (MBA) (Tianjin Fuchen Chemical Reagents Co., Ltd, China) was used as a crosslinking agent. Mendec® Spine Resin and Kit (Via Andrea Doria 6, 37066Sommacampagna-Vernoa, Italy) was purchased from Tecres S.P.A. Trichloromethane and n-hexane (Tianjin Kermel Chemical Reagents Co., Ltd, Tianjin, China) were used for the purification of the copolymer. 2.1.1. Measurements and characterization 1

H NMR spectra was recorded using a Bruker AV-400 (400 MHz for 1H) spectrometer


Page 6 of 40

Page 7 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in CDCl3 at 25 °C. Chemical shifts are reported in ppm using CDCl3 (7.26 ppm) for 1H NMR. The molecular weight of the copolymer was determined by gel permeation chromatography (GPC) on a Waters 410 instrument. The monodispersed PSt was used as the standard, and tetrahydrofuran (THF) was used as the eluent. 2.1.2. Synthesis of the PMMA-PAA copolymer The monomeric MMA (20.00 g, 0.20 mol) and AA (14.40 g, 0.20 mol) were placed in a three-necked flask under nitrogen, followed by the addition of the dispersing agent PVP [3.10 g, 9.00% weight (wt), solubilized in deionized water), crosslinking agent MBA (2.70 g, 8.00% wt, solubilized in deionized water), and the initiator AIBN (0.69 g, 2.00% wt, dissolved in anhydrous ethanol). The solution (deionized water: anhydrous ethanol=4:1) was mixed at room temperature for 5 min before placing it in a water bath at 70 °C for 3 h; subsequently, the crude copolymer was obtained. This copolymer was purified by solubilizing in the trichloromethane, precipitated in the n-hexane, and lyophilized. 2.1.3. Synthesis of the PMMA-PAA-PSt copolymer The monomeric MMA (20.00 g, 0.20 mol), St (20.80 g, 0.20 mol), and AA (14.40 g,0.20 mol) were placed in a three-necked flask under nitrogen, and then the dispersing agent PVP (4.42 g, 8.00% wt, dissolved in deionized water), crosslinking agent MBA (5.52 g, 10.00% wt, dissolved in deionized water), and the initiator AIBN (1.11 g, 2.00% wt, dissolved in the anhydrous ethanol) were added. The solution (deionized water: anhydrous ethanol=4:1) was stirred at room temperature for 5 min before placing it in a water bath at 70 °C for 3 h. Subsequently, the crude copolymer obtained was purified by solubilizing in trichloromethane, precipitating in the n-hexane, and lyophilized.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2.1.4. Synthesis of the injectable and expandable bone cement The solid component of the injectable and expandable bone cement contains PMMA-PAA or PMMA-PAA-PSt copolymer and commercial bone cement powder (Mendec® Spine Resin). Two parts of the solid component were mixed at the volume ratio 1:1, the liquid component was the commercial bone cement (Mendec® Spine Resin) liquid. The injectable and expandable bone cement was prepared by adding the liquid component to the solid component, followed by manual mixing in the Teflon mould under ambient conditions (22 ± 1 °C) and relative humidity ≥40% using a commercial HiVac Vacuum Mixing System (Summit Medical Ltd., UK) under a reduced pressure of 76±0.1 kPa and injected until the bone cement reached the dough stage. After curing at 37 °C and under saturated humid air condition for 10–30 min, the injectable and expandable bone cements with the hydrophilous copolymer PMMA-PAA or PMMA-PAA-PSt were obtained. 2.2 Characterization of the cements 2.2.1. Water uptake and volume expansion ratios in simulated body fluid (SBF) Cement samples were immersed in SBF(at 37 °C for 1 h. To determine the water uptake (WU),37 the sample was weighed before and after soaking in SBF. The drainage method was used to determine the change in volume expansion (VE) of the sample to avoid the effect of deionized water on the expansion performance of the sample and absorption properties. In this method, the anhydrous ethanol replaced the deionized water. Both the water uptake and volume expansion were measured at 10 min intervals. WU=[(Mi-Mo)/Mo]×100% (1) Mi pellet mass after soaking in the SBF


Page 8 of 40

Page 9 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Mo initial mass before first immersion VE=[(Vi-Vo)/Vo] ×100% (2) Vi pellet volume after soaking in the SBF Vo initial volume before first immersion 2.2.2. Curing parameters A typical thermocouple was placed at the center of a Teflon mould (diameter 10 mm, height 15 mm). The cement was poured into the mould after mixing when it reached to the dough stage. In order to exclude the variations caused by lab temperature, the mould and the two components of the cements were initially maintained at 10 °C in a cool enclosure. Each second cement temperature during curing was measured through the thermocouple connected to a dedicated device.1 According to standard ISO5833-2002, the temperature curves allow the determination of the maximum temperature (Tmax) achieved by the cement during curing and setting time (Tset). Tmax and Tset are curing parameters. Tset =

Tmax + Tamb 2

Tamb: the ambient temperature Tmax: the maximum temperature Tset: average of maximum temperature and ambient temperature

2.2.3. Mechanical compression testing The compression strength and modulus of the cement were determined by ISO5833 on the cylindrical specimens 12.0 ± 0.1 mm length and 6.0 ± 0.1 mm diameter. The specimens were polished by sandpaper of 1000 mesh in order to guarantee that the two surfaces were completely parallel before the test. Compressive loading using the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

computer control material testing machine (BOSE, USA) operated at a crosshead speed of 0.6 mm/min until specimen failure. The compression strength (CS) was calculated from the obtained load-deformation curves with the following equations: CS=F/A, where F is the applied load (N) at the highest point of the load-deflection curve and A is the cross-section area of the sample tested.

2.2.4. Fabrication of cement membrane and three-dimensional (3-D) cement discs The bone cement was made by mixing the powder and liquid components together according to the manufacturer's instructions until the dough stage was achieved. Consecutively, the cement was poured into 6-well plates coated with the release agent, and the specimens (diameter 34.8 mm, height 1 mm) were removed from the plate after solidification for subsequent cell culture experiments. The 3-D cement discs were placed in 48-well plates coated with the release agent, and the specimens (diameter 10.2 mm, height 1 mm) were obtained.

