Testing the N-Terminal Velcro Model of CooA Carbon Monoxide

Subscriber access provided by Kaohsiung Medical University

Article

Testing the N-terminal Velcro Model of CooA Carbon Monoxide Activation Sarvind Tripathi, and Thomas L. Poulos Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.8b00359 • Publication Date (Web): 30 Apr 2018 Downloaded from http://pubs.acs.org on May 2, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Testing the N-terminal Velcro Model of CooA Carbon Monoxide Activation Sarvind Tripathi1,2 and Thomas L. Poulos1* 1

Departments of Molecular Biology and Biochemistry, Pharmaceutical Sciences, and Chemistry, University of California, Irvine, Irvine, California, 92697-3900

*E-mail: [email protected]. Phone: (949) 824-7020 2

Present address Department of Chemistry and Biochemistry, University of California, Santa

Cruz, Santa Cruz, California, 95064. This work was supported by NIH grant GM57353 (TLP). Coordinates and structure factors have been deposited in the Protein Data Base under accession number 6CPB.

1

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract CooAs are dimeric bacterial CO sensing transcription factors that activate a series of enzymes responsible for CO oxidation. The crystal structure of Rhodspirillum rubrum (rrCooA) shows that the N-terminal Pro from monomer A of the dimer coordinates the heme of monomer B which locks rrCooA in the “off” state. Upon CO binding, it is postulated that the Pro is replaced by CO resulting in a very large reorientation of the DNA binding domains required for specific binding to DNA. Crystal structures of the closely related CooA from Carboxydothermus hydrogenoformans (chCooA) are available and in one of these the CO-bound on-state indicates that the N-terminal region that is displaced when CO binds provides contacts between the heme and DNA binding domains that holds the DNA binding domain in position for DNA binding. This has been termed the N-terminal velcro model of CooA activation. The present study tests this hypothesis by generating a disulfide mutant that covalently locks chCooA in the on-state. A simple fluorescence assay was used to measure DNA binding and the S-S mutant was found to be in the on-state even without CO. We also determined the high resolution crystal structure of the apo-heme domain and the resulting structure is very similar to the holo-heme bound structure. This result shows that the heme binding motif forms a stable structure without heme or the DNA binding domain.

2


Page 2 of 18

Page 3 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Introduction The CooA family of proteins are prokaryotic CO-sensing transcription factors that regulate the expression of genes involved in the utilization of CO as an energy source.1 These are homodimeric proteins that contain two hemes. Each monomer has a N-terminal heme-binding domain and a C-terminal DNA-binding domain. The binding of CO to the heme iron switches CooA to a state that binds to 5' promoter sequences resulting in the transcription2 of genes that enable CO to be utilized as an energy source.3,4 The overall architecture of CooA closely resembles the Catabolite Activator Protein (CAP) family of transcription factors that are regulated by cyclic AMP. The available crystal structures of CAP5-7 are in the so-called on-state with the DNA domain in position to bind DNA. The crystal structure of Rhodospirillum rubrum (rrCooA)8 was the first structure of a CAP-like transcription factor in the inactive off-state. A comparison of this off-state structure with the on-states of CAP shows that the DNA binding domain can undergo a very large reorientation between the on- and off-states. The off-state CooA crystal structure shows that the N-terminal Pro residue of monomer A coordinates the heme of monomer B and vice versa (Fig. 1). In the presence of CO the N-terminal Pro ligand is replaced by CO resulting in a switch to the on-state. Crystal structures of a second CooA, Carboxydothermus hydrogenoformans CooA or chCooA are available9,10, and one of these is in CO-bound on-state. In this case the N-terminal region is situated between the DNA and heme domains providing a series of non-bonded bridges between the two domains that has been postulated to hold the DNA domain in the active orientation. We have termed this the N-terminal velcro model of CooA activation (Fig. 1). Figure 1 The proposed on- and off-state structures of CooA. The model shown is a hybrid of the rrCooA off-state and chCooA on-state structures. In the offstate the N-terminus of one molecule in the dimer (large dark blue and green spheres) coordinates the heme of the second molecule of the dimer. In the on-state the N-terminal segment of molecule A serves as bridge between the heme and DNA binding domains that holds the DNA binding helices in an

3


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 18

orientation suitable for DNA interactions.

