Synthesis and Evaluation of a Novel Fluorescent Photoprobe for

Grams , F., Brandstetter , H., D'Alo , S., Geppert , D., Krell , H. W., Leinert , H., Livi , V., Menta , E., Oliva , A., and Zimmermann , G. 2001 Pyri...
0 downloads 0 Views 692KB Size
Download PDF
Bioconjugate Chem. 2008, 19, 1001–1008

1001

Synthesis and Evaluation of a Novel Fluorescent Photoprobe for Imaging Matrix Metalloproteinases Andreas Faust,*,†,‡,§ Bianca Waschkau,†,§ Jens Waldeck,† Carsten Höltke,†,‡ Hans-Jörg Breyholz,‡ Stefan Wagner,‡ Klaus Kopka,‡ Walter Heindel,† Michael Schäfers,‡,| and Christoph Bremer†,| Department of Clinical Radiology and Department of Nuclear Medicine, University Hospital Münster, Albert-Schweitzer-Str. 33, 48149 Münster, Germany, and Interdisciplinary Center for Clinical Research (IZKF Münster), Domagkstr. 3, University of Münster, 48149 Münster, Germany. Received November 5, 2007; Revised Manuscript Received February 1, 2008

The measurement of matrix metalloproteinase (MMP) activity in diseases like inflammation, oncogenesis, or atherosclerosis in vivo is highly desirable. Fine-tuned pyrimidine-2,4,6-triones (barbiturates) offer nonpeptidyl lead structures for developing imaging agents for specifically visualization of activated MMPs in vivo. The aim of this study was to modify a C-5-disubstituted barbiturate and thus design a highly affine, nonpeptidic, optical MMP inhibitor (MMPI)-ligand for imaging of activated MMPs in vivo. A convergent 10 step synthesis was developed, starting with a malonic ester and (4-bromophenoxy)benzene to generate 5-bromo-pyrimidine-2,4,6trione as the key intermediate. To minimize the interactions between activated MMPs and the dye of the conjugate 6, a PEGylated piperazine derivative was used as a spacer and an azide as a protected amino function. After linking both building blocks, reducing the azide (Staudinger reaction) and labeling with Cy 5.5, we obtained the nonhydroxamate MMP inhibitor 6 with high affinity (IC50-value: 48 nM for MMP-2) measured in a fluorogenic assay using commercially available MMP-substrates and the purified enzyme. Zymography revealed an efficient blocking of enzyme activity of purified MMP-2 and MMP-9 and of MMP-containing cell supernatants (HT1080), (A-673) using the PEGylated barbiturate 5. Fluorescence microscopy studies using a highly (A-673) and a moderate (HT-1080) MMP-2 secreting cell line showed efficient binding of the Cy 5.5 labeled tracer 6 to the MMP-2 positive cells while MMP-2 negative cells (MCF-7) did not bind. Therefore, this new barbiturate-based MMP-probe has a high affinity and specificity toward MMP-2 and -9 and is thus a promising candidate for sensitive MMP detection in vivo.

INTRODUCTION Molecular imaging of locally upregulated and activated matrix metalloproteinases (MMPs) in vivo is a clinical challenge. MMPs are zinc- and calcium-dependent endopeptidases and represent a subfamily of the metzincin superfamily. They are able to degrade all protein components of the extracellular matrix (ECM) with overlapping substrate specificities (1–3). To date more than 20 human MMPs have been characterized. Based on their specificity the MMPs are classified into collagenases, gelatinases, stromelysins, and matrilysins. Another subclass of the MMPs is represented by the membrane-type MMPs (MT-MMPs) (4, 5). An increased MMP expression is associated with pathophysiological processes including the progression of cancer, cardiovascular diseases such as atherosclerosis, and inflammation (6–13). Recently, the pyrimidine-2,4,6-triones (or barbiturates) were identified as nonhydroxamate MMP inhibitors that exhibit specific activities for a subgroup of secreted MMPs comprising the gelatinases A (MMP-2) and B (MMP-9), neutrophil collagenase (MMP-8), the membrane bound MMPs, MT-1-MMP (MMP-14), and MT-3-MMP (MMP-16) (14). Barbiturates are, therefore, promising candidates for molecular imaging of MMP * To whom correspondence should be addressed. Address: Department of Clinical Radiology, Albert-Schweitzer-Str. 33, University Hospital Münster, 48149 Münster, Germany. E-mail: faustan@ uni-muenster.de. Tel.: +49-251-8347362. Fax: +49-251-8347363. † Department of Clinical Radiology, University Hospital Münster. ‡ Department of Nuclear Medicine, University Hospital Münster. § These authors contributed equally to this work. | Interdisciplinary Center for Clinical Research.

activity. The enolic tautomer of the pyrimidine-2,4,6-triones binds to the zinc active site (15, 16). Recently, C-5-disubstituted pyrimidine-2,4,6-triones were exploited as a new class of potential MMP inhibiting radiotracers with improved MMP binding potency (17, 18). Fluorochrome-based molecular tracers have been shown to allow highly sensitive visualization of molecular targets. Moreover, optical technologies are inexpensive and free of ionizing radiation and isotope decay as well as applicable to tomographic (e.g., fluorescence mediated tomography, FMT) and surface-weighted (e.g., fluorescence reflectance imaging, FRI) imaging techniques. In this study the synthesis of a barbiturate-based MMP-2 and MMP-9 ligand is described. A poly(ethylene glycol) (PEG) spacer group containing the amino functionality was inserted to enable labeling with fluorescent dyes without changing the MMP binding pharmacophor. The conjugation of the fluorescent dye Cy 5.5 was accomplished by forming an amide bond under standard conditions. Enzyme activity assays and cell binding studies in vitro confirmed a high binding affinity of the probe to the target.