2.3 In vitro cytocompatibility analysis 2.3.1. Isolation of the primary osteoblasts and cultivation Experiments were conducted in accordance with the Chinese Legislation on Protection of Animals and the National Guidelines for the Care and Use of Laboratory Animals. Primary osteoblasts were isolated as described previously.38,39 Briefly, newborn Sprague–Dawley rats (supplied by the Fourth Military Medical University, Xi’an, China) were sacrificed, and the calvaria were isolated. After digestion with 0.25% trypsin (Sigma-Aldrich, St. Louis, USA) for 15 min and 0.1% type II collagenase (Sigma) for 30 min, small pieces of calvaria were cultured in α-modified minimum essential medium (α-MEM; Hyclone, UT, USA) containing 10% fetal bovine serum (FBS; Hyclone) and


Page 10 of 40

Page 11 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


antibiotics (10 U/mL penicillin and 10 mg/mL streptomycin) at 37 °C in a CO2 incubator. The medium was replaced every 2 days. Primary osteoblasts were obtained from trypsinized (Trypsin/EDTA, 0.05%/0.4 mM) adherent cells. Cells from passages 2–4 were used in subsequent experiments. The cells were counted by a hemocytometer and diluted to the desired density. After isolation and culture in α-MEM, the cells were observed and images acquired using an Olympus Microphoto light microscope on days 1, 3, and 7.

2.3.2. Cell proliferation assay The cement samples were sterilized by 60Co gamma-irradiation at a dose of 25 kGy. The cement extracts were obtained by incubating the samples in culture medium (0.2 g/mL) 40 at 37 °C for 48 h. Approximately, 0.3 × 104 cells were seeded in each well of 96-well plate and incubated at 37 °C in a CO2 incubator for 24 h. Subsequently, the medium was replaced with 100 µL cement extract. The cells cultured in the medium without the cement extract were used as controls. The cell proliferation was assessed using the Cell Counting Kit-8 assay (CCK-8, Dojindo Molecular Technologies, Japan) according to the manufacturer’s instructions. For growth assays, the cells were cultured in 96-well plates for 1, 4, and 7 days after the medium was replaced by cement extracts and the absorbance at 450 nm was measured on a Bio-Rad microplate reader (Bio-Rad, CA, USA).

2.3.3. Analysis of apoptosis by flow cytometry Primary osteoblasts were seeded in 6-well plates (1×106 cells/well) and incubated at 37 °C in a CO2 incubator for 24 h. Subsequently, the medium was replaced with 2 mL cement extract, and the cells were cultured for 3 days. The cells cultured in the medium



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

without cement extract were used as controls. On days 1 and 3 after medium replacement by cement extracts, the cells were trypsinized and neutralized with 6 mL FBS for 5 min. The cells were washed two times in PBS. AnnexinV/FITC Kit (Sizhengbo Products, Beijing, China) was used to analyze the viable and apoptotic cells according to the manufacturer’s instructions. The sample was analyzed on an FACScan (BD Biosciences, NJ, USA) flow cytometer.

2.3.4. Western blotting Primary osteoblasts on cement films and without cement films (controls) were seeded in 6-well plates at a density of 1×105 cells/well. The cells were collected on days 3 and 7, followed by lysis using the buffer comprising of 50 mM Tris–HCl (pH 7.5),150 mM NaCl, 0.5% sodium deoxycholate, and 1% NP-40 supplemented with complete protease inhibitors (Roche Applied Science, Mannheim, Germany). Cell lysates (30 µg) were separated by electrophoresis on 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membranes. Then, the membranes were blocked using TBST [20 mM Tris–HCl (pH 7.6), 136 mM NaCl, and 0.1% Tween-20] containing 5% skim milk, followed by incubation with primary antibody at 4 ºC overnight. Subsequently, the membranes were washed and incubated with horseradish peroxidase (HRP)-coupled with donkey anti-goat (1:2000, Bioss, Beijing, China,) at room temperature for 90 min. The immunoreactive products were visualized by enhanced chemiluminescence (ECL Kit, Thermo Scientific). The primary antibodies were as follows: ALP (Bioss, 1:1000), COL I (Abcam, MA, USA, 1:1000), Runx2 (Bioss, 1:1000), and OC (Gene Tex, CA, USA, 1:500). β-actin (Abcam, 1:1000) was used as a loading control. Goat polyclonal secondary antibody to rabbit IgG-H&L (HRP) was purchased from Abcam. The


Page 12 of 40

Page 13 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chemiluminescence was detected and quantified by a chemiluminescence imaging system (ChemiScope3600MINI, CLINX, Shanghai, China). PhotoShop（Adobe, USA, ）were used for the analysis of the signal intensities.

2.3.5. Quantitative real time PCR analysis Primary osteoblasts were seeded on cement films and without cement films (controls) in the α-MEM medium at a density of 1×105 cells/well in 6-well plates, respectively. The cells were collected at 3 and 7 days for real-time polymerase chain reaction (real time-PCR) analysis. Total RNA was extracted using TRIizol reagent (Takara, Tokyo, Japan) and cDNA was synthesized using PrimeScript RT reagent Kit (TaKaRa, Japan) according to the manufacturer’s instructions. The expressions of alkaline phosphatase (ALP), collagen I (COL I), runt-related transcription factor 2 (Runx2), and osteocalcin (OC) genes were detected by the Bio-Rad Quantitative Real time PCR system (qRT-PCR; Bio-Rad,

MyiQ,

USA).