Here we provide experiments designed to test this model. Based on the chCooA crystal structures, a mutant has been designed that should form an intramolecular S-S bond between the DNA and heme domains thus locking chCooA in the on-state. In addition, a novel fluorescence assay has been developed that provides a simple and rapid method for differentiating between the on- and off-state conformations.

Materials and Methods FPLC purified oligonucleotides were obtained from IDT. Restriction enzymes, T4 DNA ligase and polymerase were purchased from New England Bio-labs (Beverly, MA, USA). Site-directed mutagenesis kits were purchased from Agilent Technologies. Ni-NTA agarose superflow resin and miniprep plasmid purification kit was from Qiagen (Chatsworth, CA, U.S.A.). Dithiothreitol (DTT), 5,-dithiobis-(2-nitrobenzoic acid) (DTNB), I=imidazole, hemin and all other chemicals were purchased from Sigma-Aldrich and were of the highest quality. A Cary spectrophotometer (Agilent Technologies) was used for spectroscopic studies. Hitachi F4500 fluorescence spectrophotometer used for fluorescence studies.

Site directed mutagenesis for Q4C and M177C Based on crystal structure (PDB code, 2HKX)10 we designed mutation to lock chCooA in on state. Amino acids Gln4 and Met77 were mutated to Cys by using standard site directed mutagenesis and polymerase chain reaction. The Q4C/M77C double mutant is designated DMchCooA.

Expression and purification of chCOOA WT, (L127N/L128S) and (Q4C/M177C) mutants Wild type chCooA, double leucine mutants (N127L/S128L abbreviated as LLchCooA), and cysteine mutants proteins were purified by same procedure reported before by Clark et al.,

11

with a few modification. Briefly, protein was over-expressed in E. coli BL21(DE3) cells by inducing with 1mM IPTG at 0.6 OD and grown it further for 24 hrs at 250C. 0.4µm δaminolevulinic acid was also added during induction for better heme incorporation. The IPTGinduced cells were harvested, re-suspended in 50 mM Tris–HCl pH 7.8, 500 mM NaCl and 10 4


Page 5 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

mM histidine (buffer A) and lysed by sonication. The crude lysate was centrifuged at 17,000 rpm for 60 min. The supernatant was applied to a Ni2+-NTA column pre-equilibrated with buffer A. Protein was eluted using the same buffer supplemented with 80 mM histidine. Fractions containing protein were pooled and concentrated by using a 10 kDa centricon. Concentrated protein was further purified and buffer exchanged by gel filtration using Superdex 75 16/60 column equilibrated with 50mM Tris (7.8) and 500 mM NaCl (buffer B). Protein fractions with higher heme content (R/Z) were pooled and concentrated by using a 10 kDa cutoff centricon (Amicon). Protein concentrations were determined by using extinction coefficient reported previously. 12 The purity of the protein was confirmed using 12% SDS–PAGE.

Preparation of Fe(II) and Fe(II)-CO samples were prepared anaerobically. The protein stocks were reduced with 50mM dithionite in nitrogen filled anaerobic chamber and extra dithionite was removed by desalting column. For Fe(II)-CO, the Fe(II) CooA is exposed to CO in anaerobic cuvette with 1cm path length.

Non-reducing PAGE and determination of free thiol groups by Ellman’s reagents Disulfide bond formation in the double cysteine mutant was visualized by using non-reducing SDS-PAGE. Non-reducing gel electrophoresis was conducted using 12% polyacrylamide gels made and samples loaded by mixing with dye without any reducing agent. Ellman’s reagent13 was used to quantitate free thiols. Five hundred µM Ellman’s reagent (5,5-dithiobis(2nitrobenzoic acid) was incubated with 5µM of WTchCooA or double cysteine mutants in 100mM Tris (7.8), 300mM NaCl and 6M guanidinium chloride for 15 min at RT. The absorbance is recorded by using a Cary 3E spectrophotometer at 412nM and concentration of free thiol is calculated by standard curve using cysteine. To calculate free thiol in proteins reduced by DTT we used desalting column (BioRad) to remove excess DTT under anaerobic condition before recording spectra.

