Synthesis, Anticancer Activity, and Genome Profiling of Thiazolo Arene

Subscriber access provided by GAZI UNIV

Article

Synthesis, Anticancer Activity and Genome Profiling of Thiazolo Arene Ruthenium Complexes ADRIANA GROZAV, Ovidiu Balacescu, Loredana Balacescu, Thomas Cheminel, Ioana Berindan-Neagoe, and Bruno Therrien J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.5b00855 • Publication Date (Web): 21 Oct 2015 Downloaded from http://pubs.acs.org on October 22, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Synthesis, Anticancer Activity and Genome Profiling of Thiazolo Arene Ruthenium Complexes

Adriana Grozav,*,† Ovidiu Balacescu,*,‡ Loredana Balacescu,‡ Thomas Cheminel,§ Ioana Berindan-Neagoe,‡,ǁ Bruno Therrien*,§

†

Faculty of Pharmacy, "Iuliu Hatieganu" University of Medicine and Pharmacy, Victor Babes 41, RO-400012 Cluj-Napoca, Romania

‡

Department of Functional Genomics, Proteomics and Experimental Pathology, The Oncology Institute “Prof Dr. Ion Chiricuta” , 34-36 Republicii Str, RO-400015, Cluj-Napoca, Romania §

Institut de Chimie, Université de Neuchâtel, 51 Avenue de Bellevaux, CH-2000 Neuchâtel, Switzerland

ǁ

Research Center of Functional Genomics, Biomedicine and Translational Medicine, "Iuliu

Hatieganu" University of Medicine and Pharmacy, 23 Marinescu Str, RO-400337 Cluj-Napoca, Romania

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 53

ABSTRACT

Sixteen hydrazinyl-thiazolo arene ruthenium complexes of the general formula [(η6-pcymene)Ru(N,N'-hydrazinyl-thiazolo)Cl]Cl were synthesized. All complexes were tested in vitro for their antiproliferative activity on three tumor cell lines (HeLa, A2780, A2780cisR) and on a non-cancerous cell line (HFL-1). A superior cytotoxic activity of the ruthenium complexes as compared to cisplatin and oxaliplatin, on both cisplatin-sensitive and cisplatin-resistant ovarian cancer cells, was observed. In addition, the biological activity of two selected derivatives was evaluated using microarray gene expression assay and Ingenuity Pathway Analysis. The p53 signaling was identified as an important pathway modulated by both arene ruthenium compounds. New activated molecules such as FAS, ZMAT3, PRMT2, BBC3/PUMA and PDCD4, whose over-expressions are correlated with overcoming resistance to cisplatin therapy, were also identified as potential targets. Moreover, the arene ruthenium complexes can be used in association with cisplatin to prevent cisplatin resistance development and synergistically to induce cell death in ovarian cancer cells.

Keywords: Arene ruthenium; Anticancer activity; Genome profiling; Thiazolo ligands; Bioorganometallic chemistry; Ovarian cancer


2

Page 3 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION

Ovarian cancer is the eighth leading cause of cancer-related deaths in women worldwide and the second cause of gynecologic cancer-related deaths, responsible for over 150000 deaths per year around the world.1 While often combined with other techniques such as radiotherapy or surgery, chemotherapy is certainly the most widely used treatment for cancer. However, this technique has several limitations, mainly the lack of selectivity of the drug, which often also kills healthy cells and thus leads to undesirable side effects (hair loss, fatigue, nausea, etc…). The resistance of cancerous cells against drugs is also a major problem in chemotherapy; one of those drugs being the well-known transition metal complex cisplatin, which has been used in cancer treatment for more than thirty years.2,3 Its inefficiency on platinum-resistant tumors is a major disadvantage, which led to the search for alternative agents to resolve this drawback. Since then, complexes of other transition metals have been designed as alternatives to cisplatin. Among these candidates, ruthenium derivatives have undoubtedly stood out. Over the last few decades, many examples of anticancer ruthenium compounds have been reported, some of which are already into clinical trials, such as the well-known complexes [imiH]trans-[Ru(N-imi)(S-dmso)Cl4] (NAMI-A)4 and [Na]trans-[Ru(N-ind)2Cl4] (NKP1339).5 Those complexes present some advantages over cisplatin, such as their activity against cisplatinresistant cancerous cell lines and their higher selectivity for cancerous over healthy cells, leading to reduced side effects.6,7 The mechanisms of action of ruthenium complexes appear to be different from platinum drugs used in the clinic and many of them are not known yet. However, some mechanisms have been proposed for the anti-cancer activity of ruthenium complexes, such as the inhibition of metastasis,8,9 interaction with DNA,10 interaction with proteins,11 production


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 53

of reactive oxygen species,12 inhibition of topoisomerase,13 induction of apoptosis14 and antiangiogenic effects.15,16 In recent years, much attention was given to compounds with pharmacophore hydrazinethiazolo or thiazolo moieties due to the identification of several thiazolo lead compounds showing antiproliferative activity,17 inhibition of Bcl-XL,18 inhibition of tautomerase,19 inhibition of metastatic cancer cell migration and invasion20 and antitumor activity.21,22 Therefore, in this study, we have combined a p-cymene ruthenium unit with a hydrazinylthiazolo ligand to generate a series of organometallic compounds with significant antitumor activity, taking advantages of the synthetic versatility of hydrazinyl-thiazolo derivatives and the promising biological activity of ruthenium complexes.


4

Page 5 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS AND DISCUSSION A series of monocationic arene ruthenium complexes (1-16) containing hydrazinyl-thiazole bidentate ligands (L1-L16) were prepared (Scheme 1). The synthesis of the complexes was realized by two methods: a) A conventional synthetic method involving one equivalent of the ruthenium dimer (η6-p-cymene)2Ru2Cl4 and two equivalents of the hydrazinyl-thiazole derivatives (L1-L16) in methanol at room temperature for 10 hours; and b) A microwave-assisted synthetic method, whose optimal reaction conditions were established after several experiments, varying the solvent (methanol, acetonitrile, dichloromethane), the temperature (40°C, 60°C, 82°C, 100°C), and the reaction time (0.5h, 1h, 1.5h, 2h). The best yields for the complexes were obtained after 0.5h of microwave irradiation at 60°C and using dichloromethane as solvent (see Table S1). The two alternative synthetic methods (microwave irradiation and conventional synthesis) are comparable for the resulting yield (50-80%) but the microwave-assisted method demands a shorter reaction time (30 minutes vs 10 hours). In order to obtain a greener synthesis, one has tried to replace standard organic solvents by water. Unfortunately, in water, the complexes could only be recovered in traces.

Scheme 1. Synthesis of complexes 1-16, R1, R2 and R3 functional groups are given in Table 1.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 53

Table 1. Identification of the functional groups R1-R3 attached to the hydrazinyl-thiazole compounds L1-L16.

L1 L2 L3 L4 L5 L6 L7 L8

R1 Ph Ph Ph 2,4-Cl2-C6H3 2,4-Cl2-C6H3 2,4-Cl2-C6H3 4-HO-C6H4 4-HO-C6H4

R2 Me Ph Me CH2COOEt Me Me Me Ph

R3 H H COMe H COMe COOEt H H

L9 L10 L11 L12 L13 L14 L15 L16

R1 4-MeO-C6H4 4-MeO-C6H4 4-MeO-C6H4 4-MeO-C6H4 3-Cl-C6H4 3-Cl-C6H4 3-Cl-C6H4 3-Cl-C6H4

R2 Me Ph Me Me Me Me Ph Me

R3 H H COOEt COMe H COMe H COOEt

All complexes were isolated as their chloride salts, and they have been fully characterized by 1

H NMR spectroscopy, mass spectrometry, IR spectroscopy, elemental analysis and for 12 by a

single-crystal X-ray structure analysis. No attempt to separate the cationic enantiomers was performed, and the chiral-at-metal complexes were isolated and used as racemic mixtures. All complexes are stable in D2O and DMSO solutions as well as in biological media (aqueous solution containing RPMI 1640 medium with 5% fetal calf serum, glutamine and antibiotics), showing no decomplexation of the hydrazinyl-thiazolo ligands. The 1H NMR spectra of all complexes show, in addition to the signals of the p-cymene ring, the characteristic signals of the ligand at higher chemical shifts related to its free form, because of the deshielding effect produced by the arene ruthenium unit. Typical signals for the ligands after complexation are: A singlet at around 9 ppm associated to the proton of the azomethine moiety (CH=N), and the proton from the hydrazine moiety (N-NH), which is the most deshielded one, appearing as a singlet at around 15 ppm (in some cases the signal is not observed due to the deuterium


6

Page 7 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


exchange). In the case of the complexes where R3 = H, the corresponding proton of the thiazolo ring is observed as a singlet around 6.5 ppm. Crystals suitable for a single-crystal X-ray structure analysis were obtained for [(η6-pcymene)Ru(L12)Cl]Cl. The molecular structure of the cation is presented in Figure 1, together with selected geometrical parameters. In complex 12, the ruthenium center shows a typical pseudo-tetrahedral geometry with the hydrazinyl-thiazolo ligand being N,N'-coordinated. The Ru-N bond distances are 2.090(6) (thiazole) and 2.123(6) Å (hydrazine) and these values are similar to those found in analogous N,N'-coordinated pyridyl-thiazolo arene ruthenium complexes.23-25 In the solid state, an angle of 34.6(3)° is observed between the plane formed by the hydrazinyl-thiazolo unit and the plane of the methoxyphenyl group.

Figure 1: ORTEP drawing of complex 12 at 35% probability level, with hydrogen atoms being omitted for clarity. Selected bond lengths (Å) and angles (°): Ru(1)-Cl(1) 2.408(2), Ru(1)-N(1) 2.090(6), Ru(1)-N(3) 2.123(6), N(2)-N(3) 1.396(7), N(3)-C(17) 1.299(8); Cl(1)-Ru(1)-N(1) 85.61(15), Cl(1)-Ru(1)-N(3) 90.04(15), N(1)-Ru(1)-N(3) 76.2(2), N(1)-C(16)-N(2) 120.5(6), C(16)-N(1)-Ru(1) 112.1(4), C(14)-N(1)-Ru(1) 133.8(5), C(17)-N(3)-Ru(1) 133.7(5), N(2)-N(3)Ru(1) 111.1(4), N(2)-N(3)-C(17) 114.2(6), C(13)-S(1)-C(16) 88.2(3).

In vitro antiproliferative activity The hydrazinyl-thiazolo arene ruthenium complexes 1-16 were tested in vitro for their antiproliferative activity on four cell lines: HeLa (human cervical cancer cells), A2780 (human


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 53

ovarian cancer cells), A2780cisR (cisplatin-resistant human ovarian cancer cells) and HFL-1 (non-cancer cells, human fibroblast). IC50 values were used to determine the antiproliferative activity of the complexes (IC50 = drug concentration necessary for 50% inhibition of cell viability); these values are listed in Table 2. Moreover, the calculated partition coefficients (log P) of the hydrazinyl-thiazole compounds L1-L16 together with their IC50 values on HeLa cells17 are presented in Table 3, thus giving an approximation of the lipophilicity of the ligands and their cytotoxicity. Cisplatin and oxaliplatin, two metal-based drugs currently used in the clinic to treat cancer, were used as controls and their IC50 values are also reported in Table 2.