The

housekeeping

gene

glyceraldehydes-3-phosphatedehydrogenase (GAPDH) was used as an endogenous control. The forward and reverse primer sequences are listed in Table 1.The relative level of gene expression was determined from three independent experiments using the △△ CT method to calculate the differences between the target and control CT values for each sample. The relative expression level (fold change) was obtained by transforming the △△CT

logarithmic values into absolute values using 2-

.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table 1. Primers for PCR reactions Gene ALP Collagen I Runx2 OC GAPDH

Direction Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Sequence (5’ – 3’) ATGTCTGGAACCGCACTGAAC AGCCTTTGGGATTCTTTGTCAG GGATCGACCCTAACCAAGGC GATCGGAACCTTCGCTTCCA CAGTATGAGAGTAGGTGTCCCGC AAGAGGGGTAAGACTGGTCATAGG AGGGCAGTAAGGTGGTGAATAGA GAAGCCAATGTGGTCCGCTA TTCCTACCCCCAATGTATCCG CATGAGGTCCACCACCCTGTT

2.4 Scanning electron microscopy (SEM) morphology The morphology and proliferation of primary osteoblasts on 3-D cement discs were investigated using SEM (Hitachi S-3000N, Japan). After culturing on 3-D cement discs (1 × 104 cells/disc), the cells were removed on days 1 and 3 and immediately rinsed in 0.2 M sodium cacodylate buffer. Critical drying was performed after 2.5% glutaraldehyde treatment. The specimens were coated with gold particles in a sputter coater, and the cross-sectioned discs examined using SEM at 5 kV. The 3-D cement discs without the cells were used for the observation of cement surface morphology.

2.5 Cement injection into rabbit femur with cavity defect 2.5.1. Femur cavity defect repair The experiments were conducted in accordance with the Chinese legislation on the protection of animals and the National Guidelines for the Care and Use of Laboratory Animals. The on New Zealand rabbit medial femoral condyle cavity defect model was used to investigate the efficacy of PMMA and new expandable bone cement in filling the defect and promoting repair. Briefly, 27 male New Zealand rabbits (supplied by the


Page 14 of 40

Page 15 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fourth Military Medical University, Xi’an, China, weight 2.0–2.5 kg) were anesthetized by intramuscular injection of sodium pentobarbital (0.02 g/kg, Sigma, USA). Then, a Ø5×10 mm defect was made in a perpendicular orientation to the longitudinal and coronal axes of the medial femoral condyle of the right femur of each rabbit using a 5-mm diameter trephine bur (Boshi, China). Critical-sized calvarial defects were generated in 27 rabbits, and the PMMA, PMMA-PAA, and PMMA-PAA-PSt cements were injected into the cavities randomly: PMMA group (n=9), PMMA-PAA group (n=9), and PMMA-PAA-PSt group (n=9). At post-injection weeks 1, 4, and 12, the rabbits were sacrificed, and the right femur with the cement was harvested.

2.5.2. Radiographic examination A radiographic examination consisting of the lateral side of the right femur of each rabbit was carried out after 1 week of cement injection using a Philips Practix 360 mobile radiography system（Holland）.

2.5.3 Histological evaluation The extracted femoral condyle was fixed in 4% paraformaldehyde with surrounding soft tissue cleaned. After rinsing in tap water for 12 h, all specimens were dehydrated in a gradient of alcohol, clarified with xylene, and embedded in self-curing denture acrylic (Tianjin Fuchen Chemical Reagents Co., Ltd, Tianjin, China). The sections perpendicular to the implants of 150–200 µm were sliced using a microtome (Microm-HM 350S, Thermo Fisher Scientific, USA) and glued onto plastic slides. After polishing to 50 ±10 µm thickness, the sections were stained with Ponceau S. Subsequently, the coverslips were placed on the slides that were observed and photographed by an Olympus Microphoto light microscope（Japan）.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2.6 Statistical analysis Differences between the data sets were analyzed by one-way analysis of variance (ANOVA); P ≤ 0.05 was considered as statistically significant.

Results 3.1 Synthesis of the PMMA-PAA and PMMA-PAA-PSt copolymer The copolymers PMMA-PAA and PMMA-PAA-PSt were synthesized by the radical polymerization of methyl methacrylate and AA or methyl methacrylate, AA, and St by crosslinking with the MBA (Fig .1A and 1B). 1H NMR (400 MHz, CDCl3, 25 °C): δ (ppm) 0.84, 1.03, and 1.25 [3H, -C(CH3)-, PMMA], 1.82 and 1.95 (4H, -CH2-), 2.40 (1H, -CH-, PAA), 3.60 (3H, -CH3, PMMA); GPC (THF, polystyrene standard): Mn = 49023 g/mol, PDI = 1.65. Fig. 1C exhibits a significant chemical shift in the methyl ester group of MMA at 3.60 ppm. Three peaks at 0.84, 1.02, and 1.26 ppm are indicated by the -CH3 of MMA with different tacticity, syndiotactic (rr), heterotactic (mr), and isotactic (mm) triads, respectively. 2.40 ppm in 1H NMR spectrum is the -CH- group of the PAA. The molar ratio of the copolymer, determined by 1H NMR, is 6:1 (PMMA:PAA). 1

H NMR (500 MHz, CDCl3) δ ppm: 3.52(3H, -CH3, PMMA), 2.21(1H, -CH-, PAA),

6.65–7.37 (5H, aromatic ring, PS), 1.95 (4H, -CH2-, PMMA), 1.56 (2H, -CH2-, PAA), 0.57, 1.25 (3H, -C(CH3)-, PMMA), GPC (THF, polystyrene standard): Mn = 32013 g/mol, PDI = 1.77. a, f, and h are the characteristic absorption peaks of PSt, PMMA, and PAA, respectively in Fig. 1D. The molar ratio of the copolymer was calculated by their area from the 1H NMR is 1:1:2 (PMMA:PAA:PSt)


Page 16 of 40

Page 17 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.2 Characteristics of PMMA-PAA and PMMA-PAA-PSt polymers Compared with PMMA cement (compressive strength: 85.6 ± 5.2MPa, elastic modulus: 1846.0 ± 201.5 MPa), the compressive strength of PMMA-PAA and PMMA-PAA-PSt cements reduced to 58.9±3.1 MPa and 57.4±5.0 Mpa, respectively; the elastic modulus was reduced to 1306.4 ± 118.8 MPa and 1468.2 ± 275.8 Mpa, respectively. Fig. 2A and 2B showed that the differences between PMMA and new cement were significant; however, there were no differences in the compressive strength or elastic modulus between PMMA-PAA and PMMA-PAA-PSt cements (P < 0.05). The expanding rate of new PMMA-PAA and PMMA-PAA-PSt cements showed excellent volumetric swelling: 15.2±0.3% and 87.5±0.5%, respectively (Table 2). In addition, Table 2 displayed the doughing time, setting time, and setting temperature of the new PMMA-PAA and PMMA-PAA-PSt cements. The new copolymer exhibited a prolonged doughing time (PMMA-PAA: 49.9±0.9 min; PMMA-PAA-PSt: 55.6±0.8 min), setting time (PMMA-PAA: 9.3±0.2 min; PMMA-PAA-PSt: 11.3±0.3 min), and maximum temperature (PMMA-PAA: 46.2±0.5 °C; PMMA-PAA-PSt: 78.9±0.5 °C) than PMMA cement (P < 0.05).