Fluorescence spectrophotometer studies for DNA binding All fluorescence studies utilizing tyrosine emission were performed by using synthetic oligonucleotide reported previously.14 The sequence of half sites contains nucleotide derived

5


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

from binding sites of one monomer of chCooA. Equi-molar concentrations of the two strands were mixed to a final concentration of 1µM in 50mM Tris (7.8) and 100mM NaCl. The strands were annealed by placing solution at 90 0C and controlled cooling to 40C at speed to 10C/min. ssDNA 1

5’ GCGAAAAGTGTCAC

ssDNA 2

5’ ATATGTGACACTTTTCG

dsDNA Full site GCGAAAAGTGTCAC ATATGTGACACTTTTCG GCTTTTCACAGTGTATACACTGTGAAAAGCG chCooA binds to DNA when the heme iron is reduced and bound to CO. To do qualitative analysis of DNA binding we used fluorescence spectroscopy to demonstrate DNA binding to different states of native and DMchCooA at 250C on a Hitachi F4500 fluorescence spectrophotometer. chCooA does not have any tryptophan residue but does contain 7 tyrosine residues which were used to monitor DNA binding. Proteins, oligonucleotide and buffer were degassed and purged with argon obtaining the fluorescence data. Three µM protein was excited at 272nm and emission spectra were recorded between 300 to 350nm to monitor changes in fluorescence upon DNA binding in 50Mm Tris pH 7.8, 300mM NaCl and 5mM EDTA. Corrections were made by subtracting the spectrum of the appropriate buffer. pUC 19 plasmid is used as control.

Cloning and purification of heme domain Heme domain (1-137) of chCooA was PCR amplified from a plasmid containing LL-chCOOA and cloned between NcoI and XhoI with a C-terminal His tag in pET28a. Since heme binding to the heme domain is very low compared to full length protein, 0.4mm δ-aminolevulinic acid was also aed during induction for better heme incorporation. Purification of heme domain was done by the same method used for purification of wild type and mutant full length protein except low salt concentration (100mM) is used at final step of purification.

Heme-binding Heme binding was monitored by difference spectroscopy in the Soret region of the UV−Visible spectrum at 25 °C. Successive aliquots of freshly prepared 1 mM hemin in 0.1N NaOH were

6


Page 6 of 18

Page 7 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

added to 7.5 µM heme domain and the reference cuvette. Difference spectra were recorded 5 min after the addition of each heme aliquot.

Crystallization, data collection and structure solution of heme domain Heme domain was crystallized by the hanging drop method and the plates were incubated at 22°C. Apo-heme domain crystals were obtained by mixing 2 µL of 400uM protein and 1 µL of reservoir solution containing ammonium sulfate ranging from 1.6 to 2.0M and 100mM Tris (8.5). Thirty % glycerol was used as a cryo-protectant and a set of data collected from single crystal at SSRL beamline 7-1. The Diffraction images were indexed integrated and scaled using the Mosflm15 and Aimless.16 The heme domain (2-143) of rrCooA17 used as a search model to solve the structure by molecular replacement calculations using the program Phaser18 implemented in CCP4 package.19 The transformed model was subjected to refinement using Phenix.20 Phases were improved and extended incrementally to 1.16 Å. 2Fo − Fc and Fo − Fc electron density maps were visualized and model building carried out using the program COOT.21 The crystallographic R-factor and Rfree were monitored at each stage to avoid any bias. Water molecules were added by the automatic water-picking algorithm of COOT and inspected manually. The refined structure of heme domain contains two chains and 124 water molecules. Final refinement statistics are given in Table 1.

7


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table 1. Crystallographic data collection and refinement Data collection Space group Unit cell dimensions (a,b,c) (Å), (α, β, γ (º) Resolution Range (Å) (highest shell) Wavelength (Å) Total observations Unique reflections Rmerge CC(1/2) Redundancy Completeness (%)

P212121 64.66, 65.82, 72.88 (90, 90. 90) 72.88-1.15 (1.17-1.15) 1.127 747009 (32152) 109455 (5388) 5.0 (50.6) 14 (2.7) 0.99(0.89) 6.8(6.0) 100 (99.2)

Refinement Rwork %/ Rfree % Number of non H-atoms Protein Ligand/ion Water B-factor (Wilson) Macromolecules solvents

