Synthetic Phytochelatin Surface Display in Cupriavidus metallidurans

Article pubs.acs.org/est

Synthetic Phytochelatin Surface Display in Cupriavidus metallidurans CH34 for Enhanced Metals Bioremediation Ronaldo Biondo,*,† Felipe Almeida da Silva,‡ Elisabete José Vicente,‡ Jorge Eduardo Souza Sarkis,§ and Ana Clara Guerrini Schenberg‡ †

Centro de Pesquisas em Biotecnologia, Universidade de São Paulo, Av. Prof. Lineu Prestes, 1730, Cidade Universitária, 05508-900 São Paulo, SP, Brasil ‡ Instituto de Ciências Biomédicas, Departamento de Microbiologia, Universidade de São Paulo, Av. Prof. Lineu Prestes, 1374, Cidade Universitária, 05508-900 - São Paulo, SP, Brasil § Instituto de Pesquisas Energéticas e Nucleares, Av. Prof. Lineu Prestes, 2242, Cidade Universitária, 05508-000 - São Paulo, SP, Brasil ABSTRACT: This work describes the effects of the cell surface display of a synthetic phytochelatin in the highly metal tolerant bacterium Cupriavidus metallidurans CH34. The EC20sp synthetic phytochelatin gene was fused between the coding sequences of the signal peptide (SS) and of the autotransporter β-domain of the Neisseria gonorrhoeae IgA protease precursor (IgAβ), which successfully targeted the hybrid protein toward the C. metallidurans outer membrane. The expression of the SS-EC20sp-IgAβ gene fusion was driven by a modified version of the Bacillus subtilis mrgA promoter showing high level basal gene expression that is further enhanced by metal presence in C. metallidurans. The recombinant strain showed increased ability to immobilize Pb2+, Zn2+, Cu2+, Cd2+, Mn2+, and Ni2+ ions from the external medium when compared to the control strain. To ensure plasmid stability and biological containment, the MOB region of the plasmid was replaced by the E. coli hok/sok coding sequence.

■

INTRODUCTION

considered a potential candidate for a variety of cleanup purposes.2,7 C. metallidurans CH34 was initially isolated in sediments of a decantation basin of a zinc factory in Belgium8 and it is known to possess genes conferring resistance to Ag1+, As3+, As5+, AsO21−, Au1+, Au3+, Bi3+, Cd2+, Co2+, CrO42−, Cs1+, Cu1+, Cu2+, Gd3+, Hg2+, HAsO42−, Mn2+, Ni2+, Pb2+, SeO32−, SeO42−, Sr2+, Tl1+, and Zn2+, located on the chromosome (3.9 Mb), a megaplasmid (2.6 Mb), and two large plasmids: pMOL30 (234 kb) and pMOL28 (171 kb).7,9 The main detoxification mechanism is based on efflux systems with multiple cross responses.7,9,10 However, bacteria protected by efflux systems are able to detoxify their cytoplasm but not the environment, which represents limitations to exploit the high biotechnological potential of C. metallidurans CH34 for metal remediation.11 Different attempts to develop a bacterial strain improved for metal bioremediation are reported in the literature. Bacteria displaying different metal-chelating compounds on their surface have been constructed and these recombinant cells exhibited enhanced adsorption of heavy metals to varying degrees.12 In the vast majority of these studies, E. coli was used for the cell

Environmental pollution by toxic metals is a matter of concern as metals are not biodegradable and, therefore, persist in the environment. Beyond certain concentrations, metals have harmful consequences for human and animal health, as well as endanger natural ecosystems.1 Different metals are discharged into the atmosphere, aquatic, and terrestrial environments, deriving, largely, from anthropogenic activities, such as industry, agriculture, and domestic wastes.2,3 In recent years, the growing production of electronic waste also became a matter of concern, due to its toxic metal content.4 Conventional chemical or physical wastewater treatment techniques are problematic in their application because they are often inadequate to reduce metal concentrations to acceptable regulatory standards. Besides, such treatments are in general cost-expensive and potentially risky due to the possibility of generation of hazardous byproducts.3,5 As a promising alternative, bioremediation approaches, using microorganisms as metals biosorption agents, have been developed. Bioremediation presents advantages such as lower costs, good performance, and safety, besides being environmentally friendly.3,6 The nonpathogenic bacterium Cupriavidus metallidurans CH34 (previously named Alcaligenes eutrophus, Ralstonia eutropha, Ralstonia metallidurans, Wautersia metallidurans) flourishes in soils heavily polluted with metals and has been © 2012 American Chemical Society

Received: Revised: Accepted: Published: 8325

February 14, 2012 July 6, 2012 July 13, 2012 July 13, 2012 dx.doi.org/10.1021/es3006207 | Environ. Sci. Technol. 2012, 46, 8325−8332