EXPERIMENTAL PROCEDURES Materials and Methods. All chemicals, reagents, and solvents for the synthesis of the compounds were analytical grade and purchased from commercial sources. For the labeling procedure DNA-grade dimethylformamide was used. Melting points (uncorrected) were determined on a Stuart Scientific SMP3 capillary melting point apparatus. 1H NMR and 13C NMR spectra were recorded on a Bruker ARX 300 (Bruker BioSpin GmbH, Rheinstetten, Germany). Mass spectrometry was per-

10.1021/bc700409j CCC: $40.75  2008 American Chemical Society Published on Web 04/09/2008

1002 Bioconjugate Chem., Vol. 19, No. 5, 2008

formed using a QUATTRO LCZ (Waters Micromass, Manchester, U.K.) spectrometer with a nanospray capillary inlet. Synthetic Organic Chemistry. N-Boc-Piperazine. A solution of piperazine (27.60 g, 320 mmol) in 450 mL of dichloromethane was cooled to 0 °C. Di-tert-butyl dicarbonate (34.96 g, 160 mmol) in 150 mL of dichloromethane was added dropwise. The resulting mixture was stirred for 2 h at 0 °C and then at ambient temperature for 22 h. The precipitate was filtered off, and the filtrate was concentrated in vacuo. The crude product was dissolved in water (300 mL) and extracted with diethyl ether (3 × 200 mL). The organic layer was dried over magnesium sulfate and concentrated to give a colorless solid. Yield: 20.27 g (109 mmol, 68%). Mp: 72–73 °C. 1H NMR (CDCl3, 300 MHz): δ (ppm) ) 1.46 (s, 9H, C(CH3)3), 1.85 (s, 1H, NH), 2.79–2.83 (m, 4H, NH(CH2)2), 3.37–3.41 (m, 4H, (CO)N(CH2)2). 13C NMR (CDCl3, 75 MHz): δ (ppm) ) 28.3 (C(CH3)3), 45.8 (NHCH2), 51.1 (CO)N(CH2)2), 79.4 (C(CH3)3), 154.7 (N(CO)O). MS (ES+) m/e ) 209.1 (M + Na)+, 187.1 (M + H)+. Tetraethyleneglycol Dimethanesulfonate. Methanesulfonyl chloride (317 mL, 470 g, 4.1 mol) was added dropwise over a period of 4 h to a solution of tetraethylene glycol (347 mL, 388 g, 2 mol) in dichloromethane (1.8 L) and triethyl amine (570 mL, 415 g, 4.1 mol) at 0 °C. The mixture was stirred at ambient temperature for an additional 16 h, and the resulting precipitate was filtered off. Concentration of the filtrate yielded an orange oil, which was used without further purification. Yield: 596 g (1.7 mol, 85%). 1H NMR (CDCl3, 300 MHz): δ (ppm) ) 3.08 (s, 6H, SO3CH3), 3.65–3.68 (m, 8H, OCH2CH2O), 3.76–3.78 (m, 4H, SO3CH2CH2), 4.37–4.40 (m, 4H, SO3CH2CH2). 13C NMR (CDCl3, 75 MHz): δ (ppm) ) 37.6 (SO3CH3), 68.9 (SO3CH2CH2), 69.2 (SO3CH2CH2), 70.4, 70.5 (OCH2CH2O). MS (ES+) m/e ) 373.1 (M + Na)+, 351.1 (M + H)+. 2-(2-(2-(2-Azidoethoxy)ethoxy)ethoxy)ethyl Methanesulfonate (1). To a solution of tetraethyleneglycol dimethanesulfonate (83.4 g, 272 mmol) in dimethyl formamide (600 mL) was added sodium azide (10.6 g, 163 mmol), and the reaction mixture was stirred at 120 °C for 5 h. Most of the dimethyl formamide was removed in vacuo. The crude product was dissolved in ethyl acetate (400 mL) and washed with water (5 × 200 mL) and brine (200 mL) and dried over magnesium sulfate. After removing the solvent the resulting oil was chromatographed on a silica gel column (cyclohexane/EtOAc 2/1 to 1/1) to give a pale yellow oil. Yield: 17.2 g (58 mmol, 36%). 1H NMR (CDCl3, 300 MHz): δ (ppm) ) 3.08 (s, 3H, SO3CH3), 3.64–3.69 and 3.76–3.79 (m, 14H, OCH2CH2O and OCH2CH2N3), 4.37–4.40 (m, 2H, SO3CH2CH2). 13C NMR (CDCl3, 75 MHz): δ (ppm) ) 37.6 (SO3CH3), 51.0 (CH2N3), 68.8 (SO3CH2CH2), 69.3 (SO3CH2CH2), 69.9, 70.4, 70.5 (OCH2CH2O). MS (ES+) m/e ) 319.1 (M + Na)+, 297.1 (M + H)+. tert-Butyl-4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)piperazine-1-carboxylate. A solution of 1 (12.44 g, 41.8 mmol), N-Boc-piperazine (9.34 g, 50.2 mmol), and triethyl amine (8.3 g, 11.5 mL, 82 mmol) in acetonitrile (150 mL) was heated to reflux for 24 h. After removing the solvent the crude product was purified by column chromatography on silica gel (cyclohexane/EtOAc 1:2) to give a pale yellow oil. Yield: 9.76 g (25.2 mmol, 60%). 1H NMR (CDCl3, 300 MHz): δ (ppm) ) 1.45 (s, 9H, C(CH3)3), 2.44 (t, 4H, (CO)NCH2CH2N, 3J ) 5.1 Hz), 2.59 (t, 2H, NCH2CH2NCH2, 3J ) 6 Hz), 3.38 (t, 2H, CH2N3, 3J ) 5.4 Hz), 3.43 (t, 4H, (CO)NCH2, 3J ) 5.1 Hz), 3.60–3.69 (m, 12H, OCH2CH2O). 13C NMR (CDCl3, 75 MHz): δ (ppm) ) 28.3 (C(CH3)3), 43.7 ((CO)NCH2), 50.6 (CH2N3), 53.2 (NCH2CH2NCH2), 57.7 (NCH2CH2NCH2), 68.8, 69.9, 70.3, 70.5 (OCH2CH2O). MS (ES+) m/e ) 388.3 (M + H)+.

Faust et al.