13.0/14.9 2634 2300 33 301 20 17.6 33.5 Ch. A; 1-6 Unmodeled residues Ch. B; 1-7 RMSD Bond length (Å) 0.007 RMSD Bond angle 0.93 Ramachandra allowed/outliers (%) 100/0.0 Rmerge = ∑hkl∑i‫׀‬Ihkl-〈Ihkl〉‫׀‬/∑hkl∑i(Ihkl), where Ihkl is the intensity of an individual reflection and 〈Ihkl〉is the average intensity over symmetry equivalents. Rwork = ||Fobs (h)|-|Fcalc (h)|| / h|Fobs (h)|, where Fobs (h) and Fcalc (h) are the observed and calculated structure factors, respectively. Rfree is the R value obtained for a test set of reflections consisting of a randomly selected 5% subset of the data set excluded from refinement.

Results and Discussion Purification and Characterization The double Cys mutant, DMchCooA, was over-expressed as a heme-protein in the cytosolic fraction like wild type and LLChCooA. Purified protein migrated as a single band of 26 kDa on SDS-PAGE. Since imidazole act as a proximal ligand to heme we used histidine to elute proteins

8


Page 8 of 18

Page 9 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

from the Ni-NTA column. The electronic absorption spectra of chCooA shows soret, α and β band at 421, 565 and 538nm.

Figure 2 A comparison of one monomer of off-state rrCooA and on-state chCooA. The N-terminal peptide of chCooA is situated between the DNA binding and heme domains. The Leu127 mutant side chain in the heme domain forms nonpolar interactions with Leu7 and Ala2. We hypothesize that these favorable interactions is one reason the N127L/S128L double mutant is locked in the on-state even in the absence of CO.

Mutant Design The structure of chCooA we reported 10 was that of a mutant called LLchCooA. Using an in vivo selection process it was found that the conversion of Asn127 and Ser128 to Leu to give LLchCooA is able to enhance transcription in the absence of CO and hence must be locked in the on-state. As shown in Fig. 2, Leu127 on the F helix forms non-bonded contacts with Ala2 and Leu7. Comparing the rrCooA off-state and LLchCooA on-state structures shows that the DNA domain can reorient up to 180o (Fig. 1). As shown in Fig. 2 the DNA-binding helix is oriented "down" in the on-state and thus is available for DNA binding but in the off-state this helix is oriented "up". We have postulated that the reason the LLchCooA mutant adopts primarily the onstate conformation is that the mutant Leu127 side chain is exposed to solvent in the off-state but buried in the on-state where it can form favorable non-bonded contacts with Leu7 and Ala2. The N-terminal segment thus provides a series of non-bonded contacts between the DNA and heme domains that effectively holds the DNA domain in position for proper DNA binding. By displacing the N-terminal heme ligand, CO frees the N-terminal segment to form the link holding the DNA domain in the active orientation. The LLchCooA mutant shifts the equilibrium to the on-state even in the absence of CO owing to the favorable burial of the mutant Leu127 side chain at the DNA-heme domain interface. To further test this view of CooA activation we designed a mutant that will form an S-S bond between the heme and DNA domains thus permanently locking chCooA in the on-state. Visual inspection of the LLchCooA structures indicates that

9


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

mutating Met177 in the DNA domain and Gln4 in the heme domain should form an S-S bond when protein is in on-state.

Disulfide Bond Formation To examine disulfide bond formation in the double mutant (DMchCooA), the purified protein was run on an SDS gel + reducing agent (Fig. 3). An intramolcular S-S bond generates a more compact structure which can potentially migrate toward lower molecular weights in SDS gels. WTchCooA runs as a single band +reducing agent while DMchCooA protein produces two bands under oxidizing conditions but only one band under reducing conditions. Treatment of DMchCooA with diamide, an oxidizing agent used to induce disulfide bond formation, increased the amount of the faster migrating band. These results indicate the band migrating toward lower molecular weight forms the intramolecular S-S bond formation.

