Bloconjugate Chem. 1993, 4,549-553
548
Synthesis and Ribosome Binding Properties of Model mRNAs Modified with Undecagold Cluster Eugene Skripkin,*-+Gulnara Yusupova,* Marat YUSUPOV,* Pascal Kessler,s Chantal Ehresmann, and Bernard Ehresmann UPR 9002 du CNRS, Institut de Biologie Mol6culaire et Cellulaire, 15 rue Ren6 Descartes, 67084 Strasbourg Cedex, France, Institute of Protein Research, Russian Academy of Science, 142292 Pushino, Moscow Region, Russian Federation, and CEA, Centre #Etudes de Saclay, DIEP, Batiment 152, 91191 Gif-sur-Yvette Cedex, France. Received July 20, 1993"
The synthesis and purification of short model messenger RNAs modified with undecagold cluster are described. A monoamino undecagold cluster was introduced on the oxidized 3' cis-glycol group of the mRNA followed by reduction of the formed Schiff s base. The stability of the modified mRNA under the conditions used for in vitro messenger RNA translation is studied. The possibility of the formation of a specific translational initiation complex with bacterial ribosomes and modified mRNAs is shown. The results of these experiments indicate that the attachment of an undecagold cluster to a mRNA is a useful tool for electron microscopic and crystallographic studies.
INTRODUCTION Heavy-metal-atom derivatives have successfully been used in protein crystallography and are undoubtedly good tools for structural determination of large particles, like ribosomes. Crystals of ribosome particles have already been obtained from different microorganisms, and X-ray analysis of these crystals are in progress (for reviews see e.g. refs 1and 2). For correct phase determination of such large ribonucleoprotein complexes (molecular weight 2 700 000) it is necessary to place a compact heavy-atom cluster to one site on the ribosomal surface. Undecagold clusters (AuC)' containing 11gold atoms in a central core surrounded by triarylphosphine ligands and coordinating counterions (Figure 1)are a suitable tool for this purpose (3-6). The peripheral amide groups provide the water solubility and the amino group raises the possibility to produce labeling reagent with different specificities. One easy way to obtain heavy-atom derivatives of ribosomes is to soak them in a gold cluster solution, leading to their equilibrium binding to the crystalline molecule. However, such big particles have a large surface area, leading to the potential binding of a variable number of clusters to a single ribosome. A way to overcome this problem is to use heavy-atom derivatives of nonribosomal components such as tRNA or messenger RNA, which are able to form stable functional complexeswith the ribosome. Such RNAs have the advantage that the aldehyde generated by oxidation from the free cis-glycol group of the
* Author to whom correspondence should be sent. Present address: Institut de Biologie Molbculaire et Cellulaire, 15 rue Renb Descartes, 67084 Strasbourg Cedex, France. Tel.: 33.88.41.70.53.FAX: 33.88.61.06.80.E-mail:
[email protected] + On leave from Moscow State University, Moscow, W-234, Russian Federation. Russian Academy of Science. 1 CEA. Abstract published in Advance ACS Abstracts, October 15, 1993. 1 Abbreviationsused (in order of appearence in the text): AuC, undecagold cluster; PCR, polymerase chain reaction; DTE, dithioerythritol, Cleland's other reagent; BSA, bovine serum albumin; SDS, sodium dodecyl sulfate; SD sequence, ShineDalgarno sequence; RBS, ribosome binding site. @
7043-7002/93/29Q4-0549$04.00/0
0 H~CHN-(
h
0
=w z H C H 3 X = HC03-
.
= ALI
Figure 1. Monofunctional undecagold cluster with a dense core (0.8 nm in diameter) of 11gold atoms surrounded by an organic
shell.