Table 2. Descriptive statistics of the physical properties of PMMA, PMMA-PAA, and PMMA-PAA-PSt samples (P < 0.05 as compared to PMMA group)

Sample type

Expansion rate (%)

Setting time (min)

Setting temperature (℃ ℃)

Doughing time (min)

PMMA

-6.5±0.4

19.0±0.4

92.5±1.7

4.5±0.2

PMMA-PAA

15.2±0.3

49.9±0.9

46.2±0.5

9.3±0.2

PMMA-PAA-PSt

87.5±0.5

55.6±0.8

78.9±0.5

11.3±0.3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.3 Cytocompatibility of extracts from cements Primary osteoblasts were cultured in the medium with cement extract, and the cell proliferation was assessed by the CCK-8 assay. Fig. 3B showed that the rates of cell proliferation in the PMMA-PAA and PMMA-PAA-PSt cement extracts were increased significantly as compared to the PMMA cement. The survival of the primary osteoblasts in the extract from the PMMA-PAA and PMMA-PAA-PSt cements was significantly higher than that in the extract from the PMMA cement (P < 0.05). These results indicated that the newly synthesized PMMA-PAA and PMMA-PAA-PSt cements were rather suitable for the viability and proliferation of osteoblasts than the PMMA cement. Fig. 4 showed that the apoptosis of the primary osteoblasts was analyzed by flow cytometry. On the days 1 and 3 after the medium was replaced by cement extracts, the apoptotic rates (population B2+B4) among all three cement extracts groups presented significant differences from the controls (Fig. 4，P < 0.05). The rate of apoptosis of the primary osteoblasts cultured in PMMA cement extracts was 3.1 ± 0.4% on day 1 (Fig. 4a) and 8.6 ± 1.5% on day 3 (Fig. 4b). In the PMMA-PAA cement extracts, 2.4 ± 0.2% of the cells were apoptotic on day 1 (Fig. 4a) and 6.7 ± 0.8% on day 3 (Fig. 4b). In the PMMA-PAA-PSt cement extracts, 1.8 ± 0.1% of the cells were apoptotic on day 1 (Fig. 4a) and 5.0 ± 0.4% on day 3 (Fig. 4b). The control group exhibited an apoptotic rate of 1.4 ± 0.1% on day 1 (Fig. 4a) and 3.2 ± 0.3% on day 3 (Fig. 4b). The apoptotic rate of primary osteoblasts in extracts from the PMMA-PAA and PMMA-PAA-PSt cements was significantly lower than that from the PMMA cement (P < 0.05). This result was in accordance with those by CCK-8 analysis described in the previous section.

3.4 Effects of cement films on osteogenic gene expression of primary osteoblasts


Page 18 of 40

Page 19 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Primary osteoblasts were grown on cement films for 3 and 7 days. The expression of osteogenic genes: ALP, COL I, Runx2, and OC by primary osteoblasts was evaluated by Western blot (Fig. 5) and real-time quantitative RT-PCR analysis (Fig. 6). Western blots indicated that in comparison to the cells cultured on PMMA cement films, the expressions of ALP and COL I were higher in the cells grown on either PMMA-PAA and PMMA-PAA-PSt cement films as assessed on 3- (Fig. 5A and Fig. 5B) or 7-day growth (Fig. 5A and Fig. 5C), with an enhanced expression of OC on day 7 (Fig. 5C). RT-PCR analysis showed that in comparison to the cells cultured on PMMA cement films, an enhanced expression of ALP and COL I was observed for cells cultured on PMMA-PAA-PSt cement films both on day 3 and 7 (Fig. 6A and Fig. 6B). At day 3, cells on the PMMA-PAA-PSt cement films showed an upregulated expression of Runx2 (Fig. 6C). In addition, the PMMA-PAA group showed relatively higher expression of ALP at day 7 and that of Runx2 on both days 3 and 7 as compared to the PMMA group (Fig. 6A and Fig. 6C).

3.5 Primary osteoblasts’ attachment and proliferation on 3-D cement discs SEM revealed that the newly synthesized PMMA-PAA-PSt 3-D cement discs had a specific porous/coralloid morphology (Fig. 7). The morphology of primary osteoblasts that had been attached to the scaffolds was observed on days 1 and 3. After culturing for 1 day, the primary osteoblasts proliferated with an intimate contact on the surface of the PMMA-PAA and PMMA-PAA-PSt cement discs. On day 3, the cells associated with PMMA-PAA and PMMA-PAA-PSt cement discs showed an excellent growth, including elongated, spindle-shaped morphology, and intercellular connections (right columns). In contrast, the primary osteoblasts exhibited a poor attachment on PMMA cement discs



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

without spreading.

3.6 Radiographic observation X-ray examinations of the cements in medial femoral condyle of the right femur in each rabbit were performed after 1 week cement injection. Results indicated that each cement sufficiently filled the femur cavity defect (Fig. 8A) without fracture or cement leakage.

3.7 Histological morphologies of the interface between bone tissue and cement Ponceau S staining assessed the bone-cement contact at 1, 4, and 12 weeks. Fig. 8B showed that a minor crack was observed at the interface of the PMMA cement at 1 and 4 weeks after implantation. In contrast, direct and cohesive contact with the bone was confirmed at 1, 4, and 12 weeks after implantation in the PMMA-PAA and PMMA-PAA-PSt cement. On the other hand, as the implantation period increased to 12 weeks, osteogenic-positive staining was observed inside the PMMA-PAA and PMMA-PAA-PSt cement in the proximity to the bone-cement contact. However, no evidence of osteogenic behavior was found in the PMMA cement.