Figure 3 SDS-PAGE of purified DMchCooA and WTchCooA. The purified protein is treated with or without reducing agent in SDS loading dye, and run on 12% SDS-PAGE. Lane M, molecular mass markers; lane1, DMchCooA with reducing agent; lane 2, DMchCooA without reducing agent; lane 3, chCooA with reducing agent; lane 4, chCooA without reducing agent

The total number of free thiol groups in chCooA estimated from DTNB analysis under various treatments are listed in Table 2. These results show that there was only one free thiol group per subunit of purified WTchCooA while for DMchCooA it is greater than one. On the other hand, treatment of chCooA and DMchCooA with DTT along with 6M guanidium chloride the total thiol count is near 3. Taken together, the SDS gels and thiol titration analysis indicates that a large fraction of DMchCooA forms an intramolecular S-S bond.

10


Page 10 of 18

Page 11 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 2. DTNB titration of ChCooA. Free thiol groups (RSH)/ChCooA monomer (µmol of RSH/µmol of subunit) Treatment

LL-ChCooA DM-LLChCooA

6M GdmCl

0.7±0.15

1.5±0.2

6M GdmCl + DTT 0.9±0.12

2.8±0.1

Figure 4 Fluorescence emission spectra of WTchCooA and DMchCooA with DNA under anaerobic condition. A) Double mutant with S-S bond; B) Wild type chCooA; C) DNA binding titration of 3 µM reduced DMchCooA in the absence of CO.

DNA binding to chCooA In seeking out a relatively simple method for estimating DNA binding, we found that DNA induces a large quenching of fluorescence of chCooA only when chCooA is in the CO complex. Since there is no tryptophan present in chCooA we used 278 nm to excite tyrosine and recorded emission spectra over a range from 290-340nm. As shown in Fig. 4, WTchCooA binds to DNA only when the heme is reduced and bound to CO while Fe(II) DMchCooA in the absence of CO showed DNA binding.

Purification and spectrophotometric titration of heme domain Purified heme domain behaves like wild type protein and Fe(II), formed by reducing the Fe(III) form with sodium dithionite, showed the Soret, α and β band at 424, 559 and 529nm. Treatement of the reduced Fe(II) heme domain with CO exhibited the spectral properties with Soret, α and β

11


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

band at 421, 569 and 538nm.. Compared to WT-chCooA, when we purified the heme domain from E.coli it elutes with a very small amount of heme bound. We determined the stoichiometry of heme binding to heme domain to determine if the DNA binding domain plays role in heme binding. Spectrophotometric titration of heme domain of LL-chCooA with a solution of hemin showed saturation at a 2 heme bound per dimer (Fig 5).

Figure 5 Apo-heme domain (3.5 µM) titrated with increasing concentrations of heme. A) Spectral changes with increasing heme concentration and B) fractional OD change as a function of heme concentration. Saturation is achieved at 1:1 ratio of heme to monomer (2 hemes per dimer).

Heme domain structure We attempted to solve the of chCooA heme domain dimer in order to determine if the N-terminal of molecule A coordinates the heme in molecule B, which is the case in rrCooA. Unfortunately we were able to crystallize only the heme domain in the apo-form without heme although the heme domain contained a full complement of heme prior to setting up the crystallization drops. Even so this ultra high resolution structure enables us to determine the influence of heme binding on the heme domain structure. A superposition of the heme domain monomer on the holochCooA monomer gives a rmsd on Cα atoms of 1.6Å and most of the deviation is due to differences in surface loop regions. Thus we can conclude that heme binding or the presence of the DNA binding domain has little influence on the structure of the heme domain. The one significant change relevant to heme binding is the position of the heme ligand, His82, in apochCooA. In one subunit of the dimer, His82 orients out toward solvent away from the heme binding pocket. However, in the other monomer His82 is oriented in and is in position to coordinate heme. Interestingly, the holo-chCooA structure has only one heme bound10 and in the monomer missing heme, His82 also is oriented out toward solvent.

12


Page 12 of 18

Page 13 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6 Comparison of holo- and apo-chCooA heme domains. The overall dimeric structures are very similar which shows that the heme domain folds independent of the heme cofactor or DNA binding domains. The one significant change in the active site is His82 which points out away from the heme pocket in one monomer of apochCooA.