Table 2: Cytotoxic activity of complexes 1-16 in HeLa, A2780, A2780cisR and HFL-1 cells. Compound Cisplatin Oxaliplatin 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 a

HeLa 20.10±0.02 12.72±0.02 7.42±0.01 2.55±0.02 11.42±0.02 3.65±0.03 7.98±0.01 0.84±0.25 19.40±0.03 6.87±0.23 7.95±0.03 2.26±0.03 5.66±0.01 7.88±0.01 11.15±0.01 2.69±0.01 6.81±0.03 1.72±0.01

IC50 (µM) a A2780 A2780cisR 11.30±0.02 41.13±1.24 10.10±0.03 16.57±0.02 9.65±0.01 12.95±0.04 2.49±0.02 0.93±0.02 6.99±0.02 2.08±0.03 12.21±0.03 12.62±0.01 50.08±0.03 55.58±0.03 2.86±0.01 6.06±0.02 6.13±0.25 6.19±0.01 5.25±0.03 4.24±0.01 6.97±0.33 6.80±0.05 5.12±0.03 1.33±0.02 9.47±0.03 3.14±0.01 4.54±0.01 2.25±0.03 6.13±0.02 2.14±0.05 2.26±0.03 2.14±0.04 7.70±0.12 2.77±0.01 3.75±0.02 3.76±0.03

HFL-1 9.50±0.02 13.53±0.02 18.48±0.02 6.27±0.01 6.43±0.02 181±0.89 47.33±0.32 4.52±0.01 49.40±0.31 7.30±0.03 6.47±0.23 13.88±0.03 4.27±0.03 3.84±0.01 6.32±0.02 36.61±0.48 13.69±0.01 2.81±0.03

Data are reported as IC50 values (concentrations of complexes required to inhibit cell viability by 50%) determined

by MTT assay after 24h of continuous exposure to each compound. The data represents mean values ± SEM (standard error of mean) of at least three independent experiments.


8

Page 9 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 3: Cytotoxic activity of compounds L1-L16 in HeLa cells and calculated partition coefficients. Compound L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12 L13 L14 L15 L16 a

log P a 3.1±0.6 4.4±0.6 2.6±0.8 4.4±0.6 4.0±0.9 4.6±0.9 2.9±0.6 4.2±0.6 3.3±0.6 4.6±0.6 3.8±0.9 2.7±0.9 3.9±0.6 3.4±0.9 5.2±0.6 4.4±0.9

IC50 (µM) b 11.4 ± 0.005 > 100 64.87 ± 0.005 > 100 > 100 > 100 25.59 ± 0.010 20.04 ± 0.019 > 100 11.1 ± 0.009 > 100 > 100 57.53 ± 0.011 > 100 > 100 > 100

The partition coefficients were calculated using ACD/ChemSketch.26; b taken from ref 17.

The results obtained on the three tumor cell lines (HeLa, A2780, A2780cisR) show a promising profile for the antiproliferative activity of all complexes, most of them having a cytotoxic activity at concentrations significantly lower than that of cisplatin and oxaliplatin (Tables S2 and S3). Moreover, by comparing the antiproliferative effect produced by the complexes on the tumor cell lines A2780 and A2780cisR, we noticed that at almost the same concentrations (see Table 2), a similar effect is observed on both cell lines, suggesting a mode of action different from cisplatin. By analyzing the effect of the treatment with the complexes on the normal fibroblasts cell line HFL-1, a significant reduction of cytotoxicity can be noticed for complexes 4 (IC50 = 181 µM) and 14 (IC50 = 36.6 µM) (Figure 2). When comparing the cytotoxic effect produced by these two complexes on the tumor cell lines (HeLa, A2780, and A2780cisR), one may notice selectivity in favor of the non-cancerous cell line, namely a cytotoxic effect upon


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 53

normal fibroblasts 15 times lower than upon cancerous cells. Moreover, the activity of the hydrazinyl-thiazole compounds L4 and L14 on HeLa cells (Table 3) is very low (> 100 µM), confirming the beneficial effect of complexation to arene ruthenium units.

Figure 2. Molecular structures of complexes 4 and 14.

Such variations in the activity appear to be dependent on some minor modifications in the molecular structure of the complexes (see Table 1), thus revealing some interesting trends: The presence of electron-withdrawing groups (chloro, dichloro) on the phenyl ring of R1 leads to a higher antiproliferative effect on the cancerous cell lines (HeLa, A2780 and A2780cisR), and the presence of a more hydrophobic substituent (phenyl) at the R2 position of the thiazole ring, also increases the antiproliferative effect, with the exception of 15 (phenyl) and 13 (methyl) which show a higher activity but only on the HeLa cell line. On the other hand, the nature of the R3 group (H, COMe, COOEt) appears to have a less predictable effect: In complexes 13, 14 and 16 where only R3 varied, the cytotoxicity of the complexes is comparable, while between complexes 5 and 6 the COMe derivative is significantly less cytotoxic than the COOEt analogue. Moreover, when looking at the log P values of L1-L16 in conjunction with the IC50 values of the ligands on HeLa cells (Table 3), it appears that the lipophilicity of the ligands does not correlate with the


10

Page 11 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


activity. Therefore, the functionalization of the ligands should be better explored for further optimization of the pharmacological index of these hydrazinyl-thiazolo arene ruthenium complexes.

Gene expression profiling as response to ruthenium complexes treatment In order to identify molecular mechanisms induced by treatment with the thiazolo arene ruthenium compounds, we profiled a global mRNA expression assay. Two ovarian carcinoma cell lines, A2780 and A2780cisR, treated with two selected compounds (4 and 14) were used for 24 hours after treatment, for microarray analysis. Although both compounds presented similarities in their structure (Figure 2), our microarray data showed different transcriptional patterns of the two cell lines in response to these compounds. The specific genes modulated by ruthenium complexes in each cell line were selected using a Fold change (Fc) threshold of 1.5 and an FDR-adjusted p-value < 0.05. As shown in a Venn diagram (Figure 3), the numbers of genes regulated by 14 were higher than those modulated by 4, for both ovarian cisplatin-sensitive and cisplatin-resistant cell lines. Compound 4 induced transcriptional changes of 444 genes (319 up-regulated genes and 125 down-regulated genes) in A2780 cells and 4840 genes (2569 upregulated genes and 2271 down-regulated genes) in the A2780cisR cell line. Comparatively, complex 14 modulated 1392 genes (867 up-regulated genes, 525 down-regulated genes) in A2780 cells and 7577 genes (3826 up-regulated genes and 3751 down-regulated genes) in A2780cisR cells. In addition, we have identified a unique set of 169 genes modulated by both compounds in A2780 cells and a unique set of 3723 genes in A2780cisR cells (Figure 3).


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 53

Figure 3. Venn diagram of transcriptional changes induced by complexes 4 and 14 in the A2780 and A2780cisR ovarian carcinoma cell lines. The overlap areas indicate the common set of genes for both ruthenium compounds in both cell lines. Complexes 4 and 14 modulate a unique set of 169 differentially expressed genes (DEGs) in A2780 cells and 3723 common DEGs in A2780cisR cells.

Identification of the biological pathway induced by ruthenium complexes 4 and 14 To investigate the molecular mechanisms underlying the effects induced by the hydrazinylthiazolo arene ruthenium compounds, we searched databases for Gene Ontology terms and canonical pathways. The GO enrichment analysis showed that the common set of genes (n = 169) modulated by both ruthenium compounds in the A2780 cell line was significantly enriched in response to stimulus (GO:0050896|GO:0051869, 76 genes, p = 8.85E-07), apoptotic process (GO:0006915|GO:0006917|GO:0008632, 21 genes, p = 1.02E-06), programmed cell death (GO:0012501|GO:0016244, 21 genes, p = 1.39E-06) response to stress (GO:0006950, 39 genes, p = 5.95E-06) and cell death (GO:0008219, 21 genes, p = 1.09E-05). In Table 4 we are presenting the twenty-one common genes involved in apoptotic and cell death-related processes.


12

Page 13 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 4. Common set of differentially expressed genes involved in apoptotic and cell deathrelated processes modulated by complexes 4 and 14 on the ovarian A2780 cell line. Gene Symbol

Description

DRAM1 ZMAT3 TP53INP1 RPS27L TP53I3 PRMT2 SHF ID1 BAX

DNA-damage regulated autophagy modulator 1 Zinc finger, matrin-type 3 (ZMAT3) Tumor protein p53 inducible nuclear protein 1 Ribosomal protein S27-like Tumor protein p53 inducible protein 3 Protein arginine methyltransferase 2 Src homology 2 domain containing F Inhibitor of DNA binding 1, dominant negative helix-loop-helix protein BCL2-associated X protein

FAS AEN C16orf5 HTRA2 TRIAP1 SERPINB9 RHOC APH1B SLIT2 BNIP3L HK2 CXCR4

Fold change

ANOVA p-value

4 2.87 2.79 2.72 2.15 2.10 2.07 1.94 1.94

14 2.33 2.92 2.66 2.25 1.66 1.97 2.19 2.69

0.039 0.038 0.007 0.006 0.014 0.040 0.033 0.019

1.85

1.66

0.018

Fas (TNF receptor superfamily, member 6) Apoptosis enhancing nuclease Chromosome 16 open reading frame 5 HtrA serine peptidase 2

1.83 1.78 1.72 1.65

1.65 1.81 1.66 1.65

0.006 0.013 0.014 0.033

TP53 regulated inhibitor of apoptosis 1 Serpin peptidase inhibitor, clade B (ovalbumin), member 9 Ras homolog gene family, member C Anterior pharynx defective 1 homolog B (C. elegans) Slit homolog 2 (Drosophila)

1.64 1.59

1.63 2.32

0.008 0.021

1.56 1.54

1.65 1.59

0.019 0.024

-1.51

-1.88

0.017

-1.62

-1.57

0.048

-1.91 -4.21

-2.23 -3.86

0.016 0.044

BCL2/adenovirus E1B 19kDa interacting protein 3-like Hexokinase 2 Chemokine (C-X-C motif) receptor 4 (CXCR4)

The GO enrichment analysis conducted on the A2780cisR cell line showed an overrepresentation of 85 GO terms in the common set of genes modulated by both 4 and 14. The majority of the GO terms were related to cellular processes and component organization,


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 53

metabolic processes, apoptosis and cell death (Table S4). Furthermore, we focused our attention on the genes involved in apoptosis and cell death. Our data highlighted 180 differentially expressed genes with different roles in apoptosis and cell death that were taken into consideration for further analysis (Table S5). In order to better understand the mechanisms by which complexes 4 and 14 modulate apoptosis in ovarian cell lines, we performed a functional analysis on the sets of genes, modulated by these compounds, and known to be involved in apoptosis. Using Ingenuity Pathway Analysis (IPA), we highlighted the role of p53 signaling pathway in inducing apoptosis, in both cisplatin-sensitive and cisplatin-resistant ovarian carcinoma cell lines (Table 5). Our data showed that activation of autophagy was triggered by overexpression of DRAM1, AEN and TP53INP1 in the A2780 cell line (Figure 4). Under conditions of genotoxic stress induced by different agents, TP53INP1 promotes autophagy-dependent cell death by binding the proteins of the ATG8-family, followed by degradation of certain antiapoptotic proteins, through partially displacement of sequestosome 1 (SQSTM1/p62).271,28 Moreover, the inhibition of SQSTM1 can be orchestrated by DRAM129 which regulates autophagy through increasing the lysosomal activity and clearance of autophagosomes.30 In our study we found high levels of TP53INP1 induced by both complexes 4 (Fc = 3.96 up) and 14 (Fc = 3.33 up) and an increased expression of DRAM1 induced by 4 (Fc=3.19 up) and 14 (Fc=2.53 up) in the A2780 ovarian cell line. The p53-dependent autophagy, as an effect of treatment, was also enhanced by overexpression of AEN, which is involved in the growth of autophagic vacuoles and LC3-II after genotoxic stress.31 The role of TP53INP1, DRAM1 and AEN in ovarian cancer was little studied. Nevertheless, it was demonstrated in a recent in vivo study32 that downregulation of TP53INP1 expression by miR569 gave to ovarian cancer cells and metastasis the ability to survive and on


14

Page 15 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the contrary, by overexpression of TP53INP1 using anti-mir569 therapy, an activation of cell death was obtained. Moreover, it was demonstrated that the combination of anti-miR569 and cisplatin therapy significantly reduces tumor weights as compared to treatment with cisplatin alone, emphasizing the role of TP53INP1 in the management of ovarian tumor treatment. Based on these findings, the combination of cisplatin with ruthenium compounds could be considered as a valuable alternative for the treatment of ovarian cancer. To the best of our knowledge, there are no evidence regarding the role of DRAM 1 in ovarian cancer, but AEN has been linked to activation of UCHL1, an important regulator of cisplatin resistance in ovarian cancer. Downregulation of tumor suppressor gene UCHL1 was associated with increased cisplatin resistance, and there is the assumption that an increased level of UCHL1 mediated pathways is considered a new promising strategy to overcome cisplatin resistance in ovarian cancer.33 Moreover, UCHL1 and HTRA2 are considered two key components of inducing of apoptosis by proteolysis, in a caspase-independent way mediated by TNf-α.34 Our microarray data revealed up-regulation of UCHL1 expression induced by both 4 (Fc = 2 up) and 14 (Fc = 2.76 up) in the A2780 ovarian cell line and more than 1.5-fold for complexes 4 and 14 (microarray data). TP53-dependent apoptosis was also modulated by overexpression of FAS, BAX, ZMAT3, TRIAP1 and TP53I3 molecules in A2780 cells. In a recent paper,35 it was demonstrated that overexpression of FAS could avoid the development of resistance to cisplatin and thus FAS could be a promising therapeutic target to restore the sensitivity to cisplatin in ovarian cancer cells. In sensitive ovarian cell lines, we observed a 2.42-fold overexpression of FAS induced by 4 and a 1.92-fold overexpression of FAS induced by 14.


