Temperature Control of Biotin Binding and Release with A Streptavidin

Allie C. Obermeyer and Bradley D. Olsen ..... Yoshikuni Nabeshima , Tae Gwan Park , Ollie W. Press , Tsuyoshi Shimoboji , Sara Shoemaker , Heung Joon ...
0 downloads 0 Views 222KB Size
Download PDF
Bioconjugate Chem. 1999, 10, 395−400

395

Temperature Control of Biotin Binding and Release with A Streptavidin-Poly(N-isopropylacrylamide) Site-Specific Conjugate Zhongli Ding, Cynthia J. Long, Yoshiki Hayashi, Esma V. Bulmus, Allan S. Hoffman,*,† and Patrick S. Stayton*,‡ Department of Bioengineering, University of Washington, Seattle, Washington 98195. Received September 11, 1998; Revised Manuscript Received February 2, 1999

The many laboratory and diagnostic applications utilizing streptavidin as a molecular adaptor rely on its high affinity and essentially irreversible interaction with biotin. However, there are many situations where recovery of the biotinylated molecules is desirable. We have previously shown that poly(N-isopropylacrylamide) (PNIPAAm), a temperature-sensitive polymer, can reversibly block biotin association as the polymer’s conformation changes at its lower critical solution temperature (LCST). Here, we have constructed a streptavidin-PNIPAAm conjugate which is able to bind biotin at room temperature or lower and release bound biotin at 37 °C. The conjugate can repeatedly bind and release biotin as temperature is cycled through the LCST. A genetically engineered streptavidin mutant, E116C, which has only one cysteine residue, was conjugated site specifically via the sulfhydryl groups with a PNIPAAm that has pendent sulfhydryl-reactive vinyl sulfone groups. The conjugation site is near the tryptophan 120 residue, which forms a van der Waals contact with biotin that is important in generating the large binding free energy. The temperature-induced conformational change of the polymer at position 116 may lead to structural changes in the region of tryptophan 120 that are responsible for the reversible binding between biotin and the conjugated streptavidin.

INTRODUCTION

Diverse and widespread applications utilizing streptavidin as a molecular adaptor have been developed that utilize the tight binding of biotin to the protein (ca. 1013-15 M-1) (1). Streptavidin can be detected and quantitated with high sensitivity in such complexes by labeling it with enzymes, fluorescent, chemiluminescent, or radioactive agents, and metals. Labeled streptavidin has been used to detect proteins on a cell surface (2), to visualize and quantitate blots (3-7), and to perform an enzyme-linked immunosorbent assay ELISA (8-12). Streptavidin can also be readily immobilized at surfaces to capture biotinylated molecules or cells. These surfaces are used to detect and separate molecules or cells of interest from complex mixtures (13, 14). Isolation of polymerase chain reaction (PCR) products is simplified by employing streptavidin-immobilized magnetic microbeads (15-17). Streptavidin has also been investigated for targeted delivery of drugs or immunotoxins (18). These applications rely on the essentially irreversible binding of biotin and streptavidin. However, there are many cases in which dissociation of bound biotin is desired to recover biotinylated molecules or cells, or to release therapeutic reagents at targeted sites. Currently, harsh denaturing conditions are used to dissociate biotin from streptavidin (19). These denaturing conditions are undesirable especially to bioseparations. Thus, it is an important goal to effect the capture and release of biotinylated molecules and cells under mild conditions. We have developed a streptavidin-temperature sensitive * To whom correspondence should be addressed. † Box 352255. Phone: 206-543-9423. Fax: 206-543-6124. E-mail: [email protected]. ‡ Box 352125. Phone: 206-685-8148. Fax: 206-685-8256. E-mail: [email protected].