1-(2-(2-(2-(2-Azidoethoxy)ethoxy)ethoxy)ethyl)piperazine TFA Salt (2). Trifluoroacetic acid (12 mL) was added to a solution of the Boc-protected PEGylated piperazine (3.64 g, 9.4 mmol) in dichloromethane (12 mL) and stirred for 2 h. The solvent was removed and the crude product chromatographed on a silica gel column (EtOAc/MeOH 9/1 to 4/1) to give a yellow sticky oil. Yield: 2.6 g (6.7 mmol, 71%). 1H NMR (CDCl3, 300 MHz): δ (ppm) ) 3.38 (t, 2H, CH2N3, 3J ) 5.4 Hz), 3.62–3.91 (m, 22H, piperazine-CH2 and OCH2CH2O), 9.81 (bs, 2H, +NH2). 13 C NMR (CDCl3, 75 MHz): δ (ppm) ) 42.3 (NH2CH2), 50.4 (CH2N3), 52.3 (NCH2CH2NCH2), 58.5 (NCH2CH2NCH2), 65.7, 69.9, 70.3, 70.4, 70.6 (OCH2CH2O). MS (ES+) m/e ) 288.2 (M + H)+. 5-(4-Phenoxyphenyl)pyrimidine-2,4,6-trione (3). A mixture of palladium acetate (135 mg, 0.6 mmol), copper difluoride (60 mg, 0.6 mmol), tri-tert-butyl phosphine (90% grade, 220 µL, 0.8 mmol), sodium tert-butoxide (6.98 g, 73 mmol), and tetrahydrofurane (30 mL) was prepared. 4-Bromophenyl phenylether (10.5 mL, 60 mmol) and diisopropyl malonate (14.4 mL, 76 mmol) were added consecutively. The clear solution was heated to reflux for 15 h. The resultant suspension was diluted with cyclohexane (30 mL), and 3 M HCl (7.5 mL, 22.5 mmol) was added. The mixture was filtered through Celite, and the filter pad was washed with cyclohexane/THF (1/1, 100 mL). After removing the solvent, the residue was dissolved in diethyl ether, washed with 3 M HCl (3 × 25 mL), 1 M NaHCO3 (2 × 25 mL), and brine, dried over magnesium sulfate, and concentrated under reduced pressure yielding a yellow oil. Urea (6.41 g, 107 mmol) and isopropanol (130 mL) were added. The mixture was heated to 80 °C, and a 1 M solution of potassium tert-butoxide in THF (152 mL, 152 mmol) was added slowly over 3 h while distilling off approximately 70 mL of solvent and maintaining a reflux temperature between 75 and 85 °C. After the addition was complete the mixture was heated to reflux for an additional 16 h. Following cooling to ambient temperature concentrated HCl (15 mL) and water (35 mL) were slowly added and the mixture was stirred for 10 min. The solution was concentrated under reduced pressure to remove the organic solvents. The resulting aqueous mixture was diluted with water (100 mL), and the precipitate was filtered off. The off-white solid was dissolved in ethyl acetate (70 mL), heated to reflux for a few minutes, and after cooling to ambient temperature cyclohexane (35 mL) was slowly added. The precipitate was filtered off, washed with cyclohexane/EtOAc (1/1, 100 mL), and dried in vacuo to give an off-white solid. Yield: 4.2 g (12.3 mmol, 21%). 1H NMR (DMSO-d6, 300 MHz): δ (ppm) ) 4.87 (s, 1H, CH), 6.91–7.49 (m, 9H, PhH), 11.41 (bs, 2H, (CO)NH). 13 C NMR (d6-DMSO, 75 MHz): δ (ppm) ) 60.6 (barbituricCH), 118.9, 123.6, 123.7, 130.4, 131.0 (PhCH), 131.3 (qPhCCH), 157.1, 157.3 (q-PhCO), 155.4 (NHCONH), 172.8 (NHCOCH). MS (ES+) m/e ) 319.1 (M + Na)+. 5-(4-(2-(2-(2-(2-Azidoethoxy)ethoxy)ethoxy)ethyl)piperazin1-yl)-5-(4-phenoxyphenyl)-pyrimidine-2,4,6-trione (4). A solution of 3 (3.9 g, 11.5 mmol) in dimethyl formamide (15 mL) was cooled to 0 °C, and a solution of N-bromosuccinimide (2.1 g, 11.5 mmol) in 10 mL of dimethyl formamide was added over 20 min while maintaining the temperature of the reaction mixture below 10 °C. After stirring for 20 min, 2 (4.6 g, 11.5 mmol) and potassium carbonate (3.22 g, 23 mmol) were added, and the mixture was stirred for 1 h at 0 °C followed by stirring for 20 h at ambient temperature. After removing the solvent, the crude product was dissolved in toluene (25 mL) and heated to reflux for a few minutes. After cooling to ambient temperature, diethyl ether (10 mL) was added dropwise and the resulting suspension was stored overnight at –20 °C. The precipitate was filtered off, washed with diethyl ether, and dried in vacuo giving a white powder. Yield: 2.9 g (4.9 mmol, 43%).

Fluorescent Photoprobe for Imaging MMPs

Bioconjugate Chem., Vol. 19, No. 5, 2008 1003

Table 1. MMP Inhibition Potencies of the Barbiturates for MMP-2 and -9 Expressed in IC50 Values IC50a [nM] compound

MMP-2

MMP-9

4 5 6

24 ( 8 27 ( 3 48 ( 5

68 ( 10 138 ( 19 n.d.d

clog

Db

1,84 -0.34 n.d.c

clog

Pb

2.15 ( 0.85 1.29 ( 0.85 n.d.c

a Values are the mean ( SD of three assays. b log D and log P values calculated by ACD/LogD Suite at physiological pH. c Could not be calculated by ACD/LogD Suite. d Not determined.