Environmental Science & Technology

Article

Figure 1. Schematic representation of the plasmids used in this work. (A) pHEβ plasmid region carrying the SS-His6-E-tag-IgAβ gene fusion; (B) pCM1 plasmid carrying the EC20sp surface display cassette; (C) pBBpanEGFP broad-host-range plasmid carrying the egfp gene under control of the pan promoter; (D) pCM2 plasmid carrying the EC20sp surface display cassette under control of the pan promoter; and (E) pCM3 plasmid: derivative of the pCM2 plasmid upon replacement of the MOB region by the hok/sok sequence. lacI: lac repressor gene; plac: lac promoter from the E. coli lactose operon; SS: signal peptide coding sequence; His6: sequence encoding six residues of histidine; E-tag: peptide epitope coding sequence; IgAβ: β-domain coding sequence from the N. gonorrhoeae IgA protease secretion system; (CM) chloramphenicol resistance gene; (EC20sp) synthetic phytochelatin gene; (REP) replication origin; (pan) modified B. subtilis mrgA promoter; (EGFP) egf p gene; (MOB) sequence encoding the mobilization gene and transfer origin; (hok/sok) sequence encoding genes involved in segregation stability. Restriction sites are indicated.

UT5600 (Δ ompT proC leu-6 trpE38 entA),17 and Cupriavidus metallidurans CH34 (ATTC-43123). E. coli cells were grown aerobically at 37 °C (DH5α) or 28 °C (UT5600) in LB medium [1% of Bacto Tryptone, 0.5% of Bacto Yeast extract (Becton Dickinson, Circle Sparks, MD) and 1% of NaCl (Carlo Erba Reatifs S.A., Rodano, MI)] or in LB supplemented with 25 μg/mL of chloramphenicol when required. C. metallidurans cells were grown aerobically at 28 °C in Nutrient Broth (NB) (Sigma-Aldrich, St. Louis, MO) or in TSM medium supplemented with 2% of sodium-gluconate (pH 5.0).8 For the growth curves, cells grown overnight in TSM medium, with shaking at 28 °C, were appropriately diluted (1:100, vol/vol) to inoculate 100 mL TSM and incubated with shaking at 28 °C during 48 h. Samples of the cultures were withdrawn at the indicated incubation times to determine the absorbancy at 600 nm (Ab600). The experiment was carried out in triplicate. Transformation of electrocompetent C. metallidurans cells was carried out as described by Taghavi et al.18 The recombinant cells were selected in Nutrient Agar (NA) containing 230 μg/ mL of chloramphenicol or Luria Agar (LA) containing 25 μg/ mL of chloramphenicol for C. metallidurans and E. coli, respectively. In Vitro Construction of the Synthetic Phytochelatin EC20sp. All DNA manipulations were performed using

surface display of different metal-chelating peptide/proteins, even though this bacterium is not suited for metal remediation purposes, given its low level of metal resistance. Metal-resistant bacteria, such as Cupriavidus metallidurans or Pseudomonas putida, were also subject to metal adsorption improvement.13,14 However, these recombinant strains are dependent on the addition of external inducers for expression of the metalchelating protein, raising limitations for scale-up processes and environmental use. The aim of the present work was to obtain a bacterial strain gathering the characteristics of high metal resistance, metal remediation ability, and genetic stability, avoiding the need to add external inducers for gene expression or antibiotics for selection of plasmid carrying cells. To this end, the surface display of the synthetic phytochelatin EC20sp, with the structure [(Glu-Cys)20Gly],15 was created in the C. metallidurans CH34 strain, which resulted in increased capability of the cells to immobilize several metal ions.

■

MATERIALS AND METHODS Bacterial Strains and Growth Conditions. The bacterial strains used were Escherichia coli DH5α [F′/endA1 hsdR17 (rK−mK+) glnV44 thi-1 recA1 gyrA (Nalr) relA1 Δ (lacIZYAargF) U169 deoR (ϕ80dlacΔ(lacZ) M15],16 Escherichia coli 8326