polymer conjugate in which the polymer is covalently and site specifically linked to the outer edge of the biotinbinding site (20). The biotin-binding sites of the conjugate can be blocked by a small change of temperature. The collapse of the polymer did not release bound biotin, however. Morag et al. (21) have derivatized the tyrosine residues within the binding sites of avidin or streptavidin with tetranitromethane. The nitro-avidin is able to bind biotin at low pH and release bound biotin at high pH. Our approach to developing a reversible biotin-binding system is to site specifically conjugate a stimuli-sensitive polymer to streptavidin. Control of biotin-binding is achieved by manipulating the conformation of the polymer, which can be specifically designed to respond sharply to changes in temperature, pH, and even light. For example, we have previously conjugated PNIPAAm to an N49C mutant of streptavidin to reversibly block biotin binding. PNIPAAm is a temperature-sensitive polymer that exhibits lower critical solution temperature (LCST) behavior, in which the polymer changes from a water-soluble coil to a water-insoluble collapsed (dehydrated) globule as temperature increases through the LCST. PNIPAAm and other stimuli-sensitive polymers have been used for enzyme recovery (22-24), affinity separation (25), immunoassay (26), and drug delivery (27, 28). In this paper, we present our investigation of a new streptavidin conjugation site, that was designed near an important binding site residue. By changing the location of the mutation site of streptavidin and the structure of the polymer, we are now able both to block biotin binding and to release the bound biotin by changing temperature. EXPERIMENTAL PROCEDURES

Materials. N-Isopropylacrylamide (NIPAAm, Eastman Kodak, Rochester, NY) was purified by recrystalli-

10.1021/bc980108s CCC: $18.00 © 1999 American Chemical Society Published on Web 04/22/1999

396 Bioconjugate Chem., Vol. 10, No. 3, 1999

Figure 1. Scheme of synthesis and derivatization of poly(NIPAAm-co-HEMA).

zation from n-hexane. Methanol was used to recrystallize 2,2′-azoisobutyronitrile (AIBN) (J. T. Baker, Phillipsburg, NJ). To purify 2-hydroxyethyl methylacrylate (Aldrich, Milwaukee, WI), distillation under reduced pressure was employed. Divinyl sulfone (DVS) and d-biotin were purchased from Aldrich (Milwaukee, WI) and used without treatment. d-[8,9-3H]Biotin is a product of Amersham Life Science (Buckinghamshire England). Trypsin, type III from bovine pancreas, was purchased from Sigma (Sigma, St. Louis, MO). Dehydrated dimethylformamide (Sigma, St. Louis, MO) was used without further treatment. Tris-(2-carboxyethyl) phosphine (HCl) (TCEP) (Pierce, Rockford, IL) was used as received. Tosylactivated magnetic microbeads (DYNABEADS M-280, Dynal, Inc. Lake Success, NY) (TMB) were used. All other reagents were of analytical grade. MscI and MluI restriction enzymes and T4 DNA Ligase were purchased from New England Biolabs (Beverly, MA). Qiaex II kit for extracting DNA was purchased from Qiagen (Santa Clarita, CA). pET21a vector was obtained from Novagen (Madison, WI). Preparation and Activation poly(NIPAAm). A copolymer of (NIPAAm-co-HEMA) was prepared by freeradical polymerization using AIBN as an initiator, as shown in Figure 1. NIPAAm (11.3 g), HEMA (0.503 mL), and AIBN (0.164 g) were added to 50 mL of dehydrated DMF. The solution was degassed by freezing, evacuating, and thawing three times and then sealed. Polymerization was carried out at 60 °C for 20 min. The conversion of monomers was controlled within 20% in order to obtain relatively homogeneous composition of copolymer. The copolymer was collected by precipitation in diethyl ether and dried in a vacuum oven. For further purification, the dried copolymer was redissolved in 40 mL of dichloromethane and precipitated in diethyl ether. The molecular weight of the copolymer was determined by vapor pressure osmometry (VPO, model OSV111 from Knauer, German). Proton NMR spectroscopy was performed with a Bruker 200 MHz instrument to evaluate the composition of the copolymer. 1H NMR (dimethyl sulfoxide-d6): 5.05 ppm (1H, -OH) and 7.25 ppm (1H, -NH). The hydroxyl groups of HEMA in the copolymer were further reacted with DVS in alkaline conditions, as shown in Figure 1. The copolymer and DVS were dissolved in dichloromethane. The solution was purged with nitrogen at room temperature for 30 min before addition of 0.03 g of potassium tert-butoxide. The reaction was carried out at room temperature for 16 h under protection of nitrogen. The derivatized copolymer was isolated by precipitation in diethyl ether. The derivatized copolymer was submitted to NMR analysis and Ellman’s reagent