Conclusions The available CooA structures and the various structures of CAP provide a reasonably clear picture on the large motions involved in transcription factor activation. The DNA binding domains can reorient by 180o in order to place the DNA binding helices in the proper position for specific DNA interactions. The two domains are structurally independent given that the isolated heme domain crystal structures with or without heme are the same as in holo-CooA. CooA has provided some advantages over CAP in that a clearer picture has emerged on how the effector, in this case CO, triggers the required structural changes. The N-terminus of molecule A coordinates heme B and vise versa thus locking the dimer in the off-state. The displacement of the Nterminus by CO frees the N-terminal peptide to provide a bridge between the heme and DNA binding domains. Hence, the N-terminal peptide serves as the “velcro” to hold the DNA domain in the orientation required for DNA binding. These changes also alter the heme binding pocket to

13


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

favor CO binding over other diatomic ligands, most notably O2. Oxygen binding to ferrous heme proteins is generally considered to favor ferric-superoxide, Fe(III)-OO-, so H-bonding partners will help to stabilize the oxy complex. In CooA the bound CO is surrounded by a Val and symmetry related Leu residues along the dimer interface thus creating a nonpolar pocket with no potential H-bonding partners.10 This pocket is quite tight and favors a linear Fe-C-O angle rather than a bent angle preferred by O2. The hydrophobic nature of the CO binding pocket and displacement of the Pro ligand are consistent with resonance Raman coupled with mutagenesis studies.22,23 CooA thus provides a fascinating example of how diatomic sensing is coupled to large structural rearrangements of protein domains in addition to providing an example of how heme proteins can control ligand selectivity.

Acknowledgments This paper involves research carried out at the Stanford Synchrotron Radiation Laboratory, a national user facility operated by Stanford University on behalf of the U.S. Department of Energy, Office of Basic Energy Sciences. The SSRL Structural Molecular Biology Program is supported by the Department of Energy, Office of Biological and Environmental Research, and by the National Institutes of Health, National Center for Research Resources, Biomedical Technology Program, and the National Institute of General Medical Sciences. We also wish to thank Prof. Gary Roberts for previous collaborations on CooA and the generous sharing of ideas and materials.

14


Page 14 of 18

Page 15 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

References

(1) Shelver, D.; Kerby, R. L.; He, Y.; Roberts, G. P. (1995) Carbon monoxide-induced activation of gene expression in Rhodospirillum rubrum requires the product of cooA, a member of the cyclic AMP receptor protein family of transcriptional regulators. J. Bacteriol. 177, 21572163. (2) He, Y.; Shelver, D.; Kerby, R. L.; Roberts, G. P. (1996) Characterization of a COresponsive transcriptional activator from Rhodospirillum rubrum. J. Biol. Chem. 271, 120-123. (3) Ensign, S. A.; Bonam, D.; Ludden, P. W. (1989) Nickel is required for the transfer of electrons from carbon monoxide to the iron-sulfur center(s) of carbon monoxide dehydrogenase from Rhodospirillum rubrum. Biochemistry 28, 4968-4973. (4) Kerby, R. L.; Ludden, P. W.; Roberts, G. P. (1995) Carbon monoxide-dependent growth of Rhodospirillum rubrum. J. Bacteriol. 177, 2241-2244. (5) Passner, J. M.; Schultz, S. C.; Steitz, T. A. (2000) Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution. J. Mol. Biol. 304, 847859. (6) Popovych, N.; Tzeng, S. R.; Tonelli, M.; Ebright, R. H.; Kalodimos, C. G. (2009) Structural basis for cAMP-mediated allosteric control of the catabolite activator protein. Proc. Natl. Acad. Sci. U S A 106, 6927-6932. (7) Schultz, S. C.; Shields, G. C.; Steitz, T. A. (1991) Crystal structure of a CAP-DNA complex: the DNA is bent by 90 degrees. Science 253, 1001-1007. (8) Lanzilotta, W. N.; Schuller, D. J.; Thorsteinsson, M. V.; Kerby, R. L.; Roberts, G. P.; Poulos, T. L. (2000) Structure of the CO sensing transcription activator CooA. Nat. Struct. Biol. 7, 876-880. (9) Komori, H.; Inagaki, S.; Yoshioka, S.; Aono, S.; Higuchi, Y. (2007) Crystal structure of CO-sensing transcription activator CooA bound to exogenous ligand imidazole. J Mol Biol 367, 864-871. (10) Borjigin, M.; Li, H.; Lanz, N. D.; Kerby, R. L.; Roberts, G. P.; Poulos, T. L. (2007) Structure-based hypothesis on the activation of the CO-sensing transcription factor CooA. Acta Crystallogr. D Biol. Crystallogr. 63, 282-287.