dx.doi.org/10.1021/es3006207 | Environ. Sci. Technol. 2012, 46, 8325−8332


Article

standard methods.16 The synthetic gene encoding (GluCys)20Gly (EC20sp), without stop codon and flanked by EcoRV and SalI (italicized) restriction sites was constructed according to Bae et al.15 Two oligonucleotides: ec-1 5′TTTGATATCTAATGGAATGTGAATGTGAAT GTGAATGTGAATGTGAATGTGAATGTGAGTGTGAATGTGAGTGCGAATGCGAA3′ and ec-2 5′TTTGTCGACACCACATTCACATTCACATTCACATTCAC AT TCAC A TTCGCATT CA C ATT CG CATTCGCATTCGCACTC3′ were mixed, hybridized at the underlined sequence, and PCR-amplified. The ec-1 oligonucleotide contains two extra bases (bold) downstream of the EcoRV site in order to generate an in-frame fusion upon the cloning steps and ec-2 has no stop codon. The amplified fragment was cloned into the pGEM-T Easy System I cloning vector (Promega, Madison, WI), resulting in the pGEMEC20sp plasmid. The insertion-containing plasmid was sequenced using the 5′TAATACGACTCACTATAGGG3′ primer. Cloning of the EC20sp Gene in the pHEβ Vector. The pHEβ vector (Figure 1A) carries a His6 coding sequence fused between the signal sequence (SS) and the E-tag coding sequence, followed by the IgAβ domain coding sequence.17 The EC20sp fragment was isolated from the pGEMEC20sp plasmid by EcoRI and SalI digestion and cloned into pHEβ, previously digested with the same enzymes, generating the pECβ plasmid. To exclude the His6 coding fragment, pECβ was digested with BglI followed by T4 Klenow fragment (Fermentas International, Burlington, ON, Canada) treatment, EcoRV digestion, and recircularization. The final plasmid, named pCM1, was sequenced using the 5′CATTCTAGGTATTACACGAGC3′ primer (Figure 1B). Cloning of the SS-EC20sp-E-tag-IgAβ Fragment under Pan Promoter Control. The SS-EC20sp-E-tag-IgAβ fragment was PCR-amplified from pCM1 using the 5′CCCATATGAAATACCTATTGCC3′ and 5′CCAAGCTTTTAGAAACGAATCT G3′ primers. The amplified fragment was cloned in pCR2.1-TOPO (Invitrogen, Carslbad, CA). The SS-EC20spE-tag-IgAβ fragment was isolated by NdeI and KpnI digestion and cloned in the pBB-panEGFP plasmid,19 previously digested with the same enzymes and removal of the egf p gene. The final plasmid was named pCM2 and the construction was sequenced using the 5′CCGCGGTTCGGTATCGAAAGC3′ primer (Figure 1C and 1D). Construction of the pCM3 Plasmid. The amplification of the hok/sok fragment was carried out using the pOU61 plasmid20 as the template and the parB1 5′AAGACGTCAACAAACTCCGGGA3′ and parB2 5′AAGGCGCCACAACATCAGCAAG3′ primers. The amplicon was cloned in pCR2.1TOPO (Invitrogen, Carslbad, CA) and sequenced using the M13 primer 5′GTAAAACGACGGCCAG3′. The pCM2 plasmid was digested with AatII and NarI enzymes and the MOB fragment was removed. Next, the cloned hok/sok fragment was isolated by NarI and AatII digestion and subcloned into the MOB-free pCM2 plasmid. The final plasmid was named pCM3 (Figure 1 E). Protein Methods. SDS-PAGE. Cell fractions were analyzed by electrophoresis in denaturing 12.5% polyacrilamide gels.21 Cells were grown aerobically in TSM until Ab600 reached 1.0, fractionated in soluble, inner membrane (IM) and outer membrane (OM) fractions, and immunoblotted.17 Metals Bioaccumulation. Analytical-grade salts (Merck, KGaA, Darmstadt, Germany) of CdCl2 × 2.5H2O, CoCl2 × 6H2O, CuCl2 × 5H2O, MnCl2 × 4H2O, NiCl2 × 6H2O, and

ZnCl2 were used to prepare 1 M stock solutions, except for PbCl2, where a 35 mM stock solution was used. The stock solutions were filter-sterilized using a 0.22-μm membrane (Millipore). Time of contact biomass-metal. C. metallidurans CH34 cells were grown in TSM until Ab600 reached 1.0. The cells were harvested and incubated in Milli-Q water or in Milli-Q water containing either 0.1 mM or 1.0 mM of CdCl2, at 28 °C under shaking, and the Cd2+ concentration in the supernatant was determined at 2, 6, 12, and 24 h incubation times by highresolution inductively coupled plasma mass spectrometry (ELEMENT 1, Thermo Finnigan). Bioaccumulation experiments were carried out with cells grown either in TSM or TSM containing only one metal species (300 μM of Cd2+, Co2+, Mn2+ or Zn2+, 128 μM of Ni2+, 100 μM of Cu2+ or Pb2+) until Ab600 reached 1.0. Cells were harvested and then incubated during 24 h under shaking, in Milli-Q water containing a single metal species (Cd2+, Co2+, Cu2+, Mn2+, Ni2+, Pb2+, or Zn2+) at 1 mM final concentration. Cells were harvested, washed, and digested overnight with 70% nitric acid. The amount of metal adsorbed in the bacterial mass was measured with high-resolution inductively coupled plasma mass spectrometry (ELEMENT 1, Thermo Finnigan). All experiments were performed twice in duplicate and the results correspond to the average ± standard deviation. Cell viability was checked by plating appropriate dilutions of cells on Nutrient Agar before and after incubation in pure water or in pure water containing metal. The plates were incubated overnight at 28 °C and the colonies were counted. Electron Microscopy Analysis. Electron microscopy was used on whole cells incubated for 24 h in Milli-Q water with or without 1 mM of lead. Cell preparations were carried out as previously described22 and ultrathin sections of 70 nm were obtained with an ultramicrotome (Leica Ultracut R) equipped with a diamond knife and fixed in gold grids. A transmission electron microscope (LEO 906E) was used to reveal the presence of lead in cells. Photomicrographs were captured with a digital camera and processed. The cells were observed at a magnification of 46,500×. Bacterial Conjugation. Overnight cultures of E. coli DH5α cells carrying either pCM2 or pCM3 (donor strains) and of C. metallidurans CH34 wild type cells (recipient strain) were mixed in NB medium and incubated for 2 h at 28 °C without shaking. After incubation, 50 μL of each mating mixture was plated on Nutrient Agar (NA) supplemented with 230 μg/mL of chloramphenicol. Control cells were plated on NA supplemented with chloramphenicol at the final concentrations of 25 or 230 μg/mL. The mobilization frequency was calculated as the ratio between the number of transconjugants and the number of recipient cells. The experiment was carried out in duplicate. Segregational Stability. Segregational stability was examined according to Menart et al.23 with modifications. The NA medium was utilized without antibiotic or containing 230 μg/mL of chloramphenicol (NACM230). NB cultures of C. metallidurans CH34/pCM2 or C. metallidurans CH34/pCM3 were incubated overnight at 28 °C under shaking at 180 rpm and transferred into NA medium without antibiotic. Upon reaching stationary growth phase, cells were transferred into fresh NA medium without antibiotic. This procedure was repeated ten times. The cells were appropriately diluted and plated on NA and NACM230 agar plates. Segregational stability was determined by the ratio between the numbers of colony 8327