Ding et al.

analysis (29, 30) for determination of VS content. 1H NMR (dimethyl sulfoxide-d6): 6.21 ppm (2H, dCH2), 6.97 ppm (1H, -SO2CH)), and 7.20 ppm (1H, -NH). In the Ellman’s assay, the polymer was reacted with excess of cystamine followed by titrating the remaining cystamine with Ellman’s reagent. Since the copolymer has pendant reactive groups, the VS groups, the copolymer is denoted as PNIPAAm-pP. Thermal responsiveness of PNIPAAmpP was determined spectroscopically using 0.23 wt % of copolymer solution. Genetic Engineering of Streptavidin. The streptavidin mutant E116C was constructed by site-directed, cassette mutagenesis, using a synthetic “core” streptavidin gene previously designed and constructed for protein expression in Escherichia coli (31). Oligonucleotides were designed to substitute glutamic acid at position 116 with cysteine. The following sense and anti-sense oligonucleotides were obtained from Integrated DNA Technologies (Coralville, IA) (the bold-face type indicates amino acid change): 5′CCAGTACGTTGGTGGTGCTGAAGCTCGTATCAACACCCAGTGGTTGTTGACCTCCGGCACCACCTGCGCTAA-3′ and 3′GGTCATGCAACCACCACGACTTCGAGCATAGTTGTGGGTCACCAACAACTGGAGGCCGTGGTGGACGCGATTGCGC-5′. The streptavidin gene in pUC18 was digested with MscI and MluI restriction enzymes, isolated on a 1.2% agarose gel, extracted, and purified using Qiaex II kit. The synthetic oligonucleotides, designed with MscI and MluI ends, were annealed then ligated into the pUC18/ StAv vector using T4 DNA Ligase. The DNA sequence of the mutant gene was confirmed using automated dyedeoxy sequencing (PE Applied Biosystems, Foster City, CA). The streptavidin mutant (StAv/E116C) gene was subsequently subcloned into pET21a for expression in E. coli strain BL21(DE3). The protein was expressed and refolded using established protocols. Analysis of the E116C streptavidin mutant included SDS-PAGE, mass spectrometry, and biotin-binding studies. Conjugation of Polymer to Protein. Conjugation between E116C and PNIPAAm-pP was carried out in 100 mM sodium tetraborate buffer, pH 8.5, containing 50 mM sodium chloride and 5 mM EDTA at 4 °C for 16 h. Cysteine residues of E116C form disulfide bonds during storage. To reduce disulfide bonds to sulfhydryl groups, TCEP at 50-fold molar excess to E116C was used. PNIPAAm-pP in 50-fold molar excess to E116C was used in order to obtain high conjugation efficiency. The conjugate, denoted as E116C-pP, was separated from unconjugated E116C by thermal-induced precipitation, i.e., centrifuging the mixture at 15 000 rpm (31000g) for 15 min at 37 °C. The unconjugated E116C was retained in the supernatant. The thermal-induced precipitation was repeated twice for further purification. Immobilization of Conjugates. Tosyl-activated magnetic beads were used to immobilize the conjugate, E116C, and trypsin-pP. E116C-pP conjugate dissolved in 100 mM sodium tetraborate buffer, pH 9.5 (concentration ) 100 µg/mL) was mixed with TMB in a ratio of E116CpP:TMB ) 100 µg:1 mg. The mixture was rotated headover-end at 37 °C for 16 h. The E116C-pP immobilized beads (E116C-pP-TMB) were washed with and redispersed in 100 mM sodium phosphate buffer, pH 7.4 (PB). The efficiency of immobilization was determined by mass balance determination of protein loss from solution, which was quantified by the absorbance at λ ) 280 nm. A trypsin-pP immobilized magnetic bead surface was used as a control. Biotin-Binding Assay. [3H]Biotin was employed to quantitate biotin binding. To eliminate unconjugated