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 53

Table 5. The top five canonical pathways identified in gene sets related to apoptotic processes by Ingenuity Pathway Analysis (IPA). Canonical Pathways

p-value

Ratio

Genes

p53 signaling

9.48E-08

5/98 (0.051)

BAX, DRAM1,FAS, TP53I3, TP53INP1

Induction of apoptosis by HIV1

6.76E-07

4/59 (0.068)

BAX, CRC4, FAS, HTRA2

Tumoricidal Function of Hepatic Natural Killer Cells

3E-06

3/24 (0.125)

BAX, FAS, SERPINB9

Apoptosis Signaling

1.55E-04

3/88 (0.034)

BAX, FAS, HTRA2

Molecular Mechanisms of Cancer

7.76E-04

4/356 (0.011)

APH1b, BAX, FAS, RHOC

Protein Ubiquitination Pathway

4.68E-12

20/252 (0.079)

HSPA5, HSPB8, PSMA1, PSMB1, PSMB4, PSMC1, PSMC3, PSMC5, PSMC6, PSMD3, PSMD4, PSMD6, PSMD11, PSMD12, PSMD13, PSME1, PSME2, SACS, UBA1, UBE2D3

p53 signaling

7.26E-10

12/98 (0.122)

BBC3, BIRC5, E2F1, GADD45A, HIPK2, JMY, JUN, MDM4, PERP, PMAIP1, SIRT1, TP73

Molecular Mechanisms of Cancer

8.86E-06

15/356 (0.042)

ARHGEF2, ARHGEF9, ARHGEF16, ARHGEF17, BBC3, CDKN2C, E2F1, HIPK2, JAK2, JUN, MAX, PMAIP1, RHOB, SMAD6, TGFB3

CellCycle: G2/M DNA Damage Checkpoint Regulation

1.91-04

5/49 (0.102)

CDK1, GADD45A, HIPK2, MDM4, TOP2A

ATM signaling

4.59E-04

5/59 (0.085)

CDK1, GADD45A, JUN, MDM4, TP73

A2780 cell line

A2780cisR cell line


16

Page 17 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. The activation of apoptotic and autophagy mechanisms induced by 4 and 14 in the A2780 cell line. Apoptosis is modulated by overexpression of genes involved in p53 pathways such as FAS, BAX, HTRA2, TRIAP1, TP53INP1, CDIP1 or TP53I3 while autophagy is activated by overexpression of DRAM1 and TP53INP1. The red color means overexpression of the mRNAs of specific genes in A2780 cells treated with 4 and 14 compared to untreated A2780 cells. Red intensities are proportional with mRNAs transcripts.

BAX was previously identified as an important target modulated by ruthenium compounds in the treatment of patients with acquired cisplatin resistance.36 Our data showed an increased expression of BAX, emphasizing its role as an activator of apoptosis by ruthenium compounds. We also noticed a 2.5-fold up-regulation of ZMAT3 induced by both complexes 4 and 14. ZMAT3 is involved in activation of apoptosis, either directly through the regulation of BAX, p21


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 53

and FAS expression or indirectly by regulating the cell cycle through cyclin D1 and 14-3-3σ.37,38 Moreover, ZMAT3 through its double-stranded-RNA-binding zinc finger protein can bind different types of dsRNAs, increasing the effects on cell cycle regulation and apoptosis, mediated by silencing RNA.39,40 To date, no study reported ZMAT3 activation by ruthenium compounds or their role in cisplatin-induced apoptosis in ovarian cancer. Genotoxic agents as these ruthenium compounds could also activate the apoptosis through oxidative stress by enzymatic activity. One of the main actors involved in the control of apoptosis in the generation of stress oxidative in a p53-dependent manner is TP53I3.41 High levels of TP53I3 were found in stress conditions during p53-mediated growth arrest, followed by exposure to genotoxic agents.42 Our data confirm the implication of TP53I3 in TP53-mediated apoptosis under genotoxic stress conditions, almost a 2 up Fc regulation was reported for both complexes 4 and 14 (Figure 4). Likewise, we found a 2.8 Fc expression of RPS27L gene, induced by both complexes. RPS27L represents a target of p53 wild-type gene, being previously reported to be a promoter of apoptosis in genotoxic stress conditions under etoposide treatment.43 The modulation of apoptosis could also be dependent on a negative regulation of some important antiapoptotic genes by blocking their transcriptional factors as NF-Kb.44 On this line, PRMT2, one of NF-kB modulators, blocks translocation of NF-kB in the nucleus and therefore its anti-apoptotic target genes45 but, however there are no data related to the role of PRMT2 in modulation of apoptosis in ovarian cancer induced by ruthenium compounds. All the above taken together revealed new molecules and pathways involved in the cell death of A2780 ovarian cancer cells by the hydrazinyl-thiazolo arene ruthenium complexes. Then, we focused our attention on the mechanism and pathways modulated by complexes 4 and 14 in the cisplatin-resistant A2780cisR ovarian cancer cells (Figure 5).


18

Page 19 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. The activation of apoptosis by 4 and 14 in the A2780cisR cell line. Both complexes induce apoptosis in A2780cisR cells by activation of TNFRSF8 and TNFRSF10D death receptors, and by the transcription factors NURP1, FOXO3, AATF, JUN, FOSL2 and SIAH2. Molecules involved in resistance mechanisms of platinum-based compounds such as ERCC2, HMGB1 and CLSPN are not activated by 4 and 14. The intensity of the red color is proportional to the overexpression of the mRNAs induced by 4 and 14 in A2780cisR cells compared with untreated A2780cisR cells, while the green color means a loss of the activity or a downregulation of gene expression in A2780cisR cells after treatment with 4 or 14 as compared to untreated cells.

Among the genes in the network generated by A2780cisR cells, NURP1 and TRIB3 were indicated as upstream regulators by the IPA analysis. NURP1 is a transcription regulator predicted to be “activated” by ruthenium compounds and significantly affecting the expression of


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 53

their target genes such as CYR61, FOXO3, TRIB3. The relationship between upstream regulators and their target genes is presented in Table 6.

Table 6. Upstream regulators activated by 4 and 14 in the A2780cisR cell line.

Upstream regulator

Fold change

Molecule type

Predicted activation state

zscore

p-value of overlap

Target molecules in dataset

TRIB3

6.253

kinase

Inhibited

-2.236

2.94E-06

DDIT4, GARS, HERPUD1, PMAIP1, TRIB3

NURP1

3.829

transcription regulator

Activated

3.464

1.63E-03

BUB1, BUB1B, CEBPB, CYR61, DHCR24, ESPL1, FOXO3, TRIB3

We noticed different transcriptional patterns for A2780cisR compared with A2780 ovarian cell line in response to 4 and 14. One hundred and eighty differentially expressed genes with a different role in apoptosis and cell death were commonly modulated by 4 and 14 in the A2780cisR ovarian cell line (Figure 3). Our data indicated that p53 signaling was, as for the cisplatin-sensitive cell line, one of the most important pathways activated by the hydrazinylthiazolo arene ruthenium complexes in the A2780cisR cell line (Table 5). However, unlike the A2780 cell line, a different set of pro-apoptotic molecules such as BBC3,46 BCL2L13,47 HRK,48 AIFM3,49 PMAIP1,50 GADD45A,51 were activated in A2780ciR cell line (Figure 5). An overexpression greater than 2.5 Fc was recorded for HRK, AIFM3, PMAIP1 and GADD45A, while for BBC3 and BCL2L13 a minimum of 1.78 Fc up-regulation was recorded for both complexes. To our knowledge, there are no studies to present data related to these molecules as modulators of apoptosis induced by ruthenium compounds. Nevertheless, low levels of


20

Page 21 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


GADD45A and BBC3/PUMA were previously associated with cisplatin resistance in ovarian cancer.52 Considering this issue, by the growth of its expression, BBC3 was already proposed as a chemosensitizer in ovarian cancer therapy based on platinum compounds.53 Our qRT-PCR data confirms the role of BBC3 as a sensitizer for cisplatin resistance, induced by ruthenium compounds, with 2.78 and 3.38 Fc up-regulation for complexes 4 and 14. Going deeper with functional analysis, we focused our attention on five transcriptional factors including JUN, AATF, SIAH2, NUPR1 and FOXO3 that were positively correlated with activation of apoptosis. FOXO3 and JUN were both associated with BBC3/PUMA activation, their dual expression being considered necessary to overcome chemo-resistance in ovarian cancer cells.54 Moreover, our data revealed that JUN-mediated pathways have involved supplementary molecules and death modulators. In brief, JUN activated by NURP1 upstream regulator and FOXO3 via CYR6 led to the activation of two supplementary death modulators, DEDD2 and PDCD4 respectively. Recently, it was demonstrated that low levels of PDCD4 were associated with cisplatin resistance in ovarian cancer cells and by increasing the PDCD4 expression by miRNA modulation, sensitivity to cisplatin was restored.55 With 1.66 Fc expression for 4 and 1.90 Fc expression for 14, our microarray data confirmed the activation of PDCD4 by ruthenium compounds. In addition, under cellular stress, AATF triggers and increases the expression of JUN-mediated apoptosis.56 We found that SIAH2 activates the proteasome protein ubiquitin pathway by PSMD4 and UBE2D3 molecules, but however there are still no studies that evaluated the activation of these molecules in relation to apoptosis induced by platinum or ruthenium metal-based drugs. Interestingly, we noticed that molecules involved in DNA repair, associated with cisplatin resistance, such as ERCC2, HMGB1, CLSPN or E2F were not activated following the treatment


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 53

with 4 or 14, which also highlights the advantage of these classes of compounds for treatment of ovarian cancer cells resistant to cisplatin.

Microarray data validation In order to assess the reliability of the microarray data, fifteen common genes modulated by both ruthenium complexes were considered for qRT-PCR validation. The selected genes were chosen accordingly to their known functions in apoptosis and autophagy related to p53 pathways. For the A2780 cell line, PCR data showed a good correlation with the microarray data, except for the BNIP3L gene (Figure 6). This result could be explained because BNIP3l had a p-value close to the threshold (0.048) in the microarray experiment (Figure 6). For the A2780cisR cell line, all of the selected genes showed the same expression pattern as in the microarray experiment and were validated by qRT-PCR (Figure 7).


22

Page 23 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. qRT-PCR validation of microarray data in the A2780 cell line. Fold change (Fc) values were calculated by ∆∆Ct method relative to the CTR group (untreated cells). The p-values were assessed by ANOVA and a Tukey’s test was used for post-hoc pairwise comparisons (* p < 0.05, ** p < 0.01, *** p < 0.001).


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 53

Figure 7. qRT-PCR validation of microarray data in the A2780cisR cell line. Fold change (Fc) values were calculated by ∆∆Ct method relative to the CTR group (untreated cells). The p-values were assessed by ANOVA and a Tukey’s test was used for post-hoc pairwise comparisons (* p < 0.05, ** p < 0.01, *** p < 0.001).