3'-terminal ribose can be readily coupled to the amino group of the gold cluster (4). Recently, two different functional ribosome/mRNA/ tRNA complexes have been obtained in similar crystal forms (7, 8). It was also demonstrated that it is possible to selectively label a tRNA (yeast tRNAPhe)by a gold cluster, although in this case by a different chemistry (9). In the present work, we describe the labeling procedure of a short mRNA by the undecagold cluster. The ability of AuC-modified mRNAs to form a translational initiation complex between the small ribosomal subunit from Escherichia coli and initiator tRNA'etf was tested and compared with that of natural mRNAs. EXPERIMENTAL PROCEDURES Materials. Restriction endonuclease BamHI was from New England Biolabs. Taq DNA polymerase was from GIBCO BRL. Placental RNase inhibitor (RNasin) was from Promega Biotec. Phage T7 RNA polymerase was purified from the overproducing strain BL21/pAR1219, kindly supplied to us by F. W. Studier (Upton, NY). tRNAMeYwas purchased from Boehringer Manheim. M13 0 1993 American Chemical Society
550
8ioconjug8te Chem., Vol. 4, No. 6, 1993
reverse-sequence primer dCAGGAAACAGCTATGAC and primer complementary to X cro-mRNA dTGCGTTGTTCCATAC were synthesized on Applied Biosystems 392 DNA/RNA Synthesizer by A. Hoeft (Strasbourg, was from Amersham. 2-MercapFrance). [CY-~~PIATP toethanol, acrylamide, and N,N'-methylenebisacrylamide were from ROTH. Plasmid Isolation and Purification. Construction of the plasmid pMZ31, containing the fragment of the coding part of the cro-mRNA of the bacteriophage X under control of the T7 promoter, has been described previously in ( I O ) . E. coli strain XL1-Blue (Stratagene) was used for plasmid manipulation and preparation. Standard procedures were used for isolation and purification of the plasmid (II). Amplification of DNA. A double-stranded DNA fragment was prepared by the polymerase chain reaction (PCR)technique from plasmid pMZ3l ( I O ) , using the M13 reverse-sequencing primer for coping the sense chain and the primer complementary to the coding region of cromRNA to position +13 (the A residue of the AUG codon being +1)for amplification of the antisense chain of the minigene. Fifty picomoles of the reverse M13 and mRNA(+13) primers and 0.05 pmol of pMZ31 DNA were amplified up to 25 cycles in 70 pL of PCR buffer containing 10 mM Tris-HC1 (pH 8.8), 2 mM MgClz, 50 mM NaC1, 0.05 mM of each dNTP, and 2.5 units Taq DNA polymerase, at 95 "C for 1.5 min, 48 "C for 1.5 min, 72 "C for 1 min and then extented at 70 "C for 5 min. Amplified DNA was purified by phenol-chloroform extraction and ethanol precipitation. Preparation of Model mRNA. Two synthetic RNAs were used for modification by the amino undecagold cluster: mRNA (+26), pppGGCAAGGAGGUUGUAUGGAACAACGCAUAACCUUGGGAUC;mRNA (+13), pppGGCAAGGAGGUUGUAUGGAACAACGCA. mRNA(+26) was obtained by T7 RNA polymerase directed transcription of plasmid pMZ31 DNA linearized by restriction endonuclease BamHI. The only site of recognition of this endonuclease is located at position +26 of the coding part of the minigene ( I O ) . mRNA(+13) is a 27mer corresponding to a 13-nucleotide-shorter derivative of the same coding region of the above mRNA, obtained byT7 RNA polymerase directed transcription of the DNA fragment described in the previous section. DNA (20 pmol) was incubated in 0.1 mL of T7 transcription buffer containing 40 mM Tris-HC1 (pH 8.1 a t 37 "C), 2.5 mM spermidine, 12.5 mM DTE, 0.03 mg/mL BSA, 5 mM UTP, CTP, and GTP, 50 pM ATP supplemented with 30 pCi of [aJ2P]ATP, 270 units of T7 RNA polymerase, and 200 units of RNasin, a t 37 "C for 1h. The concentration of ATP was then increased to 5 mM, 270 units of T7 RNA polymerase was added, and the mixture was incubated for 50 min at 37 "C. The solution was extracted with phenol, and the mRNA was precipitated with ethanol, dissolved in water, and purified by electrophoresis in a 12 % polyacrylamide (19/1 bis)-7 M urea gel. After elution with 0.3 M sodium acetate, pH 7.0, 0.1% SDS and 1/4 v/v buffer-saturated phenol, the mRNA was precipitated with ethanol and the pellet was suspended in the water. Synthesis of Monoamino Undecagold Cluster. The monoamino undecagold cluster was prepared as described (5) and stored as a 21 mM solution in ethanol at -20 "C. Modification of the 3'End of the mRNA or DNA by Monoamino Undecagold Cluster. The mRNA (5 pM) in 10 mM sodium acetate buffer (pH 4.5) containing 10 mM NaIO4 was incubated for 1h at 20 "C in the dark. The
Skripkin et al.