Smart Polymer-Streptavidin

biotin-binding sites from interfering with biotin-binding assay, the E116C-pP-TMB was presaturated with cold biotin at 37 °C. To do so, 10-9-10-10 mol of E116C-pPTMB was incubated at 37 °C for 1 h followed by mixing with 10-fold excess unlabeled biotin at 37 °C. The mixture was incubated at 37 °C for 1 h to allow complete biotin binding to the unconjugated sites. Unbound biotin was removed by washing the beads with PB at 37 °C five times. [3H]Biotin was then added to the presaturated E116C-pP-TMB at 37 °C. One hour incubation was allowed to reach an equilibrium. An aliquot was taken from the supernatant to determine the [3H]biotin concentration in the supernatant using a β-counter (LS7000 Liquid scintillation system, Beckman Instruments, Inc. Fullerton, CA). The bead suspension was then incubated at 4 °C for 1 h to reach a biotin-binding equilibrium before the biotin concentration of the supernatant was measured. Temperature cycling continued three times. [3H]Biotin concentration of supernatant after incubation at each temperature was determined by a β-counter. Bound biotin was quantitated by the following formula:

QT ) Q0 - QS/N,T where QT is the bound biotin (mol) at temperature T (°C), Q0 is the total amount of [3H]biotin (mol) added to the E116C-pP-TMB suspension, and QS/N,T is the quantity of [3H]biotin (mol) remaining in the supernatant after incubation at temperature T (°C) The blocking or releasing efficiency was represented by following formula:

B (%) ) (Q4°C - Q37°C) × 100/Q4°C Measurement of Cumulative Release of Bound Biotin. Immobilized E116C or E116C-pP-TMB, which was presaturated with cold biotin at 37 °C, was mixed with [3H]biotin at 4 °C for 1 h to allow biotin binding. The mixtures were then incubated at 37 °C for 1 h. To collect the released biotin, the supernatant was removed from the mixture after incubation at 37 °C. The beads were washed with prewarmed (37 °C) PB and then redispersed in the same volume of PB for the next cycle. [3H]Biotin concentration in the supernatant was measured to quantify the cumulative release of [3H]biotin. RESULTS AND DISCUSSION

P(NIPAAm-co-HEMA) and PNIPAAm-pP were characterized by VPO, 1H NMR, and Ellman’s reagent. VPO analysis showed that the P(NIPAAm-co-HEMA) had a number average molecular weight (Mn) of 7500. 1H NMR analysis demonstrated that all of the hydroxyl groups in the copolymer were converted to vinyl sulfone groups in the derivatization step. Analysis using Ellman’s Reagent showed that the vinyl sulfone group content in the copolymer was 4.5 mol %, indicating that every copolymer chain had an average of three vinyl sulfone groups. Figure 2 shows the thermal-responsive properties of P(NIPAAm-co-HEMA) and PNIPAAm-pP. It is interesting that the LCST of P(NIPAAm-co-HEMA) (32.1 °C) is similar to that of a NIPAAm homopolymer (32-33 °C). Vinyl sulfone derivatization makes polymer more hydrophobic because the LCST of PNIPAAm-pP (27.5 °C) is lower than that of P(NIPAAm-co-HEMA). The LCST of PNIPAAm-pP in PB (20.2 °C) is much lower than that in water (27.5 °C). Hence, the salt has a strong effect on the thermal-responsiveness of PNIPAAm-pP. Studies have shown that the tryptophan-120 plays an important role in generating a large binding free energy

Bioconjugate Chem., Vol. 10, No. 3, 1999 397

Figure 2. The LCSTs of PNIPAAm-pP in sodium phosphate buffer (A), in deionized and distilled water (B), and that of poly(NIPAAm-co-HEMA) in deionized and distilled water (C). Polymer concentration was 0.20 wt %. The LCST is defined as the temperature at which the polymer solution is of 10% of maximum turbidity.