One of the major problems reported for ovarian cancers is related to the development of a multidrug resistance to a broad range of chemotherapeutic agents. Although, initially about 85%


24

Page 25 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of ovarian cancers respond very well to first-line chemotherapy based on platinum compounds and taxanes, less than 15% will remain in complete remission. Unfortunately, the majority of patients with ovarian cancers will develop progressive resistance. Depending on the time of relapse, three kind of platinum resistance mechanisms have been recorded: Increased resistance if the relapse occurs within 6 months after the first-line treatment; partial resistance if the relapse is recorded between 6 and 12 months after completing the initial treatment; and theoretically no resistance if relapse occurs after one year of finishing the first line therapy. Nevertheless, cisplatin based re-treatment in the second line of the patients with no platinum resistance will be effective only for about 60% of the patients, while for partially platinum resistance only a quarter of the patients will respond to a second platinum-based therapy.57 Generally, the classical treatment based on platinum compounds had a modest impact on overall survival (OS) in the last two decades.58,59 Because treatments with platinum compounds have reached a threshold of efficacy, it is necessary to identify new chemical compounds with less cross-resistance.

Processes of cell death As previously discussed, the biological pathway induced by the hydrazinyl-thiazolo arene ruthenium complexes 4 and 14 suggests apoptosis as the main cell death mechanism. Therefore, all cancerous cell lines (HeLa, A2780 and A2780cisR) were treated with complexes 4 and 14 at the corresponding IC50 concentrations, and with staurosporine (2 µg/ml) as a positive control (see Exp. Section). The percentage of apoptotic cells (cells with condensed and/or fragmented nuclei) was determined by Hoechst staining (see Figure S1). For both compounds, and on all cancer cell lines, at least 60% of the nuclei showed chromatin condensation and fragmentation, two typical


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 53

apoptotic features.60 The nuclei morphology of HeLa cells after 24 hours incubation with or without (control) complexes 4 and 14, and with staurosporine is presented in Figure 8.

Figure 8. Nuclei morphology of HeLa cells observed by fluorescence microscopy (Hoechst staining, 24h incubation at IC50 concentrations) after treatment with or without (control) complexes 4 and 14, and with staurosporine (2 µg/ml).

In addition, the effect of complexes 4 and 14 on the mitochondrial membrane potential was assessed using tetramethylrhodamine ethyl ester (TMRE) staining. As it can be appreciated in Figure 9, undisrupted mitochondrial membranes are observed for control cells (intense fluorescence staining), while upon addition of complexes 4 and 14 to A2780 and A2780cisR cells, mitochondrial membranes are altered (weak or no fluorescence staining).

Figure 9. Disruption of mitochondrial membrane potential by TMRE staining upon addition of complexes 4, 14 and staurosporine to the cancerous cells A2780 and A2780cisR.


26

Page 27 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Moreover, by combining the Hoechst and TMRE staining procedures, morphological modifications of the nucleus and disruption of the mitochondrial membranes on HeLa cells can be visualized (Figure 10). Indeed, the combination of both staining agents emphasized cell death and confirmed the role of apoptosis in sustaining tumor cell death, which further support the gene expression data.

Figure 10. Combination of Hoechst (blue fluorescence) and TMRE (red fluorescence) staining experiments, showing the effect of complexes 4, 14 and staurosporine on HeLa cells (24 hours incubations at IC50 concentrations).

Finally, using inverted fluorescence microscopy, the implication of autophagy was also investigated on the cancerous cell lines HeLa, A2780 and A2780cisR. Autophagy was evaluated using a protocol based on monodansylcadaverine (MDC) staining, and tamoxifen (10 µM) was used as a positive control. Like tamoxifen, both complexes (24 hours incubation with 4 and 14 at IC50 concentrations) clearly increase the fluorescence intensity of the staining agent as compared to untreated cells (control), confirming that autophagy is also involved in the cell death of HeLa, A2780 and A2780cisR cancerous cells (Figure 11).


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 53

Figure 11. Fluorescence intensity corresponding to autophagy upon addition of complexes 4, 14 (24 hours incubation at IC50 concentrations) and tamoxifen (10 µM) to cancer cells (control = cells treated with only the staining agent).

CONCLUSIONS In this study, we have reported the synthesis, the in vitro antiproliferative activity, and the molecular mechanisms underlying cell death in cancer cells from a new class of hydrazinylthiazolo arene ruthenium complexes. Our data bring a better understanding of the molecular mechanisms underlying biological and pharmacological profiles induced by arene ruthenium compounds and highlights their role to treat and overcome cisplatin resistance mechanisms in ovarian cancers. We found that the p53 signaling pathway was one of the most important activated pathways in both cisplatin-sensitive and cisplatin-resistant cancer cell lines, despite that signal transduction occurs through different molecules in these cell lines. Moreover, new activated molecules such as FAS, ZMAT3, PRMT2, BBC3/PUMA, GADD45A and PDCD4 whose overexpression are associated with overcoming resistance to cisplatin therapy in ovarian cancers were identified. Consequently, these results suggest that our hydrazinyl-thiazolo arene ruthenium complexes


28

Page 29 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


could be used in association with cisplatin to prevent the development of cisplatin resistance mechanisms, thus inducing cell death in ovarian cancers under a synergetic effect. This study describes for the first time on ovarian cancer cell lines the pathways and molecular mechanisms modulated by hydrazinyl-thiazolo arene ruthenium complexes.

EXPERIMENTAL SECTION The starting material (η6-p-cymene)2Ru2Cl461 and the hydrazinyl-thiazole derivatives (L1L16)17 were prepared according to the literature. All other reagents were commercially available (Sigma-Aldrich, TCI Europe) and were used without further purification. The 1H NMR spectra were recorded on a Bruker Avance II 400 spectrometer, using the residual protonated solvent as an internal standard. Infrared spectra were recorded as KBr pellets on a Perkin-Elmer FTIR 1720 X spectrometer. Elemental analyzes were performed by the Mikroelementarisches Laboratorium, ETH Zürich (Zürich, Switzerland). Elemental analyzes confirm ≥ 95% purity for all the tested compounds. Electrospray ionization mass spectra were recorded in positive-ion mode with a Bruker FTMS 4.7T BioAPEX II mass spectrometer (University of Fribourg, Switzerland). Microwave assisted syntheses were performed in sealed vessels using a CEM Discover LabMate instrument, insured with on-line inside temperature and pressure controls.

Synthesis and characterization of compounds 1-16: a) A mixture of (η6-p-cymene)2Ru2Cl4 (100 mg; 0.163 mmol) and the hydrazinyl-thiazole (0.327 mmol) in methanol (50 mL) was stirred at room temperature for 10 hours. The solvent was then completely removed under vacuum and the residue was dissolved in dichloromethane (5 mL). The product was precipitated by pouring this solution into 200 mL of n-hexane, filtered, washed


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 53

multiple times with n-hexane, and finally dried under vacuum to afford the corresponding salts in good yields (Table S1). b) A reaction mixture containing (η6-p-cymene)2Ru2Cl4 (100 mg; 0.163 mmol) and the hydrazinyl-thiazole (0.327 mmol) in dichloromethane (10 mL), was introduced in a quartz reaction vessel, which was sealed and then subjected to microwaved irradiation for 30 minutes at an internal temperature of 60°C. The mixture was then concentrated under vacuum (2 mL), and the residue was precipitated with n-hexane (50 mL), filtered, washed multiple times with nhexane, and the solid was dried under vacuum. The yields are listed in Table S1.

1: [(η6-p-cymene)Ru(L1)Cl]Cl 1

H NMR (CDCl3, 400 MHz): δ = 1.07 (d, 3JH-H = 7.1 Hz, 3H), 1.15 (d, 3JH-H = 7.1 Hz, 3H),

2.26 (s, 3H), 2.46 (s, 3H), 2.57 (sept, 3JH-H = 7.1 Hz, 1H), 4.52 (d, 3JH-H = 6.0 Hz, 1H), 5.06 (d, 3

JH-H = 6.0 Hz, 1H), 5.18 (d, 3JH-H = 6.0 Hz, 1H), 5.44 (d, 3JH-H = 6.0 Hz, 1H), 6.49 (s, 1H), 7,55-

7.57 (m, 3H), 8.12 (m, 2H), 9.32 (s, 1H), 15.63 (s, 1H) ppm. ESI-MS m/z (+): 488.05 M+. Anal. Calcd for C21H25N3SCl2Ru: C, 48.18; H, 4.81; N, 8.03. Found: C, 48.18; H, 4.83; N, 7.96. IR (KBr): 2958 (m), 2919 (m), 2525 (s), 1557 (s), 1505 (s), 1387 (m), 1306 (s), 1257 (m), 1093 (m) cm-1. 2: [(η6-p-cymene)Ru(L2)Cl]Cl 1


2.14 (s, 3H), 2.36 (sept, 3JH-H = 6.8 Hz, 1H), 4.03 (d, 3JH-H = 5.4 Hz, 1H), 4.25 (d, 3JH-H = 5.4 Hz, 1H), 4.65-4.66 (m, 2H), 6.74 (s, 1H), 7.54-7.56 (m, 6H), 7.90-7.91 (m, 2H), 8.12-8.13 (m, 2H), 9.30 (s, 1H), 15.88 (s, 1H) ppm. ESI-MS m/z (+): 550.06 M+. Anal. Calcd for C26H27N3SCl2Ru .


30

Page 31 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.5 H2O: C, 52.52; H, 4.75; N, 7.07. Found: C, 52.63; H, 4.55; N, 6.90. IR (KBr): 2916 (m), 2501 (m), 1575 (s), 1500 (s), 1384 (m), 1313 (m), 1090 (s) cm-1. 3: [(η6-p-cymene)Ru(L3)Cl]Cl 1

H NMR (CDCl3,400 MHz): δ = 1.08 (d, 3JH-H = 6.9 Hz, 3H), 1.16 (d, 3JH-H = 6.9 Hz, 3H), 2.28

(s, 3H), 2.45 (s, 3H), 2.56 (sept, 3JH-H = 6.9 Hz, 1H), 2.82 (s, 3H), 4.51 (d, 3JH-H = 5.8 Hz, 1H), 5.09 (d, 3JH-H = 5.8 Hz, 1H), 5.22 (d, 3JH-H = 5.8 Hz, 1H), 5.41 (d, 3JH-H = 5.8 Hz, 1H), 7.58-7.60 (m, 3H), 8.14 (d, 3JH-H = 7.1 Hz, 2H), 9.34 (s, 1H), 12.95 (s, 1H) ppm. ESI-MS m/z (+): 529.9 M+. Anal. Calcd for RuC23H27N3OSCl2: C, 48.85; H, 4.81; N, 7.43. Found: C, 48.96; H, 5.34; N, 6.87. IR (KBr): 2965 (w), 1637 (m), 1568 (s), 1475 (s), 1374 (m), 1309 (s) cm-1. 4: [(η6-p-cymene)Ru(L4)Cl]Cl 1


1.35 (t, 3JH-H = 7.2 Hz, 3H), 2.20 (s, 3H), 2.60 (sept, 3JH-H = 6.8 Hz, 1H), 3.80 (s, 2H), 4.29 (q, 3

JH-H = 7.2 Hz, 2H), 4.37 (d, 3JH-H = 5.9 Hz, 1H), 5.19 (d, 3JH-H = 5.9 Hz, 1H), 5.24 (d, 3JH-H =

5.9 Hz, 1H), 5.62 (d, 3JH-H = 5.9 Hz, 1H), 6.83 (s, 1H), 7.47 (dd, 3JH-H = 8.4 Hz, 4JH-H = 1.9 Hz, 1H), 7.58 (d, 4JH-H = 1.9 Hz, 1H), 8.42 (d, 3JH-H = 8.4 Hz, 1H), 9.24 (s, 1H), 16.08 (s, 1H) ppm. ESI-MS m/z (+): 630.0 M+. Anal. Calcd for C24H27N3O2SCl4Ru . H2O: C, 42.24; H, 4.28; N, 6.16. Found: C, 42.43; H, 4.08; N, 6.31. IR (KBr): 2918 (m), 1732 (m), 1589 (s), 1551 (s), 1470 (s), 1384 (s), 1259 (m), 1146 (m), 1083 (m), 1056 (m) cm-1. 5: [(η6-p-cymene)Ru(L5)Cl]Cl 1