oxidized mRNA was precipitated by ethanol, dissolved in the same volume of 0.1 7% ethylene glycol and incubated for 30 min a t 0 "C to remove the excess of NaIO4. The mRNA was purified by reprecipitation with ethanol and dissolved in 50 mM sodium borate buffer (pH 9.0) to a final concentration of 25 pM. Monoamino undecagold cluster was added to a concentration of 1 mM. The reaction mixture was allowed to stand in the dark for 1214 h at 4 "C. Then 1/20 (v/v) NaBH4 (100 mg/mL) in 50 mM sodium borate buffer (pH 9.0) was added twice each time followed by 30-min incubation at 4 "C. The mRNA was precipitated with ethanol and purified by electrophoresis in 10% polyacrylamide gel (19/1 bis) 50 mM Trisborate buffer (pH 8.3) without urea and EDTA. After elution with water a t 4 "C, GC-modified mRNA was precipitated with ethanol and dissolved in water. Gold determination in the complex was performed by thermoelectric atomization in a graphite oven (HGA-500). Formation and Analysis of 30S/mRNA/tRNA Complex. E. coli ribosomal 30s subunits were prepared from 70s ribosomes as described in ref 12 and generously provided for this work by Dr. C. Philippe (Strasbourg, France). Ribosomal 30s subunits were previously activated at a concentration of 4 mM by heating for 15 min at 37 "C. Then, 8 pmol of 30s subunits and a corresponding amount of mRNA were incubated for 5 min a t 37 "C in 0.05 mL of 20 mM Tris acetate buffer (pH 7.5) containing 10 mM magnesium acetate, 60 mM ammonium acetate, 2 mM 2-mercaptoethanol (binding buffer). Four micrograms (160 pmol) of E. coli initiator tRNAMetfwas added and incubated for 5 min a t 37 "C. The incubation mixture was loaded on an FPLC TSK 400 gel-filtration column (Bio-Rad) equilibrated with the binding buffer. Elution was with the binding buffer. Fractions (300-pL) were collected and counted. RESULTS AND DISCUSSION
Choice of the Model mRNA. To obtain a translational initiation complex very similar to the natural one, we synthesized a short-model mRNA containing the determinants crucial for the formation of a stable initiation complex between the mRNA and the ribosome (see for review ref 13): the translational initiation codon (usually AUG), the polypwine-rich Shine-Dalgarno (SD)sequence located upstream from the initiator codon, and the absence of strong secondary interactions between these two determinants and the rest of the polynucleotide chain. We decided to use the mini-cro-mRNA, a short message containing the intact ribosome binding site (RBS) of the bacteriophage X cro gene (14). This RBS includes an extended (nine-nucleotides-long)SD sequence located only three nucleotides upstream from the initiator AUG codon. Also, this message becomes single-stranded after formation of the ternary complex with the initiator tRNA and the small ribosomal subunit (14). The natural cro-mRNA contains, besides the initiator AUG codon in the RBS, an additional AUG codon on the 5' end. Balakin et al. (15) showed that at least i n vitro this particular initiator codon can participate in the formation of aberrant initiation complexes. To avoid this, mRNAs were constructed in which this codon was eliminated. This could easily be done during replacing the original X PRpromotor by the T7 promotor (10). Also, the size of the sequence downstream from the initiaton codon of mRNAs is essential. Indeed it has been shown that the region covering the first five codons is in tight contact with the ribosomal 30s subunit and is sufficient to allow stable ternary 30S/ mRNA/initiator tRNA complex formation as shown by
BkxmJugate chem.,Vd. 4, No. 6, 1993 551
undecagold cluster ModfkatlOn of mRNAs 1
2
3
Table I. Competition for Ribosome Binding between Undecagold Cluster Labeled and Control mRNAs(+l3)
4
control mRNA
-B
bMuC --+
monoAuC -D
RNA(+%)
4-
blAuC
4-
monoAuC
4-
RNA(+13)
AuC-modified mRNA
1174 1143 1020 32P-labeledmRNA (cpm) 1402 32P-labeledmRNA (pmol) 0.37 0.31 0.45 0.43 cold mRNA (pmol) 5.4 5.4 mRNA (cpm) in the 939 483 762 335 30s fraction0 total mRNA (pmol) 0.25 2.35 0.3 1.91 in the 30s fractiono OContains 4 pmol of 30s ribosomal eubunita and 20 pmol of tRNAMeY.