Table 2. Oligonucleotides Used as Primers oligonucleotides

5′ f 3′ sequence

MMP-2-for MMP-2-rev MMP-9-for MMP-9-for β-Actin-for β-Actin-rev

CAAAAACAAGAAGACATACATCTT GCTTCCAAACTTCACGCTC TGGGGGGCAACTCGGC GGAATGATCTAAGCCCAG AAAGACCTGTACGCCAACAC GTCATACTCCTGCTTGCTGAT

Scheme 1. Synthesis of the PEG Spacer 2

Mp: 139 °C. 1H NMR (DMSO-d6, 300 MHz): δ (ppm) ) 2.41–2.50 (m, 10H, piperazine-H, NCH2CH2NCH2), 3.36 (t, 2H, CH2N3, 3J ) 5.4 Hz), 3.44–3.59 (m, 12H, OCH2CH2O), 6.92–7.42 (m, 9H, PhH), 11.57 (bs, 1H, NH). 13C NMR (DMSO-d6, 75 MHz): δ (ppm) ) 47.3 (q-CNCH2), 49.9 (CH2CH2NCH2), 53.7 (CH2N3), 57.1 (CH2CH2NCH2), 68.2, 69.2, 69.6, 69.7, 69.8 (OCH2CH2O), 73.8 (q-C(CO)2), 118.0, 118.2, 118.5, 119.2 (PhCH), 124.0 (q-PhC), 127.7, 129.9, 130.1, 130.6 (PhCH), 149.6 (NHCONH), 156.9, 157.3 (q-PhCO), 170.1 (CONH). HRMS (ES+, C28H35N7O7H): calcd, 582.2761; found, 582.2760. 5-(4-(2-(2-(2-(2-Aminoethoxy)ethoxy)ethoxy)ethyl)piperazin1-yl)-5-(4-phenoxyphenyl)-pyrimidine-2,4,6-trione (5). Triphenylphosphine (560 mg, 2.5 mmol) was added to a solution of 4 (1.16 g, 2 mmol) in tetrahydrofurane (50 mL), and the reaction mixture was stirred for 16 h at ambient temperature. Then water (0.1 mL) was added, and the mixture was stirred for 3 h. The solvent was removed under reduced pressure, and the residue was chromatographed on a silia gel column (EtOAc/MeOH 2/1 + 2% TEA) to give a colorless foam (Rf ) 0.2). Yield: 785 mg (1.41 mmol, 71%). Mp: 50 °C. 1H NMR (CDCl3, 300 MHz): δ (ppm) ) 2.57–2.81 (m, 10H, piperazine-H,(CH2)2NCH2), 3.33 (bs, 2H, CH2NH2), 3.59–4.04 (m, 16H, OCH2CH2O, NH2), 6.90–7.35 (m, 9H, Ph-H). 13C NMR (CDCl3, 75 MHz): δ (ppm) ) 40.5 (CH2NH2), 45.6 (q-CNCH2), 46.9 (CH2CH2NCH2), 58.8 (CH2CH2NCH2), 66.4, 69.4, 70.3, 70.9 (OCH2CH2O), 72.1 (CH2CH2NH2), 74.0 (q-C(CO)2), 118.5, 119.1 (PhCH), 123.6 (q-PhC), 129.7, 130.3, 131.2 (PhCH), 149.7 (NHCONH), 156.8, 157.3 (q-PhCO), 170.3 (CONH). HRMS (ES+, C28H37N5O7H): calcd, 556.2766; found, 556.2766. Fluorochrome Conjugation. The amino-functionalized derivative 5 (1.0 mg, 1.7 µmol) was dissolved in 400 µL dry dimethylformamide including 10 µL triethylamine. To this solution was added Cy 5.5 NHS ester (Amersham Bioscience; 1 mg, 0.9 µmol). The reaction mixture was vortexed for 2 h at room temperature in the dark. Purification of the Cy 5.5-labeled derivative 6 was performed by gradient HPLC using a Knauer

system with two K-1800 pumps, an S-2500 UV detector, and a RP-HPLC Nucleosil 100-5 C18 column (250 mm × 4.6 mm). Eluent A: water (0.1% TFA). Eluent B: acetonitrile (0.1% TFA). Gradient from 99% A to 40% A over 23 min at a flow rate of 5 mL/min, detection at λ ) 254 nm. The appropriate fractions (tR ) 16.5 min) were collected, lyophilized, redissolved in PBS, and finally stored at –20 °C. The average content of 6 was 0.8 ( 0.2 µmol/mL (≈ 65%) as determined by fluorometer measurements with λabs ) 678 nm and ε678 ) 250 000 M-1 cm-1. MS (ES-): m/e ) 483.6 (100%), 484.0, 484.3, 484.6, 485.0 [M]3-; 725.8, 726.3, 726.7, 727.4 [M + H]2-. In Vitro Enzyme Inhibition Assays. The synthetic broadspectrum fluorogenic substrate (7-methoxycoumarin-4-yl) acetyl pro-Leu-Gly-Leu-(3-(2,4-dinitrophenyl)-L-2,3-diamino-propionyl)-Ala-Arg-NH2 (R & D Systems, Minneapolis, U.S.A.) was used to measure MMP-2 and MMP-9 activities as described previously (19). The inhibition of human active MMP-2 and MMP-9 by the barbiturates 4 and 5 and the conjugate 6 was measured by preincubating MMP-2 (2 nM) or MMP-9 (2 nM) and inhibitor compounds at varying concentrations (10 pM –1 mM) in 50 mM Tris · HCl, pH 7.5, containing 0.2 M NaCl, 5 mM CaCl2, 20 µM ZnSO4, and 0.05% Brij 35 at 37 °C for 30 min. An aliquot of substrate (10 µL of a 50 µM solution) was then added to 90 µL of the preincubated MMP/inhibitor mixture, and the activity was determined at 37 °C by following product release per time. The fluorescence changes were monitored using a Fusion Universal Microplate Analyzer (Packard Bioscience, Massachusetts, U.S.A.) with excitation and emission wavelengths set to 330 and 390 nm, respectively. Reaction rates were measured from the initial 10 min of the reaction profile where product release was linear with time and plotted as a function of inhibitor dose. From the resulting inhibition curves, the IC50 value for each inhibitor was calculated by nonlinear regression analysis, performed using the Grace 5.1.8 software (Linux). Cell Cultures. Three human carcinoma cell lines, purchased from ATCC (Manassas, VA, U.S.A.), were cultivated in the following media: fibrosarcoma HT-1080 (CCL-121) and adenocarcinoma MCF-7 (HTB-22) in RPMI-1640, and rhabdomyosarcoma A-673 (CRL-1598) in DMEM. Media (Invitrogen Corporation, San Diego, CA) were supplemented with 10% fetal calf serum (FCS), 1% penicillin and streptomycin (Biochrom AG, Berlin, Germany), 2 mM L-glutamine (Gibco BRL), and 13.5 mM sodiumbicarbonate when using A-673 cells. Cells were grown routinely in T75 flasks, incubated at 37 °C in a 5% CO2 humidified air atmosphere until the cultures were confluent (80–100%); medium was changed every 3-4 days. The amount of vital cells was determined by trypan blue staining (Sigma-Aldrich Chemie GmbH, Munich, Germany). A total of 107 cells were washed three times in serum-free medium and incubated in freshly FCS-free medium for a further 24 h. For gelatine zymography and Western blotting the supernatant was collected and stored at –20 °C. For RNA isolation, adherent cells were washed with phosphate-buffered saline (PBS), treated with 0.5% trypsin, and harvested by centrifugation (5 min, 1400 × g). RNA Isolation and cDNA Synthesis. Total RNA was isolated from harvested cells (see above) using the peqGOLD Total RNA Kit (PeqLab Biotechnology GmbH, Erlangen, Germany) according to the manufacture’s instructions. To remove possible genomic DNA contaminations a DNase I digestion reaction mix, consisting of OBI DNase I Digestion Buffer and RNase-free DNase I (20 units/µL), was added directly to the surface of the HiBind spin column. Total RNA was eluted with RNase-free water and stored at –86 °C until use. RNA concentrations and its purity were measured with the Quant-iT RNA Assay Kit (Invitrogen, Karlsruhe, Germany).