2.49 (s, 3H), 2.54 (sept, 3JH-H = 7.1 Hz, 1H), 2.63 (s, 3H), 2.79 (s, 3H), 5.08 (d, 3JH-H = 5.4 Hz, 1H), 5.35 (d, 3JH-H = 5.4 Hz, 1H), 5.57 (d, 3JH-H = 5.4 Hz, 1H), 5.65 (d, 3JH-H = 5.4 Hz, 1H), 7.31 (d, 3JH-H = 8.6 Hz, 1H), 7.42 (s, 1H), 7.98 (d, 3JH-H = 8.6 Hz, 1H), 8.29 (s, 1H), 12.83 (s, 1H)


31


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 53

ppm. ESI-MS m/z (+): 599.8 M+. Anal. Calcd for C23H25N3OSCl4Ru . H2O: C, 42.34; H, 4.17; N, 6.44. Found: C, 42.66; H, 3.96; N, 6.30. IR (KBr): 2975 (m), 1604 (m), 1564 (m), 1384 (s), 1328 (s), 1055 (s) cm-1. 6: [(η6-p-cymene)Ru(L6)Cl]Cl 1


1.33 (t, 3JH-H = 6.6 Hz, 3H), 2.21 (s, 3H), 2.62 (sept, 3JH-H = 6.2 Hz, 1H), 2.78 (s, 3H), 4.27 (q, 3


5.5 Hz, 1H), 5.59 (d, 3JH-H = 5.5 Hz, 1H), 7.44 (d, 3JH-H = 8.2 Hz, 1H), 7.56 (s, 1H), 8.55 (d, 3JH-H = 8.2 Hz, 1H), 8.78 (s, 1H), 13.43 (s, 1H) ppm. ESI-MS m/z (+): 630.0 M+. Anal. Calcd for C24H27N3O2SCl4Ru: C, 43.39; H, 4.10; N, 6.32. Found: C, 43.47; H, 4.24; N, 6.26. IR (KBr): 2965 (w), 1709 (m), 1585 (s), 1474 (s), 1373 (s), 1317 (s), 1276 (s), 1099 (s) cm-1. 7: [(η6-p-cymene)Ru(L7)Cl]Cl 1



JH-H = 5.7 Hz, 1H), 5.18 (d, 3JH-H = 5.7 Hz, 1H), 5.44 (d, 3JH-H = 5.7 Hz, 1H), 6.48 (s, 1H), 7.12

(d, 3JH-H = 8.4 Hz, 2H), 7.70 (d, 3JH-H = 8.4 Hz, 2H), 8.76 (s, 1H), 14.23 (s, 1H) ppm. ESI-MS m/z (+): 504.05 M+. Anal. Calcd for C21H25N3OSCl2Ru . 0.5 H2O: C, 45.99; H, 4.78; N, 7.66. Found: C, 45.90; H, 4.98; N, 7.12. IR (KBr): 2965 (m), 1607 (s), 1552 (m), 1509 (s), 1383 (m), 1284 (m), 1254 (m), 1174 (m) cm-1. 8: [(η6-p-cymene)Ru(L8)Cl]Cl 1


2.16 (s, 3H), 2.32 (sept, 3JH-H = 6.3 Hz, 1H), 3.95 (d, 3JH-H = 5.7 Hz, 1H), 4.60 (d, 3JH-H = 5.7 Hz, 1H), 4.71-4.73 (m, 2H), 6.73 (s, 1H), 7.15-7.18 (m, 2H), 7.54-7.55 (m, 3H), 7.75-7.77 (m, 2H),


32

Page 33 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7.90-7.92 (m, 2H), 8.77 (s, 1H), 14.25 (s, 1H) ppm. ESI-MS m/z (+): 565.9 M+. Anal. Calcd for C26H27N3OSCl2Ru . H2O: C, 50.40; H, 4.72; N, 6.78. Found: C, 50.17; H, 4.61; N, 6.32. IR (KBr): 2969 (s), 1605 (s), 1572 (s), 1508 (s), 1278 (m), 1174 (m) cm-1. 9: [(η6-p-cymene)Ru(L9)Cl]Cl 1


2.33 (s, 3H), 2.50 (s, 3H), 2.63 (sept, 3JH-H = 6.8 Hz, 1H), 3.96 (s, 3H), 4.83 (d, 3JH-H = 5.8 Hz, 1H), 5.15 (d, 3JH-H = 5.8 Hz, 1H), 5.26 (d, 3JH-H = 5.8 Hz, 1H), 5.50 (d, 3JH-H = 5.8 Hz, 1H), 6.51 (s, 1H), 7.10 (d, 3JH-H = 8.8 Hz, 2H), 8.18 (d, 3JH-H = 8.8 Hz, 2H), 9.25 (s, 1H), 15.36 (s, 1H) ppm. ESI-MS m/z (+): 517.9 M+. Anal. Calcd for C22H27N3OSCl2Ru: C, 47.74; H, 4.92; N, 7.59. Found: C, 47.52; H, 4.94; N, 7.40. IR (KBr): 2966 (w), 2481 (w), 1604 (s), 1554 (m), 1509 (s), 1378 (w), 1306 (m), 1266 (s), 1180 (m), 1087 (w) cm-1. 10: [(η6-p-cymene)Ru(L10)Cl]Cl 1


2.17 (s, 3H), 2.38 (sept, 3JH-H = 6.8 Hz, 1H), 4.00 (d, 3JH-H = 6.1 Hz, 1H), 4.53 (d, 3JH-H = 6.1 Hz, 1H), 4.70 (d, 3JH-H = 6.1 Hz, 1H), 4.74 (d, 3JH-H = 6.1 Hz, 1H), 6.72 (s, 1H), 7.06 (d, 3JH-H = 8.7 Hz, 2H), 7.55 (m, 3H), 7.91 (m, 2H), 8.15 (d, 3JH-H = 8.7 Hz, 2H), 9.20 (s, 1H), 15.67 (s, 1H) ppm. ESI-MS m/z (+): 580.1 M+. Anal. Calcd for C27H29N3OSCl2Ru . H2O: C, 51.18; H, 4.93; N, 6.63. Found: C, 51.36; H, 4.78; N, 6.49. IR (KBr): 2966 (w), 1604 (s), 1574 (m), 1509 (s), 1309 (m), 1271 (s), 1178 (m), 1085 (m) cm-1. 11: [(η6-p-cymene)Ru(L11)Cl]Cl 1


1.33 (t, 3JH-H = 7.1 Hz, 3H), 2.32 (s, 3H), 2.57 (sept, 3JH-H = 6.9 Hz, 1H), 2.82 (s, 3H), 3.93 (s, 3H), 4.30 (q, 3JH-H = 7.1 Hz, 2H), 4.78 (d, 3JH-H = 5.9 Hz, 1H), 5.13 (d, 3JH-H = 5.9 Hz, 1H), 5.26


33


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 53

(d, 3JH-H = 5.9 Hz, 1H), 5.45 (d, 3JH-H = 5.9 Hz, 1H), 7.07 (d, 3JH-H = 8.7 Hz, 2H), 8.15 (d, 3JH-H = 8.7 Hz, 2H), 9.20 (s, 1H), 16.01 (s, 1H) ppm. ESI-MS m/z (+): 589.9 M+. Anal. Calcd for C25H31N3O3SCl2Ru . CH2Cl2: C, 43.95; H, 4.68; Found: C, 43.67; H, 4.75. IR (KBr): 2966 (w), 1710 (m), 1604 (s), 1575 (s), 1509 (s), 1477 (m), 1372 (m), 1314 (s), 1268 (s), 1178 (m), 1099 (s) cm-1. 12: [(η6-p-cymene)Ru(L12)Cl]Cl 1


2.35 (s, 3H), 2.47 (s, 3H), 2.62 (sept, 3JH-H = 6.4 Hz, 1H), 2.86 (s, 3H), 3.96 (s, 3H), 4.81 (d, 3JHH

= 4.8 Hz, 1H), 5.16 (d, 3JH-H = 4.8 Hz, 1H), 5.29 (d, 3JH-H = 4.8 Hz, 1H), 5.46 (d, 3JH-H = 4.8

Hz, 1H), 7.10 (d, 3JH-H = 8.0 Hz, 2H), 8.20 (d, 3JH-H = 8.0 Hz, 2H), 9.18 (s, 1H), 12.46 (s, 1H) ppm. ESI-MS m/z (+): 560.1 M+. Anal. Calcd for C24H29N3O2SCl2Ru . H2O: C, 46.98; H, 5.09; N, 6.85. Found: C, 46.94; H, 4.91; N, 6.77. IR (KBr): 2963 (w), 1638 (m), 1604 (s), 1574 (m), 1510 (s), 1475 (m), 1374 (m), 1307 (s), 1262 (s), 1179 (m) cm-1. 13: [(η6-p-cymene)Ru(L13)Cl]Cl 1



JH-H = 5.6 Hz, 1H), 5.17 (d, 3JH-H = 5.6 Hz, 1H), 5.46 (d, 3JH-H = 5.6 Hz, 1H), 6.44 (s, 1H), 7.51

(m, 2H), 7.91 (d, 3JH-H = 7.1 Hz, 1H), 9.24 (s, 1H), 13.95 (s, 1H) ppm. ESI-MS m/z (+): 524.1 M+. Anal. Calcd for C21H24N3SCl3Ru . CH2Cl2: C, 41.10; H, 4.08; N, 6.54; Found: C, 41.40; H, 4.08; N, 6.33. IR (KBr): 2966 (w), 1604 (s), 1509 (s), 1375 (m), 1309 (s), 1261 (m), 1178 (m) cm-1.


34

Page 35 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


14: [(η6-p-cymene)Ru(L14)Cl]Cl 1


2.18 (s, 3H), 2.40 (sept, 3JH-H = 6.8 Hz, 1H), 4.02 (d, 3JH-H = 5.9 Hz, 1H), 4.42 (d, 3JH-H = 5.9 Hz, 1H), 4.69 (d, 3JH-H = 5.9 Hz, 1H), 4.78 (d, 3JH-H = 5.9 Hz, 1H), 6.77 (s, 1H), 7.54 (m, 5H), 7.90 (m, 3H), 8.50 (s, 1H), 9.27 (s, 1H), 16.05 (s, 1H) ppm. ESI-MS m/z (+): 584.0 M+. Anal. Calcd for C26H26N3SCl3Ru . 1.5 H2O: C, 48.27; H, 4.52; N, 6.49. Found: C, 48.23; H, 4.01; N, 6.32. IR (KBr): 2969 (w), 2478 (m), 1578 (s), 1499 (m), 1379 (w), 1325 (w), 1257 (w), 1088 (m) cm-1. 15: [(η6-p-cymene)Ru(L15)Cl]Cl 1


2.16 (s, 3H), 2.37 (s, 3H), 2.80 (s, 3H), 2.92 (sept, 3JH-H = 6.8 Hz, 1H), 4.50 (d, 3JH-H = 5.9 Hz, 1H), 5.03 (d, 3JH-H = 5.9 Hz, 1H), 5.18 (d, 3JH-H = 5.9 Hz, 1H), 5.48 (d, 3JH-H = 5.9 Hz, 1H), 7.37 (m, 2H), 7.52 (d, 3JH-H = 7.4 Hz, 1H), 7.70 (s, 1H), 8.34 (s, 1H), 12.69 (s, 1H) ppm. ESI-MS m/z (+): 564.0 M+. Anal. Calcd for C23H26N3OSCl3Ru: C, 46.05; H, 4.37; N, 7.00. Found: C, 45.89; H, 4.32; N, 6.98. IR (KBr): 2963 (w), 1638 (m), 1560 (s), 1475 (m), 1374 (m), 1308 (s), 1079 (w) cm-1. 16: [(η6-p-cymene)Ru(L16)Cl]Cl 1


1.34 (t, 3JH-H = 7.2 Hz, 3H), 2.32 (s, 3H), 2.60 (sept, 3JH-H = 6.2 Hz, 1H) 2.82 (s, 3H), 4.31 (q, 3


5.3 Hz, 1H), 5.47 (d, 3JH-H = 5.3 Hz, 1H), 7.56 (m, 2H), 7.93 (m, 1H), 8.46 (s, 1H), 9.32 (s, 1H), 12.68 (s, 1H) ppm. ESI-MS m/z (+): 593.9 M+. Anal. Calcd for C24H28N3O2SCl3Ru . 1.5 H2O: C, 43.88; H, 4.76; N, 6.40. Found: C, 43.76; H, 4.46; N, 5.88. IR (KBr): 2965 (w), 1711 (m), 1574 (s), 1475 (s), 1372 (m), 1316 (s), 1276 (s), 1100 (s) cm-1.