Figuw 2. Nondenaturing gel electrophoresis of unmodified and undecagold cluster modified mini-cro-mRNk lane 1, unmodified mRNA(+26); lane 2, unmodified mRNA(+13);lane 3, AuCmodified mRNA(+26); lane 4, AuC-modified mRNA(+13). Position of unmodified mRNA(+13), mRNA(+26),the mono gold cluster adduct (monoAuC), and postulated dimeric gold cluster adduct (biAuC) are marked by arrows.
toeprinting experiments (13). As shown by cross-linking experiments, even region +18 to +22 of the mRNA was able to interact with such region of the ribosome as the 5’end of 16s rRNA or ribosomal proteins S2/S3 (10;Bakin, A., Skripkin, E., and Shatsky, I., unpublished results). The first model mRNA contains 13 nucleotides downstream from the initiator AUG. It means that in this case we can expect the bulky AuC-constituent on the 3’ end of the model mRNA to be situated a t the edge of the ribosomal subunit. T o exclude any interference during complex formation between the modified polynucleotide chain and the mRNA binding site of the ribosome, the size of the second mRNA region downstream AUG was increased to 26 nucleotides. Synthesis of mRNA Derivatives. The monoamino undecagold cluster (Figure l ) , synthesized as described earlier (5),was linked to the 3’end of the mini-cro-mRNAs by Schiffs base formation, which was then stabilized by reduction with sodium borohydride. To monitor all steps of the synthesis and next binding experiments, the mRNA was labeled during T 7 transcription with radioactive [a-32P] ATP. The oxidation-reduction conditions were used according to ref 17 with some modification. The yield of the reaction was estimated by counting radioactive bands after electrophoretic separation in 10% nondenaturing polyacrylamide gel (Figure 2) or by HPLC reversephase separation on a C18 column (data not shown). The degree of modification was 25-35 % as calculated from the distribution of radioactivity either by direct counting of the radioactivity or by scanning of the gels with an image scanner (Fuji, Model BAS 2 0 0 0 ) . The bands marked as monoAuC on Figure 2 contain a near equimolar amount of the gold cluster per mRNA molecules, as was shown by atomic absorption analysis (Table 111). Some amount of product with higher molecular weight was found (seebands marked as biAuC in lanes 3 and 4, Figure 2). The yield of these dimeric side products was not higher than 10%. Their appearance could be due to the interaction of monoamino undecagold cluster with the second aldehyde group derived from ribose cis-glycol. In all binding experiments only monoadducts of mRNAs were used. Interaction of Undecagold Cluster Modified mRNA with the Ribosome. The binding of the mRNAs to the E. coli ribosomal 30s subunits was performed with unmodified mRNAs, mRNAs after oxidation and following reduction of the 3’ end cis-glycol, and mono undecagold cluster derivatives of the mRNA(+13) and mRNA(+26). T o study initiation complex formation, binary mRNA-
Table 11. Stability of Undecagold Cluster Modified mRNA( +13) incubation incubation without in the with ribosomee treatment binding buffer and tRNA 76 AuC-modified RNA in the mixture