1004 Bioconjugate Chem., Vol. 19, No. 5, 2008

Faust et al.

Scheme 2. Synthesis of the Barbiturate Precursor 5

Scheme 3. Labeling of the Precursor 5 with the Cyanine Dye Cy5.5

Prior to the reverse transcription reaction, total RNA was denatured at 65 °C for 10 min and subsequently placed on ice. Reverse transcription of RNA was performed using the RevertAid First Strand cDNA Synthesis Kit (MBI Fermentas, St. Leon-Roth) in a 20 µL reaction volume, consisting of 1 µg of total RNA, 5× reaction buffer, 1 mM of each nucleotide triphosphate, 20 units of RiboLock Ribonuclease Inhibitor, and 1 µL of random Hexamer (0.2 µg/µL). After incubation at 25 °C for 5 min, 200 units of RevertAid M-MuLV Reverse Transcriptase were added, and the reaction mixture was incubated according to the supplier’s instructions. Synthesized cDNA was stored at –20 °C until use.

Figure 1. HPLC chromatogram of the purified conjugate 6 (UV-trace).

PCR Conditions. Polymerase chain reaction (PCR) reactions were performed in a total volume of 25 µL, containing 0.2 mM of each nucleotide triphosphate, 1× PCR-buffer, 50 µM of each primer (see Table 2), 1 mM MgCl2, 1 unit of Taq DNA polymerase (PeqLab Biotechnologie GmbH, Erlangen, Germany), and 1 µL of synthesized cDNA. Thermal cycling conditions comprised an initial degradation step (94 °C, 3 min) and 35 cycles at 94 °C for 30 s, 60 °C for 20 s, and 72 °C for 30 s, followed by a final elongation step (72 °C, 1 min) in an Eppendorf Mastercycler EP Gradient (Eppendorf AG, Hamburg, Germany). PCR products were separated by agarose gel electrophoresis (2%) (Biozym Diagnostik GmbH, Oldendorf,

Fluorescent Photoprobe for Imaging MMPs

Figure 2. MMP-2 and -9 expression, secretion, and activity tests. Gelatinolytic activity of cell extracts was determined by zymography (A). Inhibition of the gelatinolytic activity with 5 (B). Western blot analysis of cell supernatants to detect pro-MMP-2, MMP-2 (C), proMMP-9, and MMP-9 (D). Semiquantitative PCR analysis was performed with the primer pairs listed in Table 2, specific for MMP-9 (E), MMP-2 (F), or β-Actin (G).

Germany). Fragment sizes were determined using the 50-bp DNA ladder standard (MBI Ferments, St. Leon-Rot, Germany). Gelatine Zymography. Gelatine zymography was performed as described previously with minor modifications (20). Twenty microliters of FCS-free cell supernatant from 1 × 107 cells were mixed with (4×) SDS sample buffer without reducing agent and separated in a sodium dodecyl sulfate (SDS)-polyacrylamide electrophoretic gel (PAGE) (0.75 mm comb, 4 °C, 150 V). The 7% separating SDS gel contained 0.6 g/L gelatine to detect latent and activated forms of gelatinases. Following electrophoresis, the gel was washed twice in 2.5% Triton X-100 for 30 min at room temperature with shaking to remove residual SDS. Subsequently, zymograms were developed by incubation overnight at 37 °C with gentle shaking in collagenases buffer (50 mM Tris-HCl pH 7.8, 10 mM CaCl2) and afterward stained/ destained with 1% Coomassie Brillant Blue G-250 dissolved in 10% ethanol and 5% acetic acid at room temperature for 120 min. Active MMP-2 from human fibroblasts and MMP-9 from human recombinant NSO cells (Sigma-Aldrich Chemie GmbH, Munich, Germany) were used as a gelatinase control. Gelatinolytic/proteolytic activity was visible as clear bands (zones of gelatine degradation) against a dark blue background of stained gelatine.