35


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 53

X-ray crystallography A crystal of 12 was mounted on a Stoe Image Plate Diffraction system equipped with a Φ circle goniometer, using Mo-Kα graphite monochromated radiation (λ = 0.71073 Å) with Φ range 0-200°. Crystal data for 12: Monoclinic space group P 21/c (No. 14), cell parameters a = 16.2513(19), b = 15.1904(12), c = 13.3986(13) Å, β = 107.817(8), V = 3149.0(5) Å3, T = 173(2) K, Z = 4, Dc = 1.256 g cm–3, F(000) 1216, λ (Mo Kα) = 0.71073 Å, 8557 reflections measured, 2494 unique (Rint = 0.2499) which were used in all calculations. The structure was solved by direct methods using the program SHELXS-97, while the refinement and all further calculations were carried out using SHELXL-97.62 The hydrogen atoms were included in calculated positions and treated as riding atoms using the SHELXL default parameters. The non-hydrogen atoms were refined anisotropically, using weighted full-matrix least-squares on F2 with 304 parameters. R1 = 0.0515 (I > 2σ(I)) and wR2 = 0.0975, GOF = 0.629; max./min. residual density 0.447/-0.729 eÅ–3. Figure 1 was drawn with ORTEP63 and the structural data deposited at The Cambridge Crystallographic Data Centre: CCDC 1063589. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac.uk/data_request/cif.

Biology Cell cultures The human cervical cancer cells (HeLa), the human ovarian cancer cells (A2780), the cisplatin-resistant human ovarian cancer cells (A2780cisR) and the non-cancerous cells (HFL-1) were obtained from the European Centre of Cell Cultures (ECACC). These cell lines were cultivated under sterile conditions by using RPMI 1640 (Sigma-Aldrich) growth media. This media was supplemented with fetal calf serum (FCS, Sigma-Aldrich, 5%), antibiotics


36

Page 37 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(penicillin– streptomycin, Actavis Sindan Pharma, 0.1%) and glutamine (Sigma-Aldrich, 0.1%) at 37°C and CO2 (5%). Cell proliferation inhibition The cytotoxicity activity was determined using the MTT assay. The cells were seeded in 96well plates with 100 µL of cell solution (cca. 10.000 cells/well) and incubated for 24 h. The 2a-p compounds were initially dissolved in DMSO, followed by a series of successive dilutions using RPMI 1640 media, so that the final concentration of DMSO was under 0.1%. The cells were treated with thiazolo-ruthenium complexes (concentrations between 0.1 µM 100 µM) for 24h, with a final volume in the well of 200µL. After the treatment, the culture media was removed, we added MTT (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide) - Hanks media solution in each well and the plates were incubated for a further 2h. The formazan crystals formed by the mitochondrial dehydrogenase activity of vital cells were dissolved in DMSO. The optical density, quantified by colorimetric measurements, is directly proportional to the amount of formazan crystals formed in the cells, and it is an indicator of the cellular viability. The plates were measured with a multimode microplate reader (Biotek Synergy 2 Multi-Mode Microplate Reader with SQ Xenon Flash light source) and absorbance was detected at 570 nm. Note: Cisplatin and oxaliplatin drugs were used as a positive control in our experiment, in the same concentrations of the studied compounds. All the experiments were performed in triplicate. Statistical analysis Values are given as the mean ± SEM. Data are represented as averages of independent experiments, performed in triplicate. The experimental data were processed with Graph Pad Prism 5 biostatistics software.


37


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 53

RNA processing Total RNA from treated and parental ovarian carcinoma cell lines (A2780 and A2780cisR) was isolated with TriReagent (Sigma-Aldrich) following the classical protocol and purified with RNeasy Mini kit (Qiagen, Hilden, Germany). RNA quality and quantity was checked with Lab on-a-chip Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) and NanoDrop ND1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The RNA Integrity Number (RIN) was calculated for each sample and was used to assess the integrity of extracted RNA. To reduce biases due to poor RNA quality, only RNAs with RIN >8 were considered for further analysis. Microarray expression profiling For each sample, 100 ng of total RNA was labeled (Cy3) and amplified using Low Input Quick Amp Labeling Kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions. Labeled cRNA targets were further purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and quantified with NanoDrop ND-1000 spectrophotometer. All samples had minimum 1.65 µg cRNA and Cy3 specific activity > 6. For each cell line (A2780 and A2780cisR) and each treatment, three biological replicates were hybridized to 4x44k Whole Human Genome Oligo Microarray (Agilent Technologies, Santa Clara, CA, USA) for 17 hours at 65°C, then washed and dried following the Agilent protocol. Slides were scanned with an Agilent Technologies Scanner G2505C US45102867 at 5 µm resolution, and pixel intensities were quantified using Feature Extraction software v. 11.5.1.1 (Agilent Technologies, Santa Clara, CA, USA).


38

Page 39 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Microarray data analysis Raw microarray data were analyzed with Gene Spring GX v.11.5.1 (Agilent Technologies, Santa Clara, CA, USA). The signal intensities were normalized using Quantile method. Features flagged as outlier, non-uniform or saturated were removed from subsequent analysis. Differentially expressed transcripts induced by two compounds in each line were selected using ANOVA followed by Tukey post hoc test and taking a fold change (Fc) cut-off of 1.5. To account for multiple testing, the p-values were corrected using Benjamini-Hochberg procedure. The differentially expressed genes were subjected to agglomerative hierarchical clustering based on Euclidian distances and Ward method. Gene Ontology enrichment analysis was performed for dataset of common differentially expressed genes (DEGs) induced by the two compounds in A2780 cell line but also in A2780cisR cell line. The significance of GO categories was assessed by a hypergeometric distribution and p-value was adjusted using the Benjamini-Yekutieli correction. Differentially expressed genes were mapped to molecular function and canonical pathway in Ingenuity Pathway Analysis (IPA). The upstream regulators considered key molecule that can affect the expression of their target genes were identified with IPA Upstream Regulator Analysis. A z-score defining the activation state of the upstream regulators (“activated” or “inhibited”) was calculated based on Fischer’s exact test (p < 0.01). A z score greater than 2 defined a statistically significant “activated” upstream regulator and a value smaller than -2 defined an “inhibited” status. Validation of microarray data by quantitative real-time PCR (qRT-PCR) The expression of 21 genes of interest identified by microarray was validated with qRT-PCR reaction using Light Cycler 480 (Roche) device. A specific set of primers and a fluorescent probe, named Universal Probe Library (UPL), were identified for every selected gene, with


39


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 53

Roche Applied Science software as follows: DRAM1 (NM_018370.2) F- tgtctgtgcttcactaatttcca, R- tcacagatcgcactcactacg (UPL#78); TP53INP1 (NM_033285.3) F-catagcccaagtagtcccaga, Rgcaagagctgcaacataacaat aagtgggatggcggtaca

(UPL#43);

(UPL#15);

gcggggattgaagtaaggac

TP53I3

(NM_004881.4)

ZMAT3(NM_152240.2)

(UPL#2);

RPS27L

F-gatttgcctgatcctcttcg,

R-

F-ccaggaaagaagggaatgagt,

R-

(NM_015920.3)

F-cagatcgcttgcagcttg,

R-

tcttccaaggacggatgtagtaa (UPL#23); PRMT2 (NM_206962.2) F-ccagtgtggagaaggcaca; Rggggaagactttttctccaac

(UPL#21);

cactcccgccacaaagat

BAX

(UPL#55);

(NM_138761.3)

AEN

(NM_022767.3)

F-caagaccagggtggttgg,

R-

f-tgcagaccggaagagacac,

R-

ggaagcctggggagtaatct (UPL#43); TRIAP1 (NM_016399.2) F-gcagttcaggaattaagatacttgg, Rgctggcaatagcagatctttg

(UPL#69);

BNIP3L

agctccacccaggaactgt

(UPL#70);

HTRA2

agcttggttctcgaagctgt

(UPL#89);

FAS

ggagaggtggcaaagctcta

(UPL#15); (UPL#1);

NUPR1

tctctcttggtgcgaccttt

(UPL#10);

PMAIP1

(UPL#11);

F-aatgtcgtcccacctagtcg,

R-

attggggtgatgatgctgac,

R-

F-

tttctcaggcatcaaaagca,

R-

(NM_021158.3)

F-ccgtcttgggccctatgt,

R-

F-ctatagcctggcccattcct,

R-

F-ggagatgcctgggaagaag,

R-

F-gacctcaacgcacagtacga,

R-

(NM_013247.4) (NM_000043.4)

TRIB3

cttcctggacggggtaca

ccaaatctcctgagttgagtagc

(NM_004331.2) F-

(NM_012385.2) (NM_021127.2)

BBC3

(NM_014417.3)

gagattgtacaggaccctcca (UPL#68); PDCD4 (NM_145341.3) F-tggaaagcgtaaagatagtgtgtg, Rttctttcagcagcatatcaatctc

(UPL#10);

ERCC2

(NM_000400.3)

F-cagatggcacagcccttc,

R-

tcctcttcagcgtctcctct (UPL#1); GADD45A (NM_001924.3) F-ggagagcagaagaccgaaag, Ragtgatcgtgcgctgactc (UPL#37); HMGB1 (NM_002128.4) F-gagtaatgttacagagcggagaga, Raatgtactgcaatggctgtgag (UPL#75); TNFRSF8 (NM001243.3) F-gctgtcaggaggtgctgttac, Rgtaggcctctgtgggcact (UPL#43) and

RN18S1 (NR_003286.2) F-gcaattattccccatgaacg, R-

gggacttaatcaacgcacgc (UPL#48). Complementary DNA (cDNA) was generated from 500 ng of


40

Page 41 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


total RNA, with First Strand cDNA Synthesis Kit (Roche Applied Science, Germany). For each PCR reaction were used 2.5 µl of 1:10 (v/v) dilution of the first cDNA, 0.5 µM of every primers and 0.2 µM UPL. The PCR conditions included a 10 minute step at 95°C for enzyme activation followed by an amplification step including 35 cycles of 15 seconds at 95°C, 20 seconds at 55°C and 1 second at 72°C followed by a final cooling step at 40°C for 30 seconds. The expression of selected genes was calculated with ∆∆Ct method64 after their normalization with the RN18S1 housekeeping gene.

Apoptosis assessment Apoptosis was assessed by fluorescence microscopy, using the Multi-Parameter Apoptosis Assay Kit (Cayman cat no 600330, Estonia), that contains tetramethylrhodamine ethyl ester (TMRE) and Hoechst dye staining agents. The HeLa, A2780 and A2780cisR cells were seeded at a density of 20000 cells/well in 96-well plates, with 200 µL culture media and treated for 24 hours with complexes 4 and 14 at concentrations corresponding to the IC50 values. Similarly, as a positive control, cells were treated with staurosporine (2 µg/ml). Cells were harvested, then washed once with phosphate-buffered saline (PBS) and centrifuged at 500 RPM for 5 minutes. Further, the cells were re-suspended and stained with Hoechst-TMRE co-staining solution 100µL/ml of culture medium and incubated for 15 minutes at 37°C in CO2. Using ZEISS LSM 510 inverted fluorescence microscope at 20X magnifications to capture the images, in order to assess the cell death mechanisms. The number of apoptotic cells was measured by assessing the percentage of cells displaying condensed or fragmented nuclei. Approximately 200 nuclei were counted per sample.