23
17.5
18.6
30s ribosomal subunit complex formation as the first step with subsequent initiator tRNAMetf addition was used (14). After incubation with tRNA, the mixture was loaded on an FPLC TSK-400 gel-filtration column. Typical distributions of radioactivity for ribosomal complexes are shown in Figure 3. The major peak of radioactivity comigrates with the UV-detected peak of ribosomal subunits. Figure 4 expresses ternary 30s subunit/mRNA/ tRNAMetfcomplex formation as a function of the 30s: mRNA ratio. From these results we can conclude that the binding level of the AuC-modified and control mRNAs is very similar. The slightly lower yield reproducibly obtained in the case of AuC-modified mRNA(+13) compared to unmodified mRNA(+13) can easily be interpreted as due to some steric hindrance of the undecagold cluster a t the 3’ end due to the shorter length of the AUG downstream region, as was mentioned above. However, the markedly lower yield of complex formation with both control and AuC-modified mRNAs(+26) compared to the mRNA(+13) should be noted. This mRNA contains in comparison with mRNA(+13) an additional nucleotide sequence. Part of this sequence (CCUUG) is able to interact with 5’ half of the SD sequence (CAAGG) and to compete with the anti-SD sequence of the ribosomal subunit. The specificity of binding of the AuC-modified mRNA was checked in competition experiments with unmodified mRNA. In a control experiment, an 18 times dilution of 32P-labeled mRNA(+13) with unlabeled mRNA( +13) increased the mRNA binding from 5% to 60% per ribosomal subunit. For gold cluster modified mRNA(+13), 14 times dilution with unmodified and nonradioactive sample also increased the binding from 7.5% (for 11molar excess of ribosomal subunits) to 48% (in the case 1.5molar excess of mixture of modified, radi active, and nonlabeled mRNAs) (see Table I); from thes, data we can conclude that modified mRNA(+13) has very similar specificity and other binding parameters as the control. Stability of Modified mRNA. T o determine the stability of the AuC-modified mRNAs, an unpurified mixture of modified and nonmodified mRNA(+13) was used. RNA samples were incubated in the binding buffer with or without initiator tRNAMeYandr i h o m a l subunits a t 37 “C. Electrophoretic analysis of AuC-modifled mRNA after incubation with ribosomes and tRNA shows that a t least 76% of mRNA is stable in the binding buffer and the
552
Bloconlugate Chem., Vol. 4, No. 6, 1993
Skripkin et
ai.
Table 111. Determination of Gold Atoms in Au-Modified mRNA(+26)
concentration of Au (mg/L) 37 f 4
amount of AuC in the sample (pmol) 1.80
amount of mRNA (pmol) 1.70
% modification of mRNA(+26) by AuC 106 f 11
0.90
1.11
81 f 8
0.43
0.85
51f8
0.60
1.30
46 f 5
AuC-mRN Aa (experiment 1) AuC-mRNA 29 f 3 (experiment 2) 30S/AuC-mRNA/ tRNAMe* 9.4 f 1.5 (experiment 1) 30S/AuC-mRNA/ tRNAMeY 13.2 f 1.5 (experiment 2) a mRNA(+26), modified by undecagold cluster. b Purified initiation
complex, isolated by gel filtration.
lo00
8M)
so
-
60
-
40
-
20
-
P
200
0
- T
0
10
20
30
40
50
I
0
N N hactbn
loo0
1
10
20
30
I
10
20
305:mRNA (moVmol)
.