by forming van der Waals contact with biotin (31). Conformational change at this site may affect the binding properties significantly. Hence, we desinged a conjugation site near the tryptophan-120. Site-directed mutagenesis techniques were used to replace the native glutamate at position 116 with cysteine. As shown in Figure 3, this cysteine is near tryptophan-120, located on the same loop that contributes to the binding site from an adjacent subunit. Conjugation of the polymer to the E116C mutant was achieved by reacting the vinyl sulfone groups of the PNIPAAm-pP with the genetically engineered sulfhydryl groups (29), as shown in Figure 4. Since every monomer of E116C mutant has only one cysteine, the conjugation is site specific. To avoid possible reaction between the vinyl sulfone and primary amines of the protein, which becomes significant only at higher pH (32), we used pH 8.5 for the conjugation to minimize this side reaction. The conjugation reaction is quite efficient. A typical conjugate yield is 70%. The conjugate was subsequently immobilized on magnetic microbeads. A commonly used method to immobilize streptavidin on a surface is to use biotinylated solid substrates. However, such biotin-immobilized streptavidin may release from the surface due to the exchange of immobilized biotin with free biotin. Therefore, covalent linkage was used to immobilize streptavidin onto magnetic microbeads, as shown in Figure 4. The efficiency of immobilization, or the percentage of protein which is immobilized, ranged from 30 to 80%. To maximize the sensitivity of analysis of the temperature responsiveness of the conjugate, the E116C-pPTMB system was presaturated with biotin at 37 °C. Our studies have indicated that not all of the biotin-binding sites of an E116C molecule are conjugated with copolymer. The biotin-binding properties of the polymerconjugated sites should show temperature dependence while the unconjugated sites should not show a significant effect of temperature on binding or release of biotin. Presaturating the unconjugated sites with unlabeled biotin reduces the signal from unconjugated binding sites. Figure 5 shows the changes in the biotin-binding capacity of the E116C-pP-TMB as a function of temperature. The first temperature cycle shows that the polymer at position 116 can block the association of biotin at 37 °C while leaving the binding site open to biotin at 4 °C. In the second cycle, when the temperature was increased from 4 to 37 °C, where the polymer collapsed, a significant fraction of the bound biotin was released. When the temperature was decreased from 37 to 4 °C, the unoccupied polymer-conjugated sites were able to rebind biotin. Therefore, biotin can be bound to and released

398 Bioconjugate Chem., Vol. 10, No. 3, 1999

Ding et al.

Figure 3. Computer model of the E116C mutant binding site.

from the conjugate by changing the temperature from below to above the polymer’s LCST. The biotin-binding properties of the unconjugated E116C streptavidin are shown in Figure 6 which demonstrates that the immobilized E116C mutant does not display a significant temperature-dependent change of % biotin bound over one cycle. Furthermore, Figure 7 shows that neither a control trypsin-PNIPAAm immobilized conjugate nor the unreacted magnetic bead surface adsorbs or traps biotin at 37 or 4 °C. These controls support the conclusion that the temperature responsiveness of biotin binding shown in Figure 5 is due to the unique site-specific conjugation of E116C with the thermally sensitive PNIPAAm. To further investigate the release of bound biotin from polymer-conjugated sites, we have conducted cumulative release experiments. Figure 8 shows that all of the bound biotin to the polymer-conjugated sites is released after four washing cycles. It is also shown that repeatedly changing the temperature is necessary to release all of the bound biotin. It should be noted that the complete release of bound biotin is not a consequence of protein denaturation because the conjugate is able to bind biotin after the washes. Figure 8 also shows that about 17% of bound biotin is released from immobilized E116C streptavidin with four washes. Streptavidin has an off-rate of 3.24 × 10-5 (s-1) at 37 °C and 1.03 × 10-7 (s-1) at 4 °C