Bioconjugate Chem., Vol. 19, No. 5, 2008 1005

Western Blot Analysis. Total protein was separated in nonreducing SDS-PAGE electrophoresis using separating gels with 10% and stacking gels with 4.5% polyacrylamide. Lanes were loaded with 20 µL of FCS-free cell supernatant and mixed with (6×) SDS buffer. After electrophoresis (4 °C, 100 V), proteins were transferred to PVDF membranes (Millipore Corporation, Bedford, MA) via electroblotting (4 °C, 60 V). Blots were blocked in tris-buffered saline-NaCl, pH 7.4, containing 1% bovine serum albumin, 0.5% milk powder (Carl Roth GmbH & Co KG, Karlsruhe, Germany), and 0.1% Tween 20, washed, and incubated at 37 °C for 120 min with 1:500 diluted primary polyclonal antibody against MMP-2 (Cell Signaling, New England Biolabs GmbH, Frankfurt a. M., Germany), which detects full length proenzyme (72 kDa) and cleaved active enzyme (64 kDa). Subsequently, blots were washed three times in tris-buffered saline, pH 7.4, containing 0.5% milk powder and 0.1% Tween 20 and incubated with 1:1000 diluted peroxidase-conjugated goat antirabbit IgG antibody (Vector, Burlingame, U.S.A.). Following three washing steps, peroxidase activity was revealed using ECL chemiluminescence (Amersham, Buckinghamshire, U.K.) according to the manufacturer’s instructions to visualize signals. MMP-2 from human fibroblasts (Sigma-Aldrich Chemie GmbH, Munich, Germany) was used as a positive control. In Vitro Cell Assays. The cell-based binding assay was performed in U-shaped polypropylene 24-well plates (Nunc); each well was seeded with 2.5 × 104 cells and grown in 1 mL of medium to confluence. Briefly, after washing the wells with PBS, 150 µL of preincubation buffer (50 mM Tris-HCl, 10 mM CaCl2, 62 mM ZnSO4, pH 7.4), with or without predosing using 50 µM 5, was added to each well and incubated for 30 min at 37 °C. Following incubation, the preincubation buffer was replaced by binding buffer (50 mM Tris-HCl, 10 mM CaCl2, 30 mM ZnSO4, pH 7.4) containing 2 nmol of 6. After an incubation time of 120 min at 37 °C, cells were washed with PBS, and subsequently 300 µL of medium/trypan blue solution (2:1 (v/v); Sigma-Aldrich Chemie GmbH, Munich, Germany) was added. Cells could be directly visualized by fluorescence microscopy (Nikon TE 2000-S, Tokyo, Japan) which was equipped with a mercury vapor lamp, 620/775 nm (excitation/ emission) filters (AHF Analysentechnik AG, Tübingen, Germany), and a Nikon DXM1200F camera using the NIS-Elements BR 2.30 sofware (Nikon, Tokyo, Japan).

RESULTS AND DISCUSSION As MMPs are involved in the regulation of the tumor microenvironment and expressed and activated in many types of human cancers, this distinct enzyme class appears to be a molecular target for imaging of cancer in vivo (8). The selective targeting of MMP-2, -9, and -14 may help to visualize tumor angiogenesis. These three MMPs are most consistently detected in malignant tissues in which they are associated with tumor aggressiveness, metastatic potential, and poor prognosis (9, 21). Increased levels of activated MMPs in inflammatory, malignant, and degenerative diseases have been attributed to increased cytokine and growth-factor-stimulated gene transcription, enhanced zymogen activation, and an imbalance in the MMP: TIMP ratio, which can be used as a “noninvasive” diagnostic test for bilharzial bladder cancer (22, 23). The objective of this work was the modification of an existing lead structure (barbiturate) with a fluorescent dye, to allow nearinfrared detection of the target enzymes. Taking into account the size of the dye molecule compared to that of the parent inhibitor, we have chosen a short PEG spacer to distance the dye from the MMP-binding site and preserve the desired binding affinity for gelatinases as outlined in Table 1. Furthermore, optical imaging techniques allow the detection of molecules in

1006 Bioconjugate Chem., Vol. 19, No. 5, 2008

Faust et al.

Figure 3. Fluorescence microscopy of the in vitro cellular assay of HT-1080, MCF-7, and A-673 cells, in the presence or absence of protease inhibitor 5 (50 µM) incubated with the Cy 5.5 labeled ligand 6 (2 nmol).

picomolar (10-12 M) concentrations, which is comparable to conventional scintigraphic imaging techniques. As well as high signal-to-noise ratios (SNRs), imaging in the near-infrared spectrum (λ ) 650-950 nm) shows very efficient tissue penetration as the absorption by water and hemoglobin is relatively low (“diagnostic window”) (24, 25). Chemistry. The PEGylated piperazine derivative 2 was prepared as illustrated in Scheme 1. Mesylation of tetraethylene glycol and subsequent mono-substitution with sodium azide on a large scale gave the PEGylated azide derivative 1 in a satisfactory yield. Nucleophilic substitution of the mesyl moiety with Boc-protected piperazine and subsequent deprotection with trifluoroacetic acid yielded the desired piperazine derivative 2 (26). To synthesize the barbiturate 3 (Scheme 2), in the first steps a Pd-catalyzed C-C bond formation followed by a condensation with urea was used (27). After bromination with N-bromo succinimide in DMF we linked the barbiturate with the PEGylated piperazine derivative 2 to get the PEGylated barbiturate 4. For labeling with the NHS-ester of the commercially available cyanine dye Cy 5.5 it was necessary to reduce the azide function by a Staudinger reaction to get the precursor 5 in good yields. Fluorochrome Conjugation. The amino functionalized compound 5 was used for the conjugation of Cy 5.5. The reaction was carried out in dry DMF with triethyl amine as the base (Scheme 3). The conjugate 6 was purified by reversed phase HPLC on an analytical column by collection of the appropriate fractions. After lyophilization and redissolving in PBS the sample showed a purity of >98% (HPLC) (Figure 1). The labeled ligand was verified by mass spectrometry with a triple negative charged ion emerging at 100% intensity. With a molecular mass of 1.45 kD the resulting probe belongs to the small molecule tracers. Moreover, the tracer’s excitation and emission spectra were identical to that of the Cy 5.5 dye (Ex, 678 nm; Em, 692 nm). In Vitro Enzyme Studies. The inhibition potencies of the barbiturates 4 and 5 and the conjugate 6 were measured for MMP-2 and MMP-9 using fluorogenic in vitro assays. The resulting MMP inhibitions were determined as IC50 values and calculated from a nonlinear regression fit of the concentrationdependent reaction rates. Both PEGylated barbiturates (MMP-2