Discussion Although PMMA is a commonly used cement in orthopedic surgery, PMMA it has several disadvantages in the clinical application which necessitate intensive study: the shrinkage during polymerization varied between 3.82 and 7.08% causing an undesirable minor crack that might lead to aseptic loosening and reduction in the biomechanical strength.41,42 The long-term stability and mechanical property of the vertebral bodies might be affected after vertebroplasty. In addition, the elastic modulus in a majority of the commercial bone cements is reported to occur between 1700–3700 Mpa,43,44 which is


Page 20 of 40

Page 21 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


significantly larger than that of the osteoporotic trabecular bone 5, thereby increasing the risk of secondary fracture dramatically.23 In this study, we synthesized a hydrophilous expandable bone cement by the radical polymerization method based on PMMA commercial cement, AA, and St. The present study aimed to obtain a novel PMMA copolymer cement with superior volumetric swelling and lower elastic modulus. As the expanding rate of the new copolymer (PMMA-PAA and PMMA-PAA-PSt) exhibited excellent volumetric swelling of 15.2±0.3% and 87.5±0.5%, respectively, the test on the mechanical properties indicated that the elastic modulus was reduced considerably (1306.4 ± 118.8 MPa, 1468.2 ± 275.8 Mpa, respectively) than the commercial PMMA (1846.0±201.5 MPa). Moreover, the compressive strength of the new copolymer decreased remarkably (58.9±3.1 MPa, 57.4±5.0 Mpa, respectively) as compared to the commercial PMMA (85.6±5.2MPa). These results of PMMA-PAA volumetric swelling are similar to described previously.28,29 Notably, the new PMMA-PAA-PSt cement exhibited a superior volumetric swelling (expanding rate 87.5±0.5%) in contrast to the PMMA-PAA cement (expanding rate 15.2±0.3%) without significant difference in elastic modulus and compressive strength. This characteristic might be attributed to the optimal content of the crosslinking agent in PMMA-PAA-PSt copolymer than the PMMA-PAA copolymer. The MBA content in the PMMA-PAA-PSt seems 2-fold more than that in PMMA-PAA. The crosslinking agent carried out the polymer transfer from the linear to the 3-D network structure. Fewer junctions will be formed of the linear polymer in the presence of the less crosslinking agent, although the hydrophilic groups are abundant in the polymer; hence, it cannot show a better swelling effect. With an increasing amount of the content of the crosslinking agent, the linear



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

polymer becomes a better 3-D network structure, which contributes to the optimal performance of the inflation significantly. However, excess crosslinking agent results in overbalanced junction points, which lead to considerable resistance on the expansion of the network structure, and thus, the swelling performance of the bone cement will also be limited. Both PMMA-PAA and PMMA-PAA-PSt in the solid phase do not react with the MMA in the liquid phase; the solid phase of the two bone cements contains an equivalent amount of copolymer fabricated by radical polymerization. This indicates an equivalent amount of PMMA that can react with the MMA, and thus, their compressive strength indexes were relatively similar. However, the mechanical properties of the two type of bone cements were significantly lower than the commercial PMMA bone cement, and it may result from the decrease in the density of the bone cement by adding PMMA-PAA and PMMA-PAA-PSt, thereby affecting the mechanical properties of the cement. On the other hand, the doughing time and setting time increased in the two new types of cement, which may be influenced by the MMA monomer ratio;45 however, it is essential to ensure that the operator is well-prepared. Due to the low cytotoxicity and excellent biocompatibility of the cellulose component in PAA,46 the synthesized PMMA-PAA and PMMA-PAA-PSt cements showed better cytocompatibility than the PMMA cement, including superior proliferation and lower apoptotic rates of SD rat-derived osteoblasts. On the other hand, the apparent cytotoxicity of PMMA cement was primarily caused by the unreacted MMA monomer.47 Western blotting for protein expression and RT-PCR analysis of osteogenesis-specific genes results showed that the new cements’ films exhibited a tendency to enhance the


Page 22 of 40

Page 23 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


expression of osteogenesis-specific genes. These advantages might have been derived from the hydrophilic property of synthesized PMMA-PAA and PMMA-PAA-PSt cements, which enhanced the cell adhesion and growth.48 Thus, this phenomenon was confirmed by SEM observation. In contrast, bioinert and hydrophobic PMMA cement led to enhanced apoptosis and a predisposition towards the low expression of osteogenesis-specific genes.49 The capacity of cements filling in vivo and the formation of the bone-cement interface were assessed by histological morphologies in rabbit medial femoral condyle cavity defect model. A minor crack observed at the interface of the PMMA cement at 1 and 4 weeks post-implantation might be caused by shrinkage. On the other hand, the direct and cohesive contact with bone in new PMMA-PAA and PMMA-PAA-PSt cements revealed that excellent volumetric swelling compensated for shrinkage effectively. Furthermore, the sign of new bone growing into the cement was found in new PMMA-PAA and PMMA-PAA-PSt cements after 12 weeks, thereby exhibiting osteogenic capacity in vivo. This phenomenon was in agreement with that the microscale compressive can enhance osteogenic effects.50 The results showed that we successfully synthesized a hydrophilous expandable bone cement based on commercial PMMA, AA, and St. The PMMA-PAA and PMMA-PAA-PSt cements with low elastic modulus exhibited excellent cell compatibility and enhanced the tendency of the expression of osteogenesis-specific genes in vitro. Furthermore, new cements established contact with the bone in vivo directly and cohesively as opposed to a minor crack in the PMMA cement. The sign of new bone growing into the cement had also been observed after 12 weeks.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Conclusions In summary, this study successfully synthesized a hydrophilous expandable bone cement based on the PMMA commercial cement, AA, and St. The newly synthesized PMMA-PAA and PMMA-PAA-PSt cements showed excellent volumetric swelling in vitro with low elastic modulus. In comparison to the PMMA commercial cement, PMMA-PAA and PMMA-PAA-PSt cements exhibited a significant low cytotoxicity and properties of the osteogenic genes. Moreover, PMMA-PAA-PSt cement supplied a specific porous/coralloid surface for osteoblasts to attach to and proliferate. We also injected the cement into rabbit medial femoral condyle cavity defect and revealed direct and cohesive contact with a bone with respect to new cements in contrast to a minor crack in the PMMA cement. The bone began to grow into the new cement and after 12 weeks, showed osteogenic capacity in vivo. The PMMA-PAA and PMMA-PAA-PSt cements could be an interesting alternative in the clinical applications for vertebral compression fractures after optimization and further in vivo experiments.