0
J
40
50
60
NN t m c t h
Figure 3. HPLC gel filtration on TSK-400 column of the ternary
ribosomal 305subunit/mRNA/tRNAMeMcomplexes:panel 1,30S subunit (4pmol)/mini-cro-mRNA(+13) (0.6 pmol)/tRNAwY(20 pmol); panel 2, the similarly composed undecagold cluster modified mini-cro-mRNA(+ls) (0.3 pmol). The UV profile is shown below the radioactivity profile; arrows indicate peaks of 30s ribosomes initiation complexes, tRNAM*, and low molecular weight compounds (mRNA and salts). ternary complex formation does not destroy the modified mRNA (Table 11). The presence of gold atoms in the modified mRNA was verified by using the method of atomic absorption (Table 111). These data showed that after modification and purification of the modified mRNA(+26) by gel electrophoresis a t least 80 ?G of the mRNA molecules contained
Figure 4. Ternary ribosomal 305 subunit/mRNA/tRNAMeY complex formation as a function of the 30S:mRNA ratio: unmodified mRNA(+26) ( O ) , AuC-modified mRNA(+26) (01, unmodified mRNA(+13) (A),AuC-modified mRNA(+13) (A).
the complete gold cluster. However, after formation and isolation of the complex with the 30s ribosomal subunit and tRNA, the AuC-modified mRNA had lost approximately half of its gold atoms. Conclusion. In this work, we describe the synthesis and purification of a messenger RNA modified with undecagold cluster at its 3’ end. The AuC-modified mRNA is stable and active enough to form a ternary translational initiation complex in the presence of ribosomal 30s subunits and initiator tRNAMetf. Preliminary crystallographic experiments with ribosomes modified with a gold cluster showed that such undecagold clusters are suitable for the phasing of reflections from ribosomal crystals (6, 18). The lowresolution localization of the mRNA region downstream from the AUG codon by immune electron microscopy was already described on the small ribosomal subunit in the cleft region between head and body (19-21). This will obviously provide additional information for interpretation of the crystallographic signals. Although only 30-40 ?G of ribosomal complexes would carry a gold cluster, this yield should be suitable for phase determination, as already shown in the above mentioned crystallographic works (6,181 in which partial decomposition of the AuC-modified ribosomes was also observed. ACKNOWLEDGMENT We wish to thank Dr. C. Philippe (Strasbourg, France) and Dr. S. Kirillov (St. Petersburg, Russia) for providing us samples of 30s ribosomal subunits. We are indebted to Dr. A. Bentz, Centre de Rech. Nucl. (Strasbourg, France), for help in the gold determination, Dr. V. Shirokov
Undecagokl Cluster Modlfication of mRNAs
(Pushino, Russia), Dr. M. Gottikh, and Dr. A. Yolov (Moscow, Russia) for helpful discussions, and Dr. J. Ofengand (Nutley, NJ) for critical reading of the manuscript. G.Y. and E.S.are working in the frames of a Russian-French scientific cooperation and were supported by grants from CNRS. LITERATURE CITED (1) Yonath, A., Bennett, W., Weinstein, S., and Wittmann, H.
G. (1990) Crystallography and image reconstruction of ribosomes. In The Ribosome: Structure, Function and Evolution (W. E . Hill, A. E. Dalberg, R. A. Garret, 0. B. Moore, D. Schlessinger, and J. R. Warner, Eds.) pp 134-147, American Society of Microbiology, Washington, DC. (2) Yusupov, M. M., Garber, M. B., Vasiliev, V. D., and Spirin, A. S. (1991) Thermus thermophilus ribosomes for crystallographic studies. Biochimie 73, 887-897. (3) Bartlett, P. A., and Bauer, S. J. (1978) Synthesis of watersolubleundecagold cluster compoundsof potential importance in electron microscopicand other studies of biologicalsystems. J . Am. Chem. SOC.100, 5085-5089. (4) Lipka, J. J., Hainfeld, J. F., and Wall, J. S. (1983)Undecagold labeling of a glycoprotein: STEM visualization of an undecagoldphosphine cluster labeling the carbohydrate sites of human haptoglobin-hemoglobin complex. J. Ultrastructure Res. 84, 120-129. ( 5 ) Safer, D., Bolinger, L., and Leigh, J. S. (1986) Undecagold clusters for site-specific labeling of biological macromolecules: simplified preparation and model applications. J.Inorg. Biochem. 26, 77-91. (6) Weinstein, S., Jahn, W., Hansen, H., Wittmann, H. G., and Yonath, A. (1989) Novel procedures for derivatization of ribosomes for crystallographic studies. J. B i d . Chem. 264, 19138-19142. (7) Hansen, H. A. S., Volkmann, N., Piefke, J., Glotz, C., Weinstein, S., Makovski, I., Meyer, S., Wittmann, H. G., and Yonath, A. (1990) Crystals of complexes mimicking protein biosynthesisare suitable for crystallographicstudies. Biochim. Biophys. Acta 1050, 1-7. (8) Yusupova, G., Yusupov, M., Spirin, A., Ebel, J.-P., Moras, D., Ehresmann, C., and Ehresmann, B. (1991)Formation and crystallization of Thermus thermophilus 70s ribosome/tRNA complexes. FEBS Lett. 290, 69-72. (9) Hainfeld, J. F., Sprinzl, M., Mandiyan, V., Tumminia, S. J., and Boublik, M. (1991) Localization of a specific nucleotide in yeast tRNA by scanning transmission electron microscopy using an undecagold cluster. J. Struct. Biol. 107, 1-5.