and -9) and the conjugate 6 (MMP-2) show binding in the nanomolar range (Table 1), and these results were confirmed by zymography assays showing the potency of the labeled barbiturate 6 (Figure 2). MMP-2 and -9 Transcription, Translation, and Activity Tests. For the biological characterization of 6 in vitro experiments on different cell lines were performed with respect to target expression on the genomic, proteomic, and functional level. To determine whether the chosen cell lines express and synthesize functional MMP-2 and -9, a semiquantitative PCR analysis, Western blots, and zymography were performed. In the PCR analysis, MMP-2 and MMP-9 mRNA expression of the three human carcinoma cell lines were normalized by using the house keeping gene β-Actin. Whereas the rhabdomyosarcoma cell line A-673 expressed both MMPs, the fibrosarcoma cell line (HT-1080) only transcribed MMP-2 and the MCF-7 produced neither MMP-2 nor MMP-9 mRNA at detectable levels (Figure 2 E-G). The expression of both enzymes on the protein level was assessed by Western blotting with polyclonal antibodies against MMP-2 and MMP-9. These antibodies recognize the latent and active MMP forms and, therefore, reflect the cell lines via de novo synthesis levels of both enzymes (Figure 2 C,D). Similarly to the PCR results, Western blot analysis demonstrated that the human carcinoma cell line MCF-7 did not secrete MMP-2 and MMP-9 at detectable levels. However, activated MMP-2 (64 kDa) was secreted by HT-1080 and A-673 cells, respectively. Furthermore, in the A-673 supernatant pro-MMP-9 (92 kDa) and the active MMP-9 form (84 kDa) could be detected. Positive controls, that is, purified enzymes, give also clear signals as shown in Figure 2 C,D. The zymography perfectly corresponds to the results obtained by semiquantitative PCR and Western blot analysis. Gelatinolytic bands were visible for the cell lines HT-1080 and A-673, which secret active MMP-2 (62 kDa) with nearly similar levels. In addition to MMP-2 activity, MMP-9 (72 kDa) gelatinase activity was only detectable in the rhabdomyosarcoma cell line A-673. No gelatinase activity could be shown for the cell line MCF-7 (Figure 2 A). Incubation of the zymogram with the nonlabeled barbiturate 5 (100 µM) inhibited the MMP-2 and MMP-9 gelatinolytic activity,

Fluorescent Photoprobe for Imaging MMPs

completely confirming efficient binding of the probe precursor 5 (Figure 2 B). Zymographical analysis corroborated the former analysis and revealed the barbiturate 6 as a potential MMP-2 and -9 inhibitor. Therefore we used the Cy 5.5labeled barbiturate in an in vitro cell binding assay in order to support these findings. In Vitro Cellular Assay. Functionally active MMP-2 and MMP-9 ligands should bind to secreted MMP-2 and/or MMP-9 of monolayer cells. Indeed, a strong fluorescence signal was obtained from the surface of A-673 cells, which were shown to secret both MMP-2 and MMP-9 (Figure 3). The HT-1080 monolayer fluorescence was less powerful compared to that of A-673, and MCF-7 cells again failed to show the corresponding MMP activities. Predosing experiments using 50 µM of the unlabeled barbiturate 5 successfully blocked the binding of the Cy 5.5-labeled ligand 6 (Figure 3). In every case the cell integrity and viability were confirmed by a trypan blue test. The aim of this work was to develop a nonpeptide MMPI with high MMP binding potency which is applicable for optical imaging of MMP-2 and -9. We have chosen a barbiturate as the lead structure and developed a route for the synthesis of an amino-PEG-derivatized compound which can be used for the conjugation of common amino-reactive fluorescent markers such as Cy 5.5. Thus, we obtained a nearinfrared fluorescent photoprobe for the imaging of MMP-2 and -9. Applying semiquantitative PCR, Western blot analysis, and zymograms we checked not only the cells’ transcriptional and translational levels but also their secretion levels and the functionality of the secreted MMPs. Taking this into account, the unlabeled barbiturate 5 blocked both MMP-2 and MMP-9 activities. Additional binding studies in vitro proved the inhibition capacities of the precursor 5 and revealed the specific binding capacities of the Cy 5.5labeled ligand 6. Thus, MMP-2 and -9 imaging with the fluorescent labeled probe 6 is feasible and should be applicable to imaging modalities to monitor activiated MMP-2 and -9 associated disease processes such as invasion, metastasis, and angiogenesis in cancer in vivo.

ACKNOWLEDGMENT This work was supported by the Deutsche Forschungsgemeinschaft (SFB 656 project A4) and European Community (IP 6th framework; Grant LSHG-CT-2003-503259 (Mol. Img) and MoldDiag-Paca LSHB- CT-2006-018771). Thanks are due to Susanne Greese, Wiebke Gottschlich, Ulla Römer, Sandra Schröer, and Ingrid Otto-Valk for technical assistance, Prof. Dr. H. Luftmann at the Organic Chemistry Department of the WWU Münster for mass spectrometry, and Dr. Marilyn Law for reading the manuscript.

LITERATURE CITED (1) Skiles, J. W., Gonnella, N. C., and Jeng, A. Y. (2004) The design, structure, and clinical update of small molecular weight matrix metalloproteinase inhibitors. Curr. Med. Chem. 11, 2911– 2977. (2) Tayebjee, M. H., Lip, G. Y. H., and MacFadyen, R. J. (2005) Matrix metalloproteinases in coronary artery disease: clinical and therapeutic implications and pathological significance. Curr. Med. Chem. 12, 917–925. (3) Beaudeux, J. L., Giral, P., Bruckert, E., Foglietti, M. J., and Chapman, M. J. (2004) Matrix metalloproteinases, inflammation and atherosclerosis: therapeutic perspectives. Clin. Chem. Lab. Med. 42, 121–131. (4) Overall, C. M., and López-Otín, C. (2002) Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat. ReV. Cancer 2, 657–672.