Acknowledgments This study was supported by the National Natural Science Foundation of China (81301535 、 81772310) and Innovative talents cultivate program of Shaanxi province(No.2017KJXX-40).

Appendix A. Supplementary data Supplementary data related to this article (The expandable procedure of the hydrophilous bone cement in the SBF) can be found at supplementary material.

Abbreviations: PMMA, Polymethyl methacrylate; PVP, percutaneous vertebroplasty;


Page 24 of 40

Page 25 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PKP, percutaneous kyphoplasty; OVCF, osteoporotic vertebral compression fractures; PAA, Polyacrylic acid; PSt, Polystyrene; ALP, alkaline phosphatase; Runx2, runt-related transcription factor 2; OC, osteocalcin. SBF, simulated body fluid.

References (1) Kühn, K. D. PMMA Cements, Springer, Berlin Heidelberg. 2013. (2) Charnley, J. Anchorage of the femoral head prosthesis to the shaft of the femur. The Journal of Bone & Joint Surgery-British Volume. 1960, 42, 28-30. (3) Liebschner, M. A.; Rosenberg, W. S.; Keaveny, T. M. Effects of bone cement volume and distribution on vertebral stiffness after vertebroplasty. Spine. 2001, 14, 1547-1554. (4) Serra, L.; Mehrabi, K. F.; Panagiotopoulos, K.; De Rosa, V.; Vizioli, L. Vertebroplasty in the treatment of osteoporotic vertebral fractures: results and functional outcome in a series of 175 consecutive patients. Minim Invasive Neurosurg. 2007, 50, 12-17. (5) Kinzl, M.; Benneker, L. M.; Boger, A.; Zysset, K.; Pahr, D. H. The effect of standard and low-modulus cement augmentation on the stiffness, strength, and endplate pressure distribution in vertebroplasty. Eur Spine J. 2012, 21, 920-929. (6) Wang, J. S.; Franzén, H.; Lidgren, L. Interface gap after implantation of a cemented femoral stem in pigs. Acta orthopaedica Scandinavica. 1999, 70, 234-239. (7) Haas, S. S.; Brauer, G. M.; Dickson, G. A characterization of polymethylmethacrylate bone cement. The Journal of bone and joint surgery. 1975, 57, 380-391. (8) Gilbert, J. L.; Hasenwinkel, J. M.; Wixson, R. L.; Lautenschlager, E. P. A theoretical



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and experimental analysis of polymerization shrinkage of bone cement: A potential major source of porosity. J Biomed Mater Res. 2000, 52, 210-218. (9) Kwong, F. N.; Power, R. A. A comparison of the shrinkage of commercial bone cements when mixed under vacuum. J Bone Joint Surg Br. 2006, 88, 120-122. (10) Wang, T.; Pelletier, M. H.; Bertollo, N.; Crosky, A.; Walsh, W. R. Cement-implant interface contamination: possible reason of inferior clinical outcomes for rough surface cemented stems. Open Orthop J. 2013, 7, 250-257. (11) Manley, M. T.; Stern, L. S.; Gurtowski, J. The load carrying and fatigue properties of the stem-cement interface with smooth and porous coated femoral components. J Biomed Mater Res. 1985, 19, 563-575. (12) Tan, J. H.; Koh, B. T.; Ramruttun, A. K.; Wang, W. Compression and flexural strength of bone cement mixed with blood. Journal of Orthopaedic Surgery. 2016, 24, 240-244. (13) Race, A.; Miller, M. A.; Ayers, D. C.; Mann, K. A. Shrinkage of vacuum mixed cement causes interface gaps: gap distribution depends on stem surface finish. J Bone Joint Surg. 2004, 86, 9. (14) Roques, A.; Browne, M.; Taylor, A.; New, A.; Baker, D. Quantitative measurement of the stresses induced during polymerisation of bone cement. Biomaterials. 2004, 25, 4415-4424. (15) Muller, S. D.; Green, S. M.; McCaskie, A. W. The dynamic volume changes of polymerising polymethylmethacrylate bone cement. Acta Orthop Scand. 2002, 73, 684-687. (16) Frankel, B. M.; Monroe, T.; Wang, C. Percutaneous vertebral augmentation: an


Page 26 of 40

Page 27 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


elevation in adjacent-level fracture risk in kyphoplasty as compared with vertebroplasty. Spine J. 2007, 7, 575-582. (17) Polikeit, A.; Nolte, L. P.; Ferguson, S. J. The effect of cement augmentation on the load transfer in an osteoporotic functional spinal unit: finite-element analysis. Spine.

2003, 28, 991-996. (18) Lee, C. Properties of Bone Cement : The Mechanical Properties of PMMA Bone Cement; Breusch, S. J.; Malchau, H. The Well-Cemented Total Hip Arthroplasty, Springer, Medizin Verlag Berlin, Heidelberg, New York. 2005, pp 60-66. (19) Baroud, G.; Nemes, J.; Heini, P. F.; Steffen, T. Load shift of the intervertebral disc after a vertebroplasty: a finite-element study. Eur Spine J. 2003, 12, 421-426. (20) Polikeit, A.; Nolte, L. P.; Ferguson, S. J. The effect of cement augmentation on the load transfer in an osteoporotic functional spinal unit: finite-element analysis. Spine.