41


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 53

Autophagy assessment The autophagy was evaluated using an Autophagy/Cytotoxicity Dual Staining Kit (Cayman Chemical Co, Ann Arbor, MI, USA), in accordance with the producer recommendation for the multiplate reader detection. The HeLa, A2780 and A2780cisR cells were seeded at a density of 20000 cells/well in 96-well plates, with 200 µL culture media and treated for 24 hours with complexes 4 and 14 at concentrations corresponding to the IC50 values. As a positive control, cells were treated in a similar manner with tamoxifen (10 µM). The fluorescence intensity was evaluated using a BioTek Microplate Reader. The fluorescence intensity of the autophagy marker MDC (monodansylcadaverine) was determined at 355 nm and the emission wavelength at 512 nm.65

ASSOCIATED CONTENT Supporting Information Comparative yields for the synthesis of the complexes (Table S1). Comparison of the antiproliferative activity of complexes 1-16 to cisplatin and oxaliplatin on the cancerous cell lines, HeLa, A2780 and A2780cisR (Tables S2 and S3). GO terms enriched in the common set of genes modulated in the A2780cisR ovarian cell line with complexes 4 and 14 (Table S4). The differentially expressed genes in the ovarian A2780cisR cell line, listed in GO categories related to apoptosis and cell death (Table S5). Percentages of condensed and fragmented nuclei in cancer cells (Figure S1). The Supporting Information is available free of charge on the ACS Publications website at DOI: xxx.


42

Page 43 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AUTHOR INFORMATION Corresponding Authors *Phone: +40-0750-774848. Fax: +40-264-597257. E-mail: [email protected] *Phone: +40-264-590638. Fax: +40-264-590638. E-mail: [email protected] *Phone: +41-32-7182499. Fax: +41-32-7182511. E-mail: [email protected] Author Contributions Adriana Grozav and Ovidiu Balacescu have equally contributed to the manuscript, while the manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was supported by the Swiss Enlargement Contribution in the framework of the Romanian-Swiss Research Program, project number IZERZO-142198/1.

REFERENCES (1) Jemal, A.; Bray, F.; Center, M. M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA Cancer J. Clin. 2011, 61, 69–90. (2) Muggia F. Platinum compounds 30 years after the introduction of cisplatin: implications for the treatment of ovarian cancer. Gynecol. Oncol. 2009, 112, 275–281. (3) Wheate, N. J.; Walker, S.; Craig, G. E.; Oun, R. The status of platinum anticancer drugs in the clinic and in clinical trials. Dalton Trans. 2010, 39, 8113–8127.


43


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 53

(4) Rademaker-Lakhai, J. M.; Bongard, D.; Pluim, D.; Beijnen, J. H.; Schellens, J. H. A phase I and pharmacological study with imidazolium-trans-DMSO-imidazole-tetrachlororuthenate, a novel ruthenium anticancer agent. Clin. Cancer Res. 2004, 10, 3717–3727. (5) (a) Hartinger, C. G.; Jakupec, M. A.; Zorbas-Seifried, S.; Groessl, M.; Egger, A.; Bergar, W.; Zorbas, H.; Dyson, P. J.; Keppler, B. K. KP1019, a new redox-active anticancer agent-preclinical development and results of a clinical phase I study in tumor patients. Chem. Biodiversity 2008, 5, 2140–2155. (b) Trondl, R.; Heffeter, P.; Kowol, C. R.; Jakupec, M. A.; Berger, W.; Keppler, B. K. NKP-1339, the first ruthenium-based anticancer drug on the edge to clinical application Chem. Sci. 2014, 5, 2925–2932. (6) (a) Gupta, G.; Nowak-Sliwinska, P.; Herrero, N.; Dyson, P. J.; Therrien, B. Highly water soluble trithiolato-bridged dinuclear arene ruthenium complexes. Inorg. Chim. Acta. 2014, 423, 524–529; (b) Sava, G.; Bergamo, A.; Dyson, P. J. Metal-based antitumour drugs in the postgenomic era: what comes next? Dalton Trans. 2011, 40, 9069–9075. (7) (a) Hartinger, C. G.; Metzler-Nolte, N.; Dyson, P. J. Challenges and Opportunities in the Development of Organometallic Anticancer Drugs. Organometallics 2012, 31, 5677–5685; (b) Kilpin, K. J.; Crot, S.; Riedel, T.; Kitchen, J. A.; Dyson, P. J. Ruthenium (II) and osmium (II) 1,2,3-triazolylidene organometallics: a preliminary investigation into the biological activity of 'click' carbene complexes. Dalton Trans. 2014, 43, 1443–1448. (8) Sava, G.; Zorzet, S.; Turrin, C.; Vita, F.; Soranzo, M.; Zabucchi, G.; Cocchietto, M.; Bergamo, A.; Giovine, S.; Pezzoni, G.; Sartor, L.; Garbisa, S. Dual action of NAMI-A in inhibition of solid tumor metastasis: selective targeting of metastatic cells and binding to collagen. Clin. Cancer Res. 2003, 91, 1898–1905.


44

Page 45 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(9) Bergamo, A.; Masi, A.; Dyson, P. J.; Sava, G. Modulation of the metastatic progression of breast cancer with an organometallic ruthenium compound. Int. J. Oncol. 2008, 33, 1281–1289. (10) Moreno, V.; Font-Bardia, M.; Calvet, T.; Lorenzo, J.; Aviles, F. X.; Garcia, M. H.; Morais, T. S.; Valente, A.; Robalo, M. P. DNA interaction and cytotoxicity studies of new ruthenium(II) cyclopentadienyl derivative complexes containing heteroaromatic ligands. J. Inorg. Biochem. 2011, 105, 241–249. (11) Martinez, A.; Suarez, J.; Shand, T.; Magliozzo, R. S.; Sanchez-Delgado, R. A. Interactions of arene-Ru(II)-chloroquine complexes of known antimalarial and antitumor activity with human serum albumin (HSA) and transferrin. J. Inorg. Biochem. 2011, 105, 39–45. (12) Kapitza, S.; Jakupec, M. A.; Uhl, M.; Keppler, B. K.; Marian, B. The heterocyclic ruthenium(III) complex KP1019 (FFC14A) causes DNA damage and oxidative stress in colorectal tumor cells. Cancer Lett. 2005, 226, 115–121. (13) Du, K. J.; Wang, J. Q.; Kou, J. F.; Li, G. Y.; Wang, L. L.; Chao, H.; Ji, L. N. Synthesis, DNA-binding and topoisomerase inhibitory activity of ruthenium(II) polypyridyl complexes. Eur. J. Med. Chem. 2011, 46, 1056–1065. (14) Li, L.; Wong, Y.; Chen, T.; Zheng, W. Ruthenium complexes containing bis-benzimidazole derivatives as a new class of apoptosis inducers. Dalton Trans. 2012, 41, 1138–1141. (15) Nazarov, A.; Baquié, M.; Nowak-Sliwinska, P.; Zava, O.; Van Beijnum, J.; Groessl, M.; Chisholm, D.; Ahmadi, Z.; McIndoe, J. S.; Griffioen, A. W.; Van den Bergh, H.; Dyson, P. J. Synthesis and characterization of a new class of anti-angiogenic agent based on ruthenium clusters. Sci. Rep. 2013, 3, 1485.


45


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 53

(16) Nowak-Sliwinska, P.; Van Beijnum, J.; Casini, A.; Nazarov, A.; Wagnières, G.; Van den Bergh, H.; Dyson, P. J.; Griffioen, A. W. Organometallic ruthenium(II) arene compounds with antiangiogenic activity. J. Med. Chem. 2011, 54, 3895–3902. (17) Grozav, A.; Găină, L.; Pileczki, V.; Crisan, O.; Silaghi-Dumitrescu, L.; Therrien, B.; Zaharia, V.; Berindan-Neagoe, I. The synthesis and antiproliferative activities of new arylidenehydrazinyl-thiazole derivatives. Int. J. Mol. Sci. 2014, 15, 22059–22072. (18) Sleebs, B. E.; Kersten, W. J. A.; Kulasegaram, S.; Nikolakopoulos, G.; Hatzis, E.; Moss, R. M.; Parisot, J. P.; Yang, H.; Czabotar, P. E.; Fairlie, W. D.; Lee, E. F.; Adams, J. M.; Chen, L.; van Delft, M. F.; Lowes, K. N.; Wei, A.; Huang, D. C.S.; Colman, P. M.; Street, I. P.; Baell, J. B.; Watson, K.; Lessene, G. Discovery of potent and selective benzothiazole hydrazone inhibitors of Bcl-XL. J. Med. Chem. 2013, 56, 5514–5540. (19) Dahlgren, M. K.; Garcia, A. B.; Hare, A. A.; Tirado-Rives, J.; Leng, L.; Bucala, R.; Jorgensen, W. L. Virtual screening and optimization yield low-nanomolar inhibitors of the tautomerase activity of Plasmodium falciparum macrophage migration inhibitory factor. J. Med. Chem. 2012, 55, 10148–10159. (20) Zheng, S.; Zhong, Q.; Xi, Y.; Mottamal, M.; Zhang, Q.; Schroeder, R. L.; Sridhar, J.; He, L.; McFerrin, H.; Wang, G. Modification and biological evaluation of thiazole derivatives as novel inhibitors of metastatic cancer cell migration and invasion. J. Med. Chem. 2014, 57, 6653– 6667. (21) (a) Andreani, A.; Burnelli, S.; Granaiola, M.; Leoni, A.; Locatelli, A.; Morigi, R.; Rambaldi, M.; Varoli, L.; Calonghi, N.; Cappadone, C.; Farruggia, G.; Zini, M.; Stefanelli, C.; Masotti, L.; Radin, N. S.; Shoemaker, R. H. New antitumor imidazo[2,1-b]thiazole guanylhydrazones and analogues. J. Med. Chem. 2008, 51, 809–816. (b) Thomas, C. J.; McCormick, M. M.; Vialas, C.;


46

Page 47 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Tao, Z.-F.; Leitheiser, C. J.; Rishel, M. J.; Wu, X.; Hecht, S. M. Alteration of the selectivity of DNA cleavage by a deglycobleomycin analogue containing a trithiazole moiety J. Am. Chem. Soc. 2002, 124, 3875–3884. (22) Ignat, A.; Lovasz, T.; Vasilescu, M.; Fischer-Fodor, E.; Tatomir, C. B.; Cristea, C.; SilaghiDumitrescu, L.; Zaharia, V. Heterocycles 27. Microwave assisted synthesis and antitumour activity of novel phenothiazinyl-thiazolyl-hydrazine derivatives. Archiv. Der Pharmazie 2012, 345, 574–583. (23) Prasad, K.T.; Therrien, B.; Mohan Rao, K. Cationic half-sandwich complexes (Rh, Ir, Ru) containing 2-substituted-1,8-naphthyridine chelating ligands: Syntheses, X-ray structure analyses and spectroscopic studies. J. Organomet. Chem. 2008, 693, 3049–3056. (24) Prasad, K.T.; Therrien, B.; Mohan Rao, K. Mono and dinuclear complexes of half-sandwich platinum group metals (Ru, Rh and Ir) bearing a flexible pyridyl-thiazole multidentate donor ligand. J. Organomet. Chem. 2010, 695, 226–234. (25) Gras, M.; Therrien, B.; Süss-Fink, G.; Casini, A.; Edafe, F.; Dyson, P. J. Anticancer activity of new organo-ruthenium, rhodium and iridium complexes containing the 2-(pyridine-2yl)thiazole N,N-chelating ligand. J. Organomet. Chem. 2010, 695, 119–1125. (26) Advanced Chemistry Development (2012) ACD/ChemSketch, version 12.0. Advanced Chemistry Development, Toronto, Canada. (27) Seillier, M.; Peuget, S.; Gayet, O.; Gauthier, C.; N'Guessan, P.; Monte, M.; Carrier, A.; Iovanna, J. L.; Dusetti, N. J. TP53INP1, a tumor suppressor, interacts with LC3 and ATG8family proteins through the LC3-interacting region (LIR) and promotes autophagy-dependent cell death. Cell Death Differ. 2012, 19, 1525–1535.