Article

forming units (CFU) on NACM230 plates and on NA plates and given as a percentage of cells still showing antibiotic resistance. The experiment was carried out twice in duplicate.

■

RESULTS AND DISCUSSION Survival Rate of the Cells in Pure Water. The survival rate of the C. metallidurans CH34 cells upon 24 h of incubation in Milli-Q water was 1.08 (time zero: 5.2 × 109 CFU/mL; 24 h: 5.6 × 109 CFU/mL). This is a relevant result, which enables the application of the recombinant derivatives for metal remediation of industrial effluents or waste waters. EC20sp Cell Surface Display in C. metallidurans CH34. The DNA sequence coding for a synthetic phytochelatin with the structure (Glu-Cys)20Gly devoid of a stop codon, named EC20sp, was synthesized in vitro and cloned in the pHEβ plasmid.17 This plasmid encodes the signal sequence (SS), His6 sequence, E-tag sequence, and the β-domain sequence of the Neisseria gonorrhoeae IgA protease secretion system (IgAβ) (Figure 1A). The SS-IgAβ fragment encodes an autotransporter protein that initially crosses the inner membrane via the Sec pathway, followed by the insertion of the C-terminal β-domain in the outer membrane, thus allowing the translocation and anchoring of the heterologous attached protein on the bacterial cell surface.24 The His6 coding sequence was removed from the pHEβ plasmid and replaced by the EC20sp gene inserted in frame with the SS coding sequence, resulting in a cell surface display cassette, which encodes the EC20sp phytochelatin (4.5 KDa) fused to the E-tag-IgAβ protein (∼45 KDa). The E-tag epitope allows immunodetection by a monoclonal antibody (anti-Etag). The new plasmid, named pCM1 (Figure 1B), carries the SS-EC20sp-E-tag-IgAβ gene fusion under the control of the E. coli lac promoter. The pCM1 plasmid was used to transform E. coli UT5600 and the transformant cells were found to express EC20sp in the outer membrane (data not shown). Considering that the pCM1 plasmid is unable to replicate in C. metallidurans CH34, in order to ensure expression in this bacterium, the SS-EC20sp-E-tag-IgAβ fragment was transferred from pCM1 to the pBB-panEGFP plasmid (Figure 1C), which derives from the broad-host-range pBBR1MCS plasmid vector (30−40 copies/cell).25−27 The pBB-panEGFP plasmid carries the pan promoter, previously described in our laboratory as a strong promoter for expression in C. metallidurans.19 The SSEC20sp-E-tag-IgAβ fragment was cloned under pan promoter control, replacing the egf p gene in pBB-panEGFP, and the final plasmid, named pCM2 (Figure 1D), was used in the genetic transformation of C. metallidurans CH34 cells. To determine the expression and the subcellular localization of the recombinant protein, cells were harvested and the proteins of the soluble, inner membrane (IM), and outer membrane (OM) fractions were analyzed by SDS-PAGE, blotted, and probed with the anti-E-tag monoclonal antibody. As can be seen in Figure 2, a single protein band of the expected size (∼50 KDa) was found only in the outer membrane fraction (OM) of the C. metallidurans CH34/ pCM2 recombinant cells, showing that the EC20sp phytochelatin was correctly targeted, presenting no sign of proteolytic degradation. Valls et al.13 used the same autotransporter system for the cell surface display of a mouse metallothionein in C. metallidurans. The metallothionein anchoring cassette was integrated in the bacterial chromosome and its expression was driven by the P. putida inducible Pm promoter, resulting in

Figure 2. Western-blotting of the EC20sp hybrid protein in C. metallidurans strains. 1: C. metallidurans CH34 wild type; 2: C. metallidurans CH34/pBBR1MCS; and 3: C. metallidurans CH34/ pCM2. The proteins were fractionated in soluble, inner (IM), and outer (OM) membrane. The band corresponding to the EC20sp-Etag-IgAβ protein is indicated by an arrow.