Bioconjugate Chem., Vol. 19, No. 5, 2008 1007 (5) Tayebjee, M. H., Lip, G. Y., and MacFadyen, R. J. (2005) Matrix metalloproteinases in coronary artery disease: clinical and therapeutic implications and pathological significance. Curr. Med. Chem. 12, 917–925. (6) Folgueras, A. R., Pendas, A. M., Sanchez, L. M., and LóezOtín, C. (2004) Matrix metalloproteinases in cancer: from new functions to improved inhibition strategies. Int. J. DeV. Biol. 48, 411–424. (7) Stamenkovic, I. (2003) Extracellular matrix remodelling: the role of matrix metalloproteinases. J. Pathol. 200, 448–464. (8) Vihinen, P., Ala-aho, R., and Kahari, V. M. (2005) Matrix metalloproteinases as therapeutic targets in cancer. Curr. Cancer Drug Targets 5, 203–220. (9) Egeblad, M., and Werb, Z. (2002) New functions for the matrix metalloproteinases in cancer progression. Nat. ReV. Cancer 2, 161–174. (10) Heeneman, S., Cleutjens, J. P., Faber, B. C., Creemers, E. E., van Suylen, R-J., Lutgens, E., Cleutjens, K. B., and Daemen, M. J. (2003) The dynamic extracellular matrix: intervention strategies during heart failure and atherosclerosis. J. Pathol. 200, 516–525. (11) Galis, Z. S., and Khatri, J. J. (2002) Matrix metalloproteinases in vascular remodeling and atherogenesis: the good, the bad, and the ugly. Circ. Res. 90, 251–262. (12) Galis, Z. S. (2004) Vulnerable plaque: the devil is in the details. Circulation 110, 244–246. (13) Newby, A. C. (2005) Dual role of matrix metalloproteinases (matrixins) in intimal thickening and atherosclerotic plaque rupture. Physiol. ReV. 85, 1–31. (14) Grams, F., Brandstetter, H., D’Alo, S., Geppert, D., Krell, H. W., Leinert, H., Livi, V., Menta, E., Oliva, A., and Zimmermann, G. (2001) Pyrimidine-2,4,6-triones: a new effective and selective class of matrix metalloproteinase Inhibitors. Biol. Chem. 382, 1277–1285. (15) Brandstetter, H., Grams, F., Glitz, D., Lang, A., Huber, R., Bode, W., Krell, H. W., and Engh, R. A. (2001) The 1.8-Å crystal structure of a matrix metalloproteinase-8 barbiturate inhibitor complex reveals a peviously unobserved mechanism for collagenase substrate recognition. J. Biol. Chem. 276, 17405–17412. (16) Dunten, P., Kammlott, U., Crowther, R., Levin, W., Foley, L. H., Wang, P., and Palermo, R. (2001) X-ray structure of a novel matrix metalloproteinase inhibitor complexed to stromelysin. Protein Sci. 10, 923–926. (17) Breyholz, H. J., Schäfers, M., Wagner, S., Höltke, C., Faust, A., Rabeneck, H., Levkau, B., Schober, O., and Kopka, K. (2005) C-5-disubstituted barbiturates as potential molecular probes for non-invasive MMP imaging. J. Med. Chem. 48, 3400–3409. (18) Wagner, S., Breyholz, H. J., Faust, A., Höltke, C., Levkau, B., Schober, O., Schäfers, M., and Kopka, K. (2006) Molecular imaging of matrix metalloproteinases in ViVo using small molecule inhibitors for SPECT and PET. Curr. Med. Chem. 13, 2819–38. (19) Huang, W., Meng, Q., Suzuki, K., Nagase, H., and Brew, K. (1997) Mutational study of the amino-terminal domain of human tissue inhibitor of metalloproteinasees 1 (TIMP-1) locates an inhibitory region for matrix metalloproteinases. J. Biol. Chem. 272, 22086–22091. (20) Heussen, C., and Dowdle, E. B. (1980) Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal. Biochem. 102, 196–202. (21) Fingleton, B. (2003) Matrix metalloproteinase inhibitors for cancer therapy: the current situation and future prospects. Expert Opin. Ther. Targets 7, 385–397. (22) George, S. J. (2000) Therapeutic potential of matrix metalloproteinase inhibitors in atherosclerosis. Exp. Opin. InVest. Drugs 9, 993–1007. (23) Eissa, S., Ali-Labib, R., Swellam, M., Bassiony, M., Tash, F., and El-Zayat, T. M. (2007) Noninvasive Diagnosis of Bladder Cancer by Detection of Matrix Metalloproteinases (MMP-2 and

1008 Bioconjugate Chem., Vol. 19, No. 5, 2008 MMP-9) and Their Inhibitor (TIMP-2) in Urine. Eur. Urol. 52, 1388–1397. (24) Bremer, C., Ntziachristos, V., Weitkamp, B., Theilmeier, G., Heindel, W., and Weissleder, R. (2005) Optical imaging of spontaneous breast tumors using protease sensing ‘smart’ optical probes. InVest. Radiol. 40, 321–327. (25) Ntziachristos, V., Bremer, C., Graves, E. E., Ripoll, J., and Weissleder, R. (2002) In vivo tomographic imaging of nearinfrared fluorescent probes. Mol. Imaging 1, 82–88.

Faust et al. (26) Tahtaoui, C., Parrot, I., Klotz, P., Guillier, F., Galzi, J. L., Hibert, M., and Ilien, B. (2004) Fluorescent pirenzepine derivatives as potential bitopic ligands of the human M1 muscarinic receptor. J. Med. Chem. 47, 4300–4315. (27) Hutchings, S., Liu, W., and Radinov, R. (2006) Heterocycles 67, 763–768. BC700409J