47


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 48 of 53

(28) Nihira, K.; Miki, Y.; Ono, K.; Suzuki, T.; Sasano, H. An inhibition of p62/SQSTM1 caused autophagic cell death of several human carcinoma cells. Cancer Sci. 2014, 105, 568–575. (29) Crighton, D.; Wilkinson, S.; O'Prey, J.; Syed, N.; Smith, P.; Harrison, P. R.; Gasco, M.; Garrone, O.; Crook, T.; Ryan, K. M. DRAM, a p53-induced modulator of autophagy, is critical for apoptosis. Cell 2006, 126, 121–134. (30) Zhang, X.-D.; Qi, L.; Wu, J.-C.; Qin, Z.-H. DRAM1 regulates autophagy flux through lysosomes. PLoS One 2013, 8, e63245. (31) Eby, K. G.; Rosenbluth, J. M.; Mays, D. J.; Marshall, C. B.; Barton, C. E.; Sinha, S.; Johnson, K. N.; Tang, L.; Pietenpol, J. A. ISG20L1 is a p53 family target gene that modulates genotoxic stress-induced autophagy. Mol. Cancer, 2010, 9, 95–102. (32) Chaluvally-Raghavan, P.; Zhang, F.; Pradeep, S.; Hamilton, M. P.; Zhao, X.; Rupaimoole, R.; Moss, T.; Lu, Y.; Yu, S.; Pecot, C. V.; Aure, M. R.; Peuget, S.; Rodriguez-Aguayo, C.; Han, H. D.; Zhang, D.; Venkatanarayan, A.; Krohn, M.; Kristensen, V. N.; Gagea, M.; Ram, P.; Liu, W.; Lopez-Berestein, G.; Lorenzi, P. L.; Børresen-Dale, A. L.; Chin, K.; Gray, J.; Dusetti, N. J.; McGuire, S. E.; Flores, E. R.; Sood, A. K.; Mills, G. B. Copy number gain of hsa-miR-569 at 3q26.2 leads to loss of TP53INP1 and aggressiveness of epithelial cancers. Cancer Cell. 2014, 26, 863–879. (33) Jin, C.; Yu, W.; Lou, X.; Zhou, F.; Han, X.; Zhao, N.; Lin, B. UCHL1 is a putative tumor suppressor in ovarian cancer cells and contributes to cisplatin resistance. J. Cancer. 2013, 4, 662–670. (34) Sosna, J.; Voigt, S.; Mathieu, S.; Kabelitz, D.; Trad, A.; Janssen, O.; Meyer-Schwesinger, C.; Schütze, S.; Adam, D. The proteases HtrA2/Omi and UCH-L1 regulate TNF-induced necroptosis. Cell Commun. Signal. 2013, 11, 76–83.


48

Page 49 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(35) Yang, F.; Long, W.; Xuechuan, H.; Xueqin, L.; Hongyun, M.; Yonghui, D. Upregulation of fas in epithelial ovarian cancer reverses the development of resistance to cisplatin. BMB Rep. 2015, 48, 30–35. (36) Kisova, A.; Zerzankova, L.; Habtemariam, A.; Sadler, P. J.; Brabec, V.; Kasparkova, J. Differences in the cellular response and signaling pathways between cisplatin and monodentate organometallic Ru(II) antitumor complexes containing a terphenyl ligand. Mol Pharm. 2011, 8, 949–957. (37) Guo, W.; Zou, Y.-B.; Jiang, Y.-G.; Wang, R.-W.; Zhao, Y.-P.; Ma, Z. Zinc induces cell cycle arrest and apoptosis by upregulation of WIG-1 in esophageal squamous cancer cell line EC109. Tumour Biol. 2011, 32, 801–808. (38) Bersani, C.; Xu, L.-D.; Vilborg, A.; Lui, W.-O.; Wiman, K. G. Wig-1 regulates cell cycle arrest and cell death through the p53 targets FAS and 14-3-3σ. Oncogene 2014, 33, 4407–4417. (39) Méndez Vidal, C.; Prahl, M.; Wiman, K. G. The p53-induced Wig-1 protein binds doublestranded RNAs with structural characteristics of siRNAs and miRNAs. FEBS Lett. 2006, 580, 4401–4408. (40) Vilborg, A.; Glahder, J. A.; Wilhelm, M. T.; Bersani, C.; Corcoran, M.; Mahmoudi, S.; Rosenstierne, M.; Grandér, D.; Farnebo, M.; Norrild, B.; Wiman, K. G. The p53 target Wig-1 regulates p53 mRNA stability through an AU-rich element. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 15756–15761. (41) Porté, S.; Valencia, E.; Yakovtseva, E. A.; Borràs, E.; Shafqat, N.; Debreczeny, J. Ē.; Pike, A. C.; Oppermann, U.; Farrés, J.; Fita, I.; Parés, X. Three-dimensional structure and enzymatic function of proapoptotic human p53-inducible quinone oxidoreductase PIG3. J. Biol. Chem. 2009, 284, 17194–17205.


49


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 50 of 53

(42) Flatt, P. M.; Polyak, K.; Tang, L. J.; Scatena, C. D.; Westfall, M. D.; Rubinstein, L. A.; Yu, J.; Kinzler, K. W.; Vogelstein, B.; Hill, D. E.; Pietenpol, J. A. p53-dependent expression of PIG3 during proliferation, genotoxic stress, and reversible growth arrest. Cancer Lett. 2000, 156, 63– 72. (43) He, H.; Sun, Y. Ribosomal protein S27L is a direct p53 target that regulates apoptosis. Oncogene 2007, 26, 2707–2716. (44) Karin, M.; Lin, A. NF-κB at the crossroads of life and death. Nat. Immunol. 2002, 3, 221– 227. (45) Ganesh, L.; Yoshimoto, T.; Moorthy, N. C.; Akahata, W.; Boehm, M.; Nabel, E. G.; Nabel, G. J. Protein methyltransferase 2 inhibits NF-kappaB function and promotes apoptosis. Mol. Cell Biol. 2006, 26, 3864–3874. (46) Follis, A. V.; Chipuk, J. E.; Fisher, J. C.; Yun, M.-K.; Grace, C. R.; Nourse, A.; Baran, K.; Ou, L.; Min, L.; White, S. W.; Green, D. R.; Kriwacki, R. W. PUMA binding induces partial unfolding within BCL-xL to disrupt p53 binding and promote apoptosis. Nat. Chem. Biol. 2013, 9, 163–168. (47) Kim, J.-Y.; So, K.-J.; Lee, S.; Park, J.-H. Bcl-rambo induces apoptosis via interaction with the adenine nucleotide translocator. FEBS Lett. 2012, 586, 3142–3149. (48) Barrera-Vilarmau, S.; Obregón, P.; de Alba, E. Intrinsic order and disorder in the bcl-2 member harakiri: insights into its proapoptotic activity. PLoS One 2011, 6, e21413. (49) Xie, Q.; Lin, T.; Zhang, Y.; Zheng, J.; Bonanno, J. A. Molecular cloning and characterization of a human AIF-like gene with ability to induce apoptosis. J. Biol. Chem. 2005, 280, 19673–19681.


50

Page 51 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(50) Sheridan, C.; Brumatti, G.; Elgendy, M.; Brunet, M.; Martin, S. J. An ERK-dependent pathway to Noxa expression regulates apoptosis by platinum-based chemotherapeutic drugs. Oncogene 2010, 29, 6428–6441. (51) Salvador, J. M.; Brown-Clay, J. D.; Fornace, A. J. Jr. Gadd45 in stress signaling, cell cycle control, and apoptosis. Adv. Exp. Med. Biol. 2013, 793,1–19. (52) Zhang, P.; Liu, S. S.; Ngan, H. Y. S. TAp73-mediated the activation of c-Jun N-terminal kinase enhances cellular chemosensitivity to cisplatin in ovarian cancer cells. PLoS One 2012, 7, e42985. (53) Yuan, Z.; Cao, K.; Lin, C.; Li, L.; Liu, H.-y.; Zhao, X.-y.; Liu, L.; Deng, H.-x.; Li, J.; Nie, C.-l.; Wei, Y.q. The p53 upregulated modulator of apoptosis (PUMA) chemosensitizes intrinsically resistant ovarian cancer cells to cisplatin by lowering the threshold set by Bcl-x(L) and Mcl-1. Mol. Med. 2011, 17, 1262–1274. (54) Zhao, Z.; Wang, J.; Tang, J.; Liu, X.; Zhong, Q.; Wang, F.; Hu, W.; Yuan, Z.; Nie, C.; Wei, Y. JNK- and Akt-mediated Puma expression in the apoptosis of cisplatin-resistant ovarian cancer cells. Biochem. J. 2012, 444, 291–301. (55) Li, H.; Xu, H.; Shen, H.; Li, H. MicroRNA-106a modulates cisplatin sensitivity by targeting PDCD4 in human ovarian cancer cells. Oncol. Lett. 2014, 7, 183–188. (56) Ferraris, S. E.; Isoniemi, K.; Torvaldson, E.; Anckar, J.; Westermarck, J.; Eriksson, J. E. Nucleolar AATF regulates c-Jun-mediated apoptosis. Mol. Biol. Cell. 2012, 23, 4323–4332. (57) Cooke, S. L.; Brenton, J. D. Evolution of platinum resistance in high-grade serous ovarian cancer. Lancet Oncol. 2011, 12, 1169–1174. (58) du Bois, A.; Reuss, A.; Pujade-Lauraine, E.; Harter, P.; Ray-Coquard, I.; Pfisterer, J. Role of surgical outcome as prognostic factor in advanced epithelial ovarian cancer: a combined


51


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 52 of 53

exploratory analysis of 3 prospectively randomized phase 3 multicenter trials. Cancer 2009, 115, 1234–1244. (59) Vergote, I.; Tropé, C. G.; Amant, F.; Kristensen, G. B.; Ehlen, T.; Johnson, N.; Verheijen, R. H. M.; van der Burg, M. E. L.; Lacave, A. J.; Benedetti Panici, P.; Kenter, G. G.; Casado, A.; Mendiola, C.; Coens, C.; Verleye, L.; Stuart, G. C. E.; Pecorelli, S.; Reed, N. S. Neoadjuvant chemotherapy or primary surgery in stage IIIC or IV ovarian cancer. New Engl. J. Med. 2010, 363, 943–953. (60) Gupta, G.; Kumar, J. M.; Garci, A.; Rangaraj, N.; Nagesh, N.; Therrien, B. Anticancer activity of half-sandwich RhIII and IrIII metalla-prisms containing lipophilic side chains ChemPlusChem 2014, 79, 610-618. (61) Bennett, M. A.; Huang, T. N.; Matheson, T. W.; Smith, A. K. (η6)-Hexamethylbenzene ruthenium complexes Inorg. Synth. 1982, 21, 74–78. (62) Sheldrick, G. M. A short history of SHELX. Acta Cryst., 2008, A64, 112–122. (63) Farrugia, L. ORTEP-3 for Windows. J. Appl. Crystallogr. 1997, 30, 565. (64) Livak, K. J.; Schmittgen T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. (65) Irimie A.I., Braicu C., Zanoaga O., Pileczki V., Gherman C., Berindan-Neagoe I., Campian R. S. Epigallocatechin-3-gallate suppresses cell proliferation and promotes apoptosis and autophagy in oral cancer SSC-4 cells Onco Targets Ther. 2015, 8, 461-470.


52

Page 53 of 53

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TABLE OF CONTENTS GRAPHIC:

Sixteen hydrazinyl-thiazolo arene ruthenium complexes were synthesized and tested in vitro for their antiproliferative activity on three tumor cell lines. A superior cytotoxic activity of the ruthenium complexes as compared to cisplatin and oxaliplatin, on both cisplatin-sensitive and cisplatin-resistant ovarian cancer cells, was observed. The biological activity was evaluated using microarray gene expression assay and Ingenuity Pathway Analysis thus providing valuable answers regarding the molecular mechanism of these complexes.


53

Synthesis, Anticancer Activity, and Genome Profiling of Thiazolo Arene

Recommend Documents