an increased ability of Cd 2+ bioaccumulation in the recombinant strain, upon addition of 3-methyl-benzoate to induce the promoter. In the present work, the EC20sp synthetic phytochelatin gene was cloned under control of the strong constitutive pan promoter,19 and the final construct was maintained in the episomal state to provide multiple copies of the EC20sp anchoring cassette, with the advantage of no requirement for any external inducer addition for expression of the metal-chelating protein. Metals bioaccumulation. To find out whether the expression and cell surface display of EC20sp increased the ability of C. metallidurans CH34 cells to adsorb metal ions, cells were grown in TSM medium to midlog phase, harvested, and the bacterial biomass was inoculated in Milli-Q water containing metal. Given that most of the results in the literature refer to Cd2+ adsorption, experiments were initially performed with cadmium. The Cd2+ concentrations used were 0.1 mM or 1.0 mM and the metal concentration in the supernatant was determined upon 2, 6, 12, and 24 h of incubation with the cells. When adsorption was carried out in 0.10 mM Cd2+, the recombinant cells adsorbed, upon 2 h of incubation, 20.90 nM of Cd2+/mg cell dw (22% more than the control cells) and, upon 24 h incubation, 30.40 nM of Cd2+/mg cell dw (50% more than the control cells). When adsorption was carried out in 1.0 mM Cd2+, the recombinant cells adsorbed, upon 2 h incubation, 22.30 nM of Cd2+/mg cell dw (90% more than the control cells), and, upon 24 h incubation, 176.30 nM of Cd2+/mg cell dw (60% more than the control cells). The cadmium adsorption reached the highest value upon 24 h of incubation of the cells in 1.0 mM of Cd2+. Therefore, this incubation time and this metal concentration were used in the next bioaccumulation experiments, where metal adsorption was measured directly in the biomass. In parallel, experiments to measure adsorption directly in the biomass were also carried out using cells pregrown in TSM containing metal. This approach was used since it was shown in previous work that EGFP expression driven by the pan promoter in C. metallidurans CH34 can be further increased when cells are grown in the presence of metals.19 The bioaccumulation experiments were performed with 1 mM Cd2+, Co2+, Cu2+, Mn2+, Ni2+, Pb2+, or Zn2+ ions, since this metal concentration is inhibitory to the growth of several bacteria but not to C. metallidurans CH34. 8328



Article

showed increased bioaccumulation of several metals, particularly when the cells were pregrown in the presence of the metal (induced). For bioremediation purposes, this is a meaningful result, since the presence of the metallic contaminant itself enhances the bioremediation capability of the cells. The metal adsorption capability of the recombinant strain relative to the control was increased approximately 219%, 210%, 76%, 59%, 45%, and 31% for Zn2+, Pb2+, Cu2+, Cd2+, Ni2+, and Mn2+, respectively (Figure 3). The greatest increases in metal accumulation by the C. metallidurans CH34/pCM2 cells were found for lead (547.5 ± 17.1 nmol of Pb2+/mg cell dry weight; Figure 3A) and zinc (510.7 ± 15.3 nmol of Zn2+/mg cell dry weight; Figure 3B), approximately 3-fold higher than the wild type in both cases. In contrast to the other metal ions examined, for cobalt bioaccumulation only a slight increase was found: 51.5 ± 2.1 nmol of Co2+ /mg cell dry weight for C. metallidurans CH34/ pCM2 cells and 45.5 ± 2.0 nmol of Co2+ /mg cell dry weight for the C. metallidurans/pBBR1MCS control cells. The affinity of C. metallidurans CH34/pCM2 cells for the different metal ions was found in the following order: Pb2+ > Zn2+ > Cu2+ > Cd2+ > Ni2+ > Mn2+ > Co2+, while for control cells the metal affinity was Cu2+ > Pb2+ > Zn2+ > Cd2+ > Ni2+ > Mn2+ > Co2+, showing that the presence of EC20sp on the cell surface modified the interaction cell-metal. According to the specific metal pollutant, it is possible to envisage the replacement of EC20sp by another peptide, which preferentially binds the metal of interest. In fact, several cysteine-rich peptides (X-Cys)n-Gly, where X = Glu, Asp, Lys, Gly, Ser, or Gln, were synthesized, showing different metal affinities.28,29 Several factors, besides the differences in the metal chelating protein, in the promoter strength, and in the number of copies of the heterologous construction per cell could account for the difference in metal adsorption efficiency found here with those in the literature. The main difficulty in comparing our results with previous reports comes from diverse experimental conditions: (i) here the adsorption analysis was performed in aqueous solution whereas in other works this quantification was carried out in nutrient-rich or chemically defined media; (ii) the

No significant variation in colony forming units was observed after 24 h of incubation with any of the examined metal ions, showing that cell viability was not affected. Accordingly, the growth kinetics of C. metallidurans CH34/pCM2 cells showed no significant difference with that of control cells, indicating that the genetic modification did not affect normal cell functioning (data not shown). As can be observed in Figure 3, in comparison to the control cells, the recombinant C. metallidurans CH34/pCM2 cells

Figure 3. Metals accumulation by C. metallidurans CH34 strains. Midlog phase cells were harvested and incubated for 24 h in Milli-Q water containing a single metal species at 1 mM final concentration. The amount of metal bound in the bacterial cells was measured by ICP-AES spectrometry and is indicated in nanomoles of the metal ion per milligram of cell dry weight (dw). One: C. metallidurans CH34/ pBBR1MCS; 2: C. metallidurans CH34/pCM2; and 3: C. metallidurans CH34/pCM2/induced (cultured in medium containing metal). A: Pb2+; B: Zn2+; C: Cu2+; D: Cd2+; E: Ni2+, F: Mn2+. The values shown are the average of two independent experiments using duplicate samples for each determination ± standard deviation.