(33). It has also been shown that biotin-binding activity decreases when streptavidin is immobilized on a solid surface (34). In the cumulative release experiments, the biotin concentration of supernatant was very low because the supernatant was replaced with fresh buffer in every cycles. All these facts may contribute to the release of small amounts of bound biotin from the E116C. However, the biotin release from E116C is significantly less than that from the conjugate. While the precise mechanism by which polymer collapse causes release of biotin cannot be determined experimentally, it is likely that the polymer conformational change alters the conformation of the tryptophan 120 loop. The radius of the PNIPAAm molecules reduces to half of its original radius upon collapse (35, 36). This conformational change is transmitted to the biotinbinding site, as demonstrated by the change in biotin affinity that leads to biotin release. Because one PNIPAAm-pP chain contains three vinyl sulfone groups on average, it is possible that one copolymer chain is conjugated to more than one site on the protein. We observed such multiple-point conjugation, as indicated by formation of insoluble gel when conjugation was performed at high concentrations of protein and the polymer. The multiple-point conjugation may transmit the conformational change from the polymer to the protein more efficiently.

Smart Polymer-Streptavidin

Bioconjugate Chem., Vol. 10, No. 3, 1999 399

Figure 7. Nonspecific adsorption of biotin to various surfaces. The data presented are an average of triplicate determinations. Magnetic beads (Dynal M-280) immobilized with 1.0 × 10-9 mol of trypsin-pP were used for the assay. Sodium phosphate buffer, pH 7.4, 100 mM was used as the medium.

Figure 4. Conjugation of E116C with PNIPAAm-pP and immobilization of E116C-pP conjugate.

Figure 8. Cumulative release of bound biotin from immobilized E116C and E116C-pP. The data presented are an average of duplicate experiments. Magnetic beads (Dynal M-280) immobilized with 5.4 × 10-10 mol of E116C-pP were used for the assay. Sodium phosphate buffer, pH 7.4, 100 mM was used as the medium.

Figure 5. Temperature effect on biotin binding to immobilized E116C-pP conjugate. The data presented are an average of triplicate determinations. The amount of bound biotin at the first 37 °C is zero. Magnetic beads (Dynal M-280) immobilized with 5.4 × 10-10 mol of E116C-pP were used for the assay. Sodium phosphate buffer, pH 7.4, 100 mM was used as the medium.

combination of specific conjugation sites on a genetically engineered protein and a stimuli-responsive copolymer. The conjugate binds biotin at 4 °C where the polymer is hydrated and releases a significant fraction of bound biotin at 37 °C where the polymer is collapsed. By combining temperature cycling between 4 and 37 °C with washing at 37 °C, all of the bound biotin can be released. The conjugate is immobilized on magnetic microbeads and can be used to capture and to recover biotin. This system is potentially useful for separation and recovery of biotinylated substances without the need for harsh elution conditions. ACKNOWLEDGMENT

We would like to thank Prof. J. Milton Harris for his advise on derivatization of polymer hydroxyl to vinyl sulfone groups. The NIH (Grant No. R01GM53771), UW Office of Technology Transfer, the Washington Research Foundation and the Washington Technology Center are gratefully acknowledged for their support of this project. Figure 6. Temperature effect on biotin binding to immobilized E116C. The data presented are an average of triplicate determinations. Magnetic beads (Dynal M-280) immobilized with 5.4 × 10-10 mol of E116C were used for the assay. Sodium phosphate buffer, pH 7.4, 100 mM was used as the medium. CONCLUSIONS

We have prepared a new site-specific conjugate of streptavidin with a temperature-sensitive polymer. When this conjugate is thermally stimulated, it is able to reversibly bind and release biotin because of the unique

LITERATURE CITED (1) Weber, P. C., Ohlendore, D. H., Wendoloski, J. J., and Salemme, F. R. (1989) Structural origins of high-affinity biotin binding to streptavidin. Science 243, 85-8. (2) Gallivan, J. P., Lester, H. A., and Dougherty, D. A. (1997) Site-specific incorporation of biotinylated amino acids to identify surface-exposed residues in integral membrane proteins. Chemistry Biol. 4, 739-49. (3) Peranen, J. (1992) Rapid affinity-purification and biotinylation of antibodies. Biotechniques 13, 546-9.