2003, 28, 991-996. (21) Frankel, B. M.; Monroe, T.; Wang, C. Percutaneous vertebral augmentation: an elevation in adjacent-level fracture risk in kyphoplasty as compared with vertebroplasty. Spine J. 2007, 7, 575-582. (22) Lin,W. C.; Lee, Y. C.; Lee, C. H.; Kuo, Y. L.; Cheng, Y. F.; Lui, C. C.; Cheng, T. T. Refractures in cemented vertebrae after percutaneous vertebroplasty: a retrospective analysis. Eur Spine J. 2008, 17, 592-599. (23) Tai, C. L.; Lai, P. L.; Lin, W. D.; Tsai, T. T.; Lee, Y. C.; Liu, M. Y.; Chen, L. H. Modification of Mechanical Properties, Polymerization Temperature, and Handling Time of Polymethylmethacrylate Cement for Enhancing Applicability in Vertebroplasty. Biomed Res Int. 2016:7901562.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(24) Boger, A.; Bohner, M.; Heini, P.; Verrier, S.; Schneider, E. Properties of an injectable low modulus PMMA bone cement for osteoporotic bone. J Biomed Mater Res B Appl Biomater. 2008, 86, 474-482. (25) Shi, M.; Kretlow, J. D.; Spicer, P. P.; Tabata,Y.; Demian, N.; Wong, M. E.; Kasper, F. K.;Mikos, A. G. Antibiotic-releasing porous polymethylmethacrylate/gelatin/antibiotic constructs for craniofacial tissueengineering . J Control Release. 2011, 152, 196-205. (26) Yang, J.; Zhang, K.; Zhang, S.; Fan, J.; Guo, X.; Dong, W.; Wang, S.; Chen, Y.; Yu, B. Preparation of Calcium Phosphate Cement and Polymethyl Methacrylate for Biological Composite Bone Cements. Med Sci Monit. 2015, 21, 1162-1172. (27) Persson, C.; López, A.; Fathali, H.; Hoess, A.; Rojas, R.; Ott, M. K.; Hilborn, J.; Engqvist, H. The effect of oligo (trimethylene carbonate) addition on the stiffness of acrylic bone cement. Biomatter. 2016, 6, e1133394. (28) Nien, Y. H.; Chen, J. Studies of the mechanical and thermal properties of crosslinked poly (methylmethacrylate acrylic acid allylmethacrylate) modified bone cement. J Appl Polym Sci. 2006, 100, 3727-3732. (29) Gualtieri, G. M.; Siegler, S.; Hume, E. L.; Kalidindi, S. R. Biological and mechanical characteristics of the interface between a new swelling anchor and bone. J Orthop Res. 2000, 18, 494-499. (30) Lin, H. R.; Wang, S. H.; Chiang, C. C.; Juang, Y. C.; Yu, F. A.; Tsai, L. High strain-rateresponse of injectable PAA hydrogel. J Biomater Sci Polym Ed. 2015, 26, 534-544. (31) Drury, J. L.; Mooney, D. J. Hydrogels for tissue engineering: scaffold design variables and applications. Biomaterials. 2003, 24, 4337-4351.


Page 28 of 40

Page 29 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(32) Kwon, H. J. Tissue engineering of muscles and cartilages using polyelectrolyte hydrogels. Adv Mater Sci Eng. 2014, 1-7. (33) Offeddu, G. S.; Mela, I.; Jeggle, P.; Henderson, R. M.; Smoukov, S. K.; Oyen, M. L. Cartilage-like electrostatic stiffening of responsive cryogel scaffolds. Sci Rep. 2017, 7, 42948. (34) Mohan, A. J.; Sekhar, V. C.; Bhaskar, T.; Nampoothiri, K. M. Microbial assisted High Impact Polystyrene (HIPS) degradation. Bioresour Technol. 2016, 213, 204-207. (35) Kaseem, M.; Hamad, K.; Ko, Y. G. Fabrication and materials properties of polystyrene/carbon nanotube (PS/CNT) composites: A review. European Polymer Journal. 2016, 79, 36-62. (36) Uemura, T.; Kaseda, T.; Sasaki, Y.; Inukai, M.; Toriyama, T.; Takahara, A.; Jinnai, H.; Kitagawa, S. Mixing of immiscible polymers using nanoporous coordination templates. Nat Commun. 2015, 6, 7473. (37) Kokubo, T.; Takadama, H. How useful is SBF in predicting in vivo bone bioactivity? Biomaterials. 2006, 27, 2907-2915. (38) Liu, C.; Zhang, Y.; Wang, L.; Zhang, X.; Chen, Q.; Wu, B. A Strontium-Modified Titanium Surface Produced by a New Method and Its Biocompatibility In Vitro. PLoS One. 2015, 10, e0140669. (39) Orriss, I. R.; Taylor, S. E.; Arnett, T. Rat Osteoblast Cultures. Methods Mol Biol.

2012, pp 31-41. (40) Jacobs, E.; Saralidze, K.; Roth, A. K.; de Jong, J. J.; van den Bergh, J. P.; Lataster, A.; Brans, B. T.; Knetsch, M. L.; Djordjevic, I.; Willems, P. C.; Koole, L. H. Synthesis and characterization of a new vertebroplasty cement based on gold-containing PMMA



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

microspheres. Biomaterials. 2016, 82, 60-70. (41) Kwong, F. N.; Power, R. A. A comparison of the shrinkage of commercial bone cements when mixed under vacuum. J Bone Joint Surg Br. 2006, 88, 120-122. (42) Kinzl, M.; Boger, A.; Zysset, P. K.; Pahr, D. H. The mechanical behavior of PMMA/bone specimens extracted from augmented vertebrae: a numerical study of interface properties, PMMA shrinkage and trabecular bone damage. J Biomech. 2012, 45, 1478-1484. (43) Kürtz, S. M.; Villaragga, M. L.; Zhao, K.; Edidin, A. A. Static and fatigue mechanical behavior of bone cement with elevated barium sulfate content for treatment of vertebral compression fractures. Biomaterials. 2005, 26, 3699-3712. (44) American Society for Testing Materials (ASTM), ASTM Standard F451-99a:standard specification for acrylic bone cement, In Annual Book of ASTM Standards, vol 13.01, ASTM, West Conshohocken, PA, United States. (45) Lewis, G.; Xu, J.; Madigan, S.; Towler, M. R. Influence of two changes in the composition of an acrylic bone cement on its handling, thermal, physical, and mechanical properties. J Mater Sci Mater Med. 2007, 18, 1649-1658. (46) Gao, X.; Cao, Y.; Song, X.; Zhang, Z.; Zhuang, X.; He, C.; Chen, X. Biodegradable, pH-responsive carboxymethyl cellulose/poly(acrylic acid) hydrogels for oral insulin delivery. Macromolecular Bioscience. 2014, 14, 565-575. (47) Lim, S. M.; Yap, A.; Loo, C.; Ng, J.; Goh, C. Y.; Hong, C.; Toh, W. S. Comparison of cytotoxicity test models for evaluating resin-based composites. Human and Experimental Toxicology. 2017, 36,339-348. (48) Kim, G.; Hong, L. Y.; Jung, J.; Kim, D. P.; Kim, H.; Kim, I. J.; Kim, J. R.; Ree, M.