Figure 4. Transmission electron micrographs of C. metallidurans CH34 cells. A: C. metallidurans/pCM2 cells after 24 h of incubation with 1 mM of lead (Pb2+), and B: C. metallidurans CH34 wild type cells after 24 h of incubation with 1 mM of lead. Cells were observed at a magnification of 46 500×. 8329



Article

metal concentration used in the experiments; (iii) the time of contact between cells and metal ions; (iv) metal quantification carried out either in the culture supernatant or directly in the biomass, as in the present work. Also, it is worth noting that the literature presents conflicting results about metal-adsorption for the same strain. In fact, for C. metallidurans CH34 wild type cells, Valls et al.13 reported an adsorption of 14 nmol of Cd2+/ mg cell dry weight, whereas Diels30 reported an adsorption of 1200 nmol of Cd2+/mg cell dry weight. In the present work, the adsorption of wild type cells was found to be 110.8 nmol of Cd2+/mg cell dry weight. Regarding lead adsorption efficiency by engineered bacteria, few studies have been reported. In spite of the different experimental conditions mentioned above, the lead bioaccumulation by C. metallidurans CH34/pCM2 cells found in this study (547.5 nmol of Pb2+/mg cell dry weight) is one of the highest found so far for engineered bacteria. For instance, Pazirandeh et al.31 showed increased lead adsorption by E. coli expressing cystein-rich periplasmic peptides under ptac promoter control, reaching 0.98 nmol of Pb2+/mg cell dry weight, and Huang et al.32 reported 413.4 nmol of Pb2+/mg cell dry weight in E. coli by MerP expression under control of the hybrid T7lac promoter. Electron Microscopy Analysis. To visualize metal adsorption on the cell surface, an experiment was performed utilizing lead. C. metallidurans CH34/pCM2 and control cells were incubated in water containing 1 mM of Pb2+ and the bacterial mass was treated and fixed in resin. Ultrathin sections were observed by electron microscopy. As can be seen in Figure 4, the electronic micrographs showed black spots on the cell surface, forming structures surrounding the recombinant bacterial cell in higher amount than the wild type, an indication of the interaction between Pb2+ and the peptides displayed, confirming that the cell surface display of EC20sp increased the amount of Pb2+ bound to the outer membrane of the recombinant cells (Figure 4A). In contrast, only a few particles were observed on the surface of wild type cells (Figure 4B). Plasmid Stabilization by Insertion of the E. coli hok/ sok Coding Sequence. Once the metal remediation ability conferred by the pCM2 plasmid was confirmed, the next step was to stabilize the new genetic information. With the purpose of maintaining multiple copies of the genetic construct/cell, we adopted the approach of using the E. coli hok/sok system, which kills plasmid-free cells.33,34 The hok/sok encoding DNA fragment, obtained from plasmid pOU61,20 was inserted in the pCM2 plasmid, giving rise to the pCM3 plasmid (Figure 1E). As the pCM2 plasmid carries the MOB sequence (Figure 1D) coding for a relaxase (Mob) and the transfer origin (oriT) involved in the exchange of genetic material via conjugation,35 the MOB sequence was excised and replaced by the hok/sok sequence in pCM3. To certify that the MOB region removal precluded plasmid mobilization, a mating experiment between E. coli cells carrying either the pCM2 or the pCM3 plasmid and C. metallidurans CH34 wild type cells was carried out. Plasmid transfer was only found to occur between E. coli/pCM2 and C. metallidurans CH34 cells with a mobilization frequency of 3.1 × 10−3, showing that the absence of the MOB region in the pCM3 plasmid completely prevented its transfer. This result ensures biological containment, which is of crucial importance regarding biosafety. On the other hand, the effect of the insertion of the hok/sok sequence on plasmid stability was examined. As shown in Figure 5A, after 75 generations, 100% of the cells carried the

Figure 5. A: Stability of the pCM2 and pCM3 plasmids in C. metallidurans CH34, as a function of the number of cell generations. The values are the average of two independent experiments using duplicate samples for each determination ± standard deviation. B: Growth curves of C. metallidurans CH34/pCM3 and C. metallidurans CH34/pBBR1MCS (control) cells in liquid TSM medium. The values correspond to the average of three replicates ± standard deviation.

pCM3 plasmid, while only 65% of the cells still carried pCM2. From 75 generations on, a slow decrease in the pCM3 stability was observed. Plasmid stabilization in C. metallidurans by the hok/sok system is described here for the first time and is in agreement with other reports that already showed the efficiency of this approach for plasmid maintenance in the absence of antibiotic selective pressure in E. coli,33,36 P. putida and Serratia marcescens,33 and Xanthomonas campestris.37 To check whether the metal adsorption capability of the cells was affected by the new pCM3 plasmid, a bioaccumulation experiment in water containing Pb2+ was performed. The C. metallidurans CH34/pCM3 cells, pregrown in medium containing lead, presented an adsorption capability 50% higher than C. metallidurans CH34/pCM2 cells under the same conditions (data not shown). The growth kinetics of the stabilized strain was also examined and no significant difference was observed with that of the control cells, indicating normal cell functioning (Figure 5B). This is a relevant result, since it proves that the genetic modification did not harm the cells. With the IgAβ pore being larger than those of the typical E. coli porins and similar to the channel found in the outer membrane components as TolC,17 the challenge here was to obtain a strain with high metal-adsorbing capability without compromising normal cell physiology, which could result from high numbers of IgAβ pores created in the cell envelope. The results of the present work reinforce the biotechnological potential of phytochelatin surface display to increase 8330