400 Bioconjugate Chem., Vol. 10, No. 3, 1999 (4) King, G., Payne, S., Walker, F., and Murray, G. I. (1997) A highly sensitive detection method for immunohistochemistry using biotinylated tyramine. J. Pathol. 183, 237-41. (5) Narendja, F. M., and Sauermann, G. (1994) The use of biotinylated poly(ADP-ribose) for studies on poly(ADP-ribose)protein interaction. Anal. Biochem. 220, 415-9. (6) Stevenson, B. R., Richards, C. L., Howarth, A. G., Maraj, V. A., and Hibbard, J. G. (1994) Quantitative immunoblot detection of rare proteins in whole cell extracts using biotinstrepavidin reagents. J. Exp. Zool. 268, 224-8. (7) Hoeltke, H. J., Ettl, I., Strobel, E., Leying, H., Zimmermann, M., and Zimmermann, R. (1995) Biotin in vitro translation, nonradioactive detection of cell-free synthesized proteins. Biotechniques 18, 900-4, 906-7. (8) Stephens, R. W., Pedersen, A. N., Nielsen, H. J., Hamers, M. J. A. G., Hoyer, H. G., Ronne, E., Dybkjaer, E., Dano, K., and Bruenner, N. (1997) ELISA determination of soluble urokinase receptor in blood from healthy donors and cancer patients. Clin. Chem. 43, 1868-76. (9) Gutierrez, R., Garcia, T., Gonzalez, I., Sanz, B., Hernandez, P. E., and Martin, R. (1997) A quantitative PCR-ELISA for the rapid enumeration of bacteria in refrigerated raw milk. J. Appl. Microbiol. 83, 518-23. (10) Muller, R. (1997) Timed ELISA: An alternative approach to quantitative enzyme-linked immunosorbent assay. Biotechnol. Appl. Biochem. 26, 73-78. (11) Schlosser, M., Hahmann, J., Ziegler, B., Augstein, P., and Ziegler, M. (1997) Sensitive monoclonal antibody-based sandwich ELISA for determination of the diabetes-associated autoantigen glutamic acid decarboxylase GAD65. J. Immunoassay 18, 289-307. (12) Shankar, G., and Cohen, D. A. (1997) Enhanced cytokine detection by a novel cell culture-based ELISA. J. Immunoassay 18, 371-88. (13) Kossek, S., Padeste, C., and Tiefenauer, L. (1996) Immobilization of streptavidin for immunosensors on nanostructured surfaces. J. Mol. Recognit. 9, 485-7. (14) Kim, D. R., and McHenry, C. S. (1996) Biotin tagging deletion analysis of domain limits involved in proteinmacromolecular interactions. Mapping the tau binding domain of the DNA polymerase III alpha subunit. J. Biol. Chem. 271, 20690-8. (15) Refseth, U. H., Fangan, B. M., and Jakobsen, K. S. (1997) Hybridization capture of microsatellites directly from genomic DNA. Electrophoresis 18, 1519-23. (16) Rolfs, A., and Weber, I. (1994) Fully automated, nonradioactive solid-phase sequencing of genomic DNA obtained from PCR. Biotechniques 17, 782-4. (17) Pettersson, B., Johansson, K. E., and Uhlen, M. (1994) Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing. Appl. Environ. Microbiol. 60, 2456-61. (18) Muzykantov, V. R., Gavriluk, V. D., Reinecke, A., Atochina, E. N., Kuo, A., Barnathan, E. S., and Fisher, A. B. (1995) The functional effects of biotinylation of anti-angiotensinconverting enzyme monoclonal antibody in terms of targeting in vivo. Anal. Biochem. 226, 279-87. (19) Weidner, J., Eigel, A., Horst, J., and Koehnlein, W. (1994) Nonisotopic detection of mutations using a modified singlestrand conformation polymorphism analysis. Human Mutat. 4, 55-6. (20) Stayton, P. S., Shimoboji, T., Long, C., Chilkoti, A., Chen, G., Harris, J. M., and Hoffman, A. S. (1995) Control of