15


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(11) Clark, R. W.; Lanz, N. D.; Lee, A. J.; Kerby, R. L.; Roberts, G. P.; Burstyn, J. N. (2006) Unexpected NO-dependent DNA binding by the CooA homolog from Carboxydothermus hydrogenoformans. Proc. Natl. Acad. Sci. U S A 103, 891-896. (12) Kerby, R. L.; Youn, H.; Thorsteinsson, M. V.; Roberts, G. P. (2003) Repositioning about the dimer interface of the transcription regulator CooA: a major signal transduction pathway between the effector and DNA-binding domains. J. Mol. Biol. 325, 809-823. (13) Ellman, G. L. (1958) A colorimetric method for determining low concentrations of mercaptans. Arch. Biochem. Biophys. 74, 443-450. (14) Clark, R. W.; Youn, H.; Parks, R. B.; Cherney, M. M.; Roberts, G. P.; Burstyn, J. N. (2004) Investigation of the role of the N-terminal proline, the distal heme ligand in the CO sensor CooA. Biochemistry 43, 14149-14160. (15) Battye, T. G.; Kontogiannis, L.; Johnson, O.; Powell, H. R.; Leslie, A. G. (2011) iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr. D Biol. Crystallogr. 67, 271-281. (16) Evans, P. R.; Murshudov, G. N. (2013) How good are my data and what is the resolution? Acta Crystallogr. D Biol. Crystallogr. 69, 1204-1214. (17) Kuchinskas, M.; Li, H.; Conrad, M.; Roberts, G.; Poulos, T. L. (2006) The role of the DNA-binding domains in CooA activation. Biochemistry 45, 7148-7153. (18) McCoy, A. J.; Grosse-Kunstleve, R. W.; Adams, P. D.; Winn, M. D.; Storoni, L. C.; Read, R. J. (2007) Phaser crystallographic software. J. Appl. Crystallogr. 40, 658-674. (19) Winn, M. D.; Ballard, C. C.; Cowtan, K. D.; Dodson, E. J.; Emsley, P.; Evans, P. R.; Keegan, R. M.; Krissinel, E. B.; Leslie, A. G.; McCoy, A.; McNicholas, S. J.; Murshudov, G. N.; Pannu, N. S.; Potterton, E. A.; Powell, H. R.; Read, R. J.; Vagin, A.; Wilson, K. S. (2011) Overview of the CCP4 suite and current developments. Acta Crystallogr. D Biol. Crystallogr. 67, 235-242. (20) Adams, P. D.; Afonine, P. V.; Bunkoczi, G.; Chen, V. B.; Davis, I. W.; Echols, N.; Headd, J. J.; Hung, L.-W.; Kapral, G. J.; Grosse-Kunstleve, R. W.; McCoy, A. J.; Moriarty, N. W.; Oeffner, R.; Read, R. J.; Richardson, D. C.; Richardson, J. S.; Terwilliger, T. C.; Zwart, P. H. (2010) PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta crystallogr. D, Biol. Crystallogr. 66, 213-221. (21) Emsley, P.; Cowtan, K. (2004) Coot: model-building tools for molecular graphics. Acta Cryst. D60, 2126-2132.

16


Page 16 of 18

Page 17 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(22) Coyle, C. M.; Puranik, M.; Youn, H.; Nielsen, S. B.; Williams, R. D.; Kerby, R. L.; Roberts, G. P.; Spiro, T. G. (2003) Activation mechanism of the CO sensor CooA. Mutational and resonance Raman spectroscopic studies. J Biol Chem 278, 35384-35393. (23) Ibrahim, M.; Kerby, R. L.; Puranik, M.; Wasbotten, I. H.; Youn, H.; Roberts, G. P.; Spiro, T. G. (2006) Heme displacement mechanism of CooA activation: mutational and Raman spectroscopic evidence. J. Biol. Chem. 281, 29165-29173.

17


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC

18


Page 18 of 18

Testing the N-Terminal Velcro Model of CooA Carbon Monoxide

Recommend Documents