Article

(12) Kotrba, P.; et al. Bacterial surface display of metal-binding sites. In Microbial Biosorption of Metals; Kotrba, P., Mackova, M., Macek, T., Eds.; Springer: New York, 2011; pp 249. (13) Valls, M.; Atrian, S.; Lorenzo, V.; Fernandéz, L. A. Engineering a mouse metallothionein on the cell surface of Ralstonia eutropha CH34 for immobilization of heavy metals in soil. Nat. Biotechnol. 2000, 18, 661−665. (14) Valls, M.; Lorenzo, V.; Gonzàlez-Duarte, R.; Atrian, S. Engineering outer-membrane proteins in Pseudomonas putida for enhanced heavy-metal bioadsorption. J. Inorg. Biochem. 2000, 79, 219− 223. (15) Bae, W.; Chen, W.; Mulchandani, A.; Mehra, R. Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol. Bioeng. 2000, 70, 518−524. (16) Sambrook, J.; Russell, D. W. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press: New York, 2001. (17) Veiga, E.; Sugawara, E.; Nikaido, H.; Lorenzo, V.; Fernández, L. A. Export of autotransported proteins proceeds through an oligomeric ring shaped by C-terminal domains. EMBO J. 2002, 21, 2122−2131. (18) Taghavi, S.; van-der-Lelie, D.; Mergeay, M. Electroporation of Alcaligenes eutrophus with (mega) plasmids and genomic DNA fragments. Appl. Environ. Microbiol. 1994, 60, 3585−3591. (19) Ribeiro-dos-Santos, G.; Biondo, R.; Quadros, O. F.; Vicente, E. J.; Schenberg, A. C. A metal-repressed promoter from Gram-positive Bacillus subtilis is highly active and metal-induced in Gram-negative Cupriavidus metallidurans. Biotechnol. Bioeng. 2010, 107, 469−477. (20) Larsen, J. E.; Gerdes, K.; Light, J.; Molin, S. Low-copy-number plasmid-cloning vectors amplifiable by derepression of an inserted foreign promoter. Gene 1984, 28, 45−54. (21) Studier, F. W. Analysis of bacteriophage T4 early RNAs and proteins on slab gels. J. Mol. Biol. 1973, 79, 237−248. (22) Ledrich, M. L.; Stemmler, S.; Laval-Gilly, P.; Foucaud, L.; Falla, J. Precipitation of silver-thiosulfate complex and immobilization of silver by Cupriavidus metallidurans CH34. Biometals 2005, 18, 643− 650. (23) Menart, V.; Jevsevar, S.; Vilar, M.; Trobis, A.; Pavko, A. Constitutive versus thermoinducible expression of heterologous proteins in Escherichia coli based on strong PR, PL promoters from phage lambda. Biotechnol. Bioeng. 2003, 83, 181−190. (24) Klauser, T.; Pohlner, J.; Meyer, T. F. Extracellular transport of cholera toxin B subunit using Neisseria IgA protease β-domain: conformation-dependent outer membrane translocation. EMBO J. 1990, 9, 1991−1999. (25) Kovach, M. E.; Phillips, R. W.; Elzer, P. H.; Roop, R. M., 2nd; Peterson, K. M. pBBR1MCS: a broad-host-range cloning vector. Biotechniques 1994, 16, 800−802. (26) Antoine, R.; Locht, C. Isolation and molecular characterization of a novel broad-host-range plasmid from Bordetella bronchiseptica with sequence similarities to plasmids from Gram-positive organisms. Mol. Microbiol. 1992, 6, 1785−1799. (27) Schneider, D.; Faure, D.; Noirclerc-Savoye, M.; Barrière, A. C.; Coursange, E.; Blot, M. A broad-host-range plasmid for isolating mobile genetic elements in Gram-negative bacteria. Plasmid 2000, 44, 201−207. (28) Bae, W.; Mehra, R. K. Metal-binding characteristics of a phytochelatin analog (Glu-Cys)2Gly. J. Inorg. Biochem. 1997, 66, 201− 210. (29) Satofuka, H.; Fukui, T.; Takagi, M.; Atomi, H.; Imanaka, T. Metal-binding properties of phytochelatin-related peptides. J. Inorg. Biochem. 2001, 86, 595−602. (30) Diels, L. Accumulation and precipitation of Cd and Zn ions by Alcaligenes eutrophus strains. In Biohydrometallurgy; Salley, J., McCready, R. G. I., Wichlacz, P. Z., Eds.; CANMET: Ottawa, ON, 1990; pp 369. (31) Pazirandeh, M.; Wells, B. M.; Ryan, R. L. Development of bacterium-based heavy metal biosorbents: enhanced uptake of cadmium and mercury by Escherichia coli expressing a metal binding motif. Appl. Environ. Microbiol. 1998, 64, 4068−4072.