Page 30 of 40

Page 31 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The biocompatability of mesoporous inorganic-organic hybrid resin films with ionic and hydrophilic haracteristics. Biomaterials. 2010, 31, 2517-2525. (49) Choi, S. M.; Yang, W. K.; Yoo, Y. W.; Lee,W. K. Effect of surface modification on the in vitro calcium phosphate growth on the surface of poly(methyl methacrylate) and bioactivity. Colloids and Surfaces B: Biointerfaces. 2010, 76, 326-333. (50) Rath, B.; Nam, J.; Knobloch, T. J.; Lannutti, J. J.; Agarwal, S. Compressive forces induce osteogenic gene expression in calvarial osteoblasts. J Biomech. 2008, 41, 1095-1103.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table of Contents


Page 32 of 40

Page 33 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1.Synthesis of the PMMA-PAA and PMMA-PAA-PSt copolymer.(a) Synthesis of the PMMA-PAA copolymer by the radical polymerization of methyl methacrylate and acrylic acid by cross-linking with MBA.(b) Synthesis of the PMMA-PAA-PSt copolymer by the radical polymerization of methyl methacrylate, acrylic acid, and styrene by crosslinking with the MBA.(c) 1H NMR spectrum of PMMA-PAA copolymer.(d) 1H NMR spectrum of PMMA-PAA-PSt copolymer.(e) GPC trace of the PMMA-PAA copolymer.(f) GPC trace of the PMMA-PAA-PSt copolymer.(g) Characteristics of the PMMA-PAA copolymer and the PMMA-PAA-PSt copolymer. 129x337mm (600 x 600 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2.Mechanical properties of the cements. (A) The compressive strength of PMMA, PMMA-PAA, and PMMA-PAA-PSt cements. (B) The elastic modulus of PMMA, PMMA-PAA, and PMMA-PAA-PSt cements. (* P< 0.05). 80x32mm (300 x 300 DPI)


Page 34 of 40

Page 35 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3.Cultivation of primary osteoblasts after isolation and proliferation in cement extracts. (A) Cell cultivation in the α-modified minimum essential medium after isolation for 1, 3, and 7 days (Dash area: small pieces of calvaria; Scale bars are left: 200 µm; right: 100µm). (B) CCK-8 assay with primary osteoblasts cultured for 1, 4, and 7 days in PMMA, PMMA-PAA, and PMMA-PAA-PSt cement extracts, cell viability are presented as OD value determined by CCK-8 assay. (n = 4, mean±standard deviation, * P < 0.05 vs. the PMMA group; #P < 0.05vs. the control group). 132x82mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4.Analysis of apoptosis in cement extracts. (a)Apoptosis of primary osteoblasts on day 1 of culture in different cement extracts: (A) PMMA; (B) PMMA-PAA; (C) PMMA-PAA-PSt; (D) Control. Results in each group were representative of three independent experiments (mean ± standard deviation, P< 0.05). (b)Apoptosis of primary osteoblasts on day 3 of culture in different cement extracts: (A) PMMA; (B) PMMA-PAA; (C) PMMA-PAA-PSt; (D) Control. Results in each group were representative of three independent experiments (mean ± standard deviation, P< 0.05). 92x57mm (300 x 300 DPI)


Page 36 of 40

Page 37 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5.Osteogenic-related protein expression on 2-D cement films. (A)Western blotting results for detection of ALP, COL I, Runx2, and OC in cells cultured for 3 and 7 days on the cement films and 6-well plates without cement films (used as controls). The intensities of ALP, COL I, Runx2, and OC protein were measured and normalized by β-actin. Similar results were obtained from three independent experiments. (B)Relative levels of ALP, COL I, Runx2, and OC expression in cells cultured for 3days on the cement films and 6-well plates without cement films by Western blot (mean ± standard deviation, *p < 0.05, vs. the PMMA group). (C)Relative levels of ALP, COL I, Runx2,and OC expression in cells cultured for 7days on the cement films and 6-well plates without cement films by Western blot (mean ± standard deviation, *p < 0.05, vs. the PMMA group). 127x85mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6.Osteogenic-related gene expression on 2-D cement films with real-time PCR analysis. The expression of osteogenic marker gene ALP (A), COL I (B), Runx2 (C), OC (D)on PMMA, PMMA-PAA, and PMMA-PAA-PSt 2-D cement films after 3 and 7 days by real-time PCR analysis (*P < 0.05 as compared to PMMA group on day 3;#P < 0.05 as compared to PMMA group on day 7). 80x56mm (300 x 300 DPI)


Page 38 of 40

Page 39 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7.Scanning electron micrographs (SEM) showing sequential steps of cell attachment and growth on 3D cement discs.The morphology of cement discs’ surfaces is showed in first line (Sample); Specific porous/coralloid morphology is showed on PMMA-PAA-PSt 3-D cement discs. Cells associated with PMMAPAA and PMMA-PAA-PSt cement discs exhibiting an excellent growth. Culture times are the second line: 1 day; and the third line: 3 days. White arrows: primary osteoblasts and extracellular matrix. Scale bars: 100 µm. 74x66mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 8.Radiographic examination and histological evaluation of the cements. (A) X-ray examinations of the cements in the medial femoral condylein the right femur of each rabbit femur after 1 week of cement injection (Yellow circle: the femur cavity defect filled with cements). (B)Ponceau S staining of bone-cement contact at 1, 4, and 12 weeks, the bone is presented as red part while cement materials are presented as black porouspart. Minor crack is observed at the interface of the PMMA cement at 1 and 4 weeks after implantation. The red parts in yellow circle of PMMA-PAA and PMMA-PAA-PSt cement group at 12 weeks are osteogenic positive staining (B: Bone; M: Materials; Yellow arrows: minor crack; Yellow circle: osteogenic positive staining). Scale bars: 200 µm. 129x65mm (300 x 300 DPI)


Page 40 of 40

Synthesis and Characterization of an Injectable ... - ACS Publications

Recommend Documents