Bioconjupte Chem., Vol. 4, No. 6, 1993
553
(10) Dontsova, 0. A., Rosen, K. V., Bogdanova,S. L., Skripkin, E. A., Kopylov,A. M., and Bogdanov, A.A. (1992)Identification of the Escherichia coli 30s ribosomal subunit protein neighbouring mRNA during initiation of translation. Biochimie 74, 363-371. (11) Maniatis, T., Fritsch, E. F., and Sambrook, J. (1983) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (12) Makhno, V. I., Pechin, N. N., Semenkov,Y. P., and Kirillov, S. V. (1988)The modified procedure of preparation of “tight” 70s ribosomes highly active in definite stages of elongation of translation. Mol. Biol. 22, 670-679 (RUBS.). (13) Gold,L. (1988) Posttranscriptional regulatory mechaniams in Escherichia coli. Annu. Rev. Biochem. 57, 199-233. (14) Balakin, A., Skripkin, E., Shatsky, I., and Bogdanov, A. (1990) Transition of the mRNA sequence downstream from the initiation codon into a single-stranded conformation is strongly promoted by binding of the initiator tRNA. Biochim. Biophys. Acta 1050, 119-123. (15) Balakin, A. G., Skripkin,E. A., Shat.aky,I.N., andBogdanov, A. A. (1992) Unusual ribosome binding properties of mRNA encoding bacteriophage X repressor. Nucleic Acids Res. 20, 563-571. (16) Balakin,A. G., Bogdanova,S. L.,andSkripkin,E. A. (1992) mRNA containing an extended Shine-Dalgarno sequence is translated independently of ribosomal protein S1. Biochem. Int. 27, 117-129. (17) Shatsky, I. N., Mochalova, L. V., Kojouharova, M. S., Bogdanov,A. A., and Vasiliev, V. D. (1979) Localization of the 3’ end of Escherichia coli 16s RNA by electron microscopy of antibody-labelled subunits. J.Mol. Biol. 133, 501-515. (18) Weinstein, S., Jahn, W.,Laschever, M., Arad, T.,Tichelaar, W., Haider, M., Glotz, C., Boeckh, T., Berkovitch-Yellin, Z., Franceschi, F., and Yonath, A. (1992) Derivatization of ribosomes and of tRNA with an undecagold cluster: Crystallographic and functional studies. J. Cryst. Growth 122,286292. (19) Evstafieva,A. G.,Shatsky, I. N.,Bogdanov,A. A.,Semenkov Y. P., and Vasiliev, V. D. (1983) Localization of 5’- and 3’-ends of the ribosome bound segment of template polynucleotides by immune electron microscopy. EMBO J.2, 799-804. (20) Stijffler,G.,and Stijffler-Meilike,M.(1984)Immunoelectron microscopy of ribosomes.Annu. Rev. Biophys. Bioeng. 13,303330. (21) Olson, H. M., Lasater, L. S., Cann, P. A., and Glitz, D. G. (1988)Messenger RNA orientation on the ribosome.Placement by electron microscopy of antibody-complementary oligonucleotide complexes. J. Biol. Chem. 263, 15196-15204.