metal-accumulation in C. metallidurans CH34. The use of a strong promoter, which does not require external inducers, to express a phytochelatin analog with a broad-range of metal binding ability was shown to increase the bacterial remediation capability of several metals. Using this bioremediation approach, it is also possible to recover the adsorbed metals from the biomass, of particular relevance when precious metals are involved.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]; tel.: (55) 11 3091 7275; fax: (55) 11 3091 7354; address: Centro de Pesquisas em Biotecnologia Universidade de São Paulo, São Paulo, Brasil. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to the Brazilian mining company VALE (www. vale.com) and to the Brazilian funding agency Conselho Nacional de Pesquisas (CNPq) for financial support. Our special thanks to the Consejo Nacional de Biotecnologiá de Madrid for providing the pHEβ plasmid and the E. coli UT5600 strain, to Dr. Luis Angel Fernández Herrero for scientific collaboration and to the Cellular Biology Laboratory of Instituto Butantan for electron microscopy facilities.

■

REFERENCES

(1) Wang, J.; Chen, C. Biosorbents for heavy metal removal and their future. Biotechnol. Adv. 2009, 27, 195−226. (2) Diels, L.; Van Roy, S.; Taghavi, S.; Van Houdt, R. From industrial sites to environmental applications with Cupriavidus metallidurans. Antonie van Leeuwenhoek 2009, 96, 247−258. (3) Gavrilescu, M. Removal of heavy metals from the environment by biosorption. Eng. Life Sci. 2004, 4, 219−232. (4) Babu, B. R.; Parande, A. K.; Basha, C. A. Electrical and electronic waste: a global environmental problem. Waste Manage. Res. 2007, 25, 307−318. (5) Atkinson, B. W.; Bux, F.; Kasan, H. C. Considerations for application of biosorption technology to remediate metal-contaminated industrial effluents. Water SA 1998, 24, 129−135. (6) Gadd, G. M. Biosorption: critical review of scientific rationale, environmental importance and significance for pollution treatment. J. Chem. Technol. Biotechnol. 2008, 84, 13−28. (7) Mergeay, M.; Monchy, S.; Vallaeys, T.; Auquier, V.; Benotmane, A.; Bertin, P.; Taghavi, S.; Dunn, J.; van-der-Lelie, D.; Wattiez, R. Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a catalogue of metal-responsive genes. FEMS Microbiol. Rev. 2003, 27, 385−410. (8) Mergeay, M.; Nies, D.; Schlegel, H. G.; Gerits, J.; Charles, P.; Van Gijsegem, F. Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals. J. Bacteriol. 1985, 162, 328−334. (9) Janssen, P. J.; Van Houdt, R.; Moors, H.; Monsieurs, P.; Morin, N.; Michaux, A.; Benotmane, M. A.; Leys, N.; Vallaeys, T.; Lapidus, A.; Monchy, S.; Médigue, C.; Taghavi, S.; McCorkle, S.; Dunn, J.; Vander-Lelie, D.; Mergeay, M. The complete genome sequence of Cupriavidus metallidurans strain CH34, a master survivalist in harsh and anthropogenic environments. PLoS ONE 2010, 5, 1−33. (10) Monsieurs, P.; Moors, H.; Van Houdt, R.; Janssen, P. J.; Janssen, A.; Coninx, I.; Mergeay, M.; Leys, N. Heavy metal resistance in Cupriavidus metallidurans CH34 is governed by an intricate transcriptional network. Biometals 2011, 24, 1133−1151. (11) Nies, D. H. Heavy metal-resistant bacteria as extremophiles: molecular physiology and biotechnological use of Ralstonia sp. CH34. Extremophiles 2000, 4, 77−82. 8331



Article

(32) Huang, C. C.; Sub, C. C.; Hsieh, J. L.; Tseng, C. P.; Lin, P. J.; Chang, J. S. Polypeptides for heavy-metal biosorption: capacity and specificity of two heterogeneous MerP proteins. Enzyme Microb. Technol. 2003, 33, 379−385. (33) Gerdes, K. The parB hok/sok locus of plasmid R1: a general purpose plasmid stabilization system. Nat. Biotechnol. 1988, 6, 1402− 1405. (34) Gerdes, K.; Wagner, E. G. RNA antitoxins. Curr. Opin. Microbiol. 2007, 10, 117−124. (35) Szpirer, C. Y.; Faelen, M.; Couturier, M. Mobilization function of the pBHR1 plasmid, a derivative of broad-host-range plasmid pBBR1. J. Bacteriol. 2001, 183, 2101−2110. (36) Wu, K.; Wood, T. K. Evaluation of the hok/sok killer locus for enhanced plasmid stability. Biotechnol. Bioeng. 1994, 44, 912−921. (37) Pimenta, A. L.; Rosato, Y. B.; Astolfi-Filho, S. Effect of parB on plasmid stability and gene expression in Xanthomonas campestris. Lett. Appl. Microbiol. 1992, 14, 233−237.

8332


Synthetic Phytochelatin Surface Display in Cupriavidus metallidurans

Recommend Documents