Ding et al. protein-ligand recognition using a stimuli-responsive polymer. Nature 378, 472-4. (21) Morag, E., Bayer, E. A., and Wilchek, M. (1996) Reversibility of biotin-binding by selective modification of tyrosine in avidin. Biochem. J. 316, 193-9. (22) Ding, Z. L., Chen, G. H., and Hoffman, A. S. (1996) Synthesis and purification of thermally sensitive oligomerenzyme conjugates of poly(N-isopropylacrylamide)-trypsin. Bioconjugate Chem. 7, 121-5. (23) Ding, Z. L., Chen, G., and Hoffman, A. S. (1998) Unusual properties of thermally sensitive oligomer-enzyme conjugates of poly(N-isopropylacrylamide)-trypsin. J. Biomed. Mater. Res. 39, 498-505. (24) Takei, Y. G., Matsukata, M., Aoki, T., Sanui, K., Ogata, N., Kikuchi, A., Sakurai, Y., and Okano, T. (1994) Temperature-responsive bioconjugates. 3. Antibody-poly (N-isopropylacrylamide) conjugates for temperature-modulated precipitations and affinity bioseparations. Bioconjugate Chem. 5, 577-82. (25) Chen, J. P., and Hoffman, A. S. (1990) Polymer-protein conjugates. II. Affinity precipitation of human IgG by poly(N-isopropylacrylamide)-protein A conjugates. Biomaterials 11, 631-4. (26) Monji, N., and Hoffman, A. S. (1987) A novel immunoassay system and bioseparation process based on thermal phase separating polymers. Appl. Biochem. Biotechnol 14, 107-20. (27) Hoffman, A. S., Afrassiabi, A., and Dong, L. C. (1986) Thermally reversible hydrogels: II. Delivery and selective removal of substances in aqueous solutions. J. Controlled Rel. 4, 213-22. (28) Yoshida, R., Kaneko, Y., Sakai, K., Okano, T., Sakurai, Y., Bae, Y. H., and Kim, S. W. (1994) Positive thermosensitive pulsatile drug release using negative thermosensitive hydrogels. J. Controlled Rel. 32, 97-102. (29) Morpurgo, M., Veronese, F. M., Kachensky, D., and Harris, J. M. (1996) Preparation and characterization of poly(ethylene glycol) vinyl sulfone. Bioconjugate Chem. 7, 363-8. (30) Riddles, P. W., Blakeley, R. L., and Zerner, B. (1983) Reassessment of Ellman’s reagent. Methods Enzymol. 91, 4960. (31) Chilkoti, A., Tan, P. H., and Stayton, P. S. (1995) Sitedirected mutagenesis studies of the high-affinity streptavidin-biotin complex: contributions of tryptophan residues 79, 108, and 120. Proc.Natl. Acad. Sci. U.S.A. 92, 1754-8. (32) Magnani, M., Chiarantini, L., and Mancini, U. (1994) Preparation and characterization of biotinylated red blood cells. Biotechnol. Appl. Biochem. 20, 335-45. (33) Unpublished data. (34) Huang, S. C., Stump, M. D., Weiss, R., and Caldwell, K. D. (1996) Binding of biotinylated DNA to streptavidin-coated polystyrene latex: effects of chain length and particle size. Anal. Biochem. 237, 115-22. (35) Wu, C., and Zhou, S. (1995) Thermodynamically stable globule state of a single poly(N-isopropylacrylamide) chain in water. Macromolecules 28, 5388-90. (36) Tiktopulo, E. I., Uversky, V. N., Lushchik, V. B., Klenin, S. I., Bychkova, V. E., and Ptitsyn, O. B. (1995) “Domain” coil-globule transition in homopolymers. Macromolecules 28, 7519-24.

BC980108S