Thermal Cycling Cascade Biocatalysis of myo-Inositol Synthesis from

Subscriber access provided by BOSTON UNIV

Article

Thermal Cycling Cascade Biocatalysis of Myo-Inositol Synthesis from Sucrose Chao Zhong, Chun You, Ping Wei, and Y-H Percival Zhang ACS Catal., Just Accepted Manuscript • DOI: 10.1021/acscatal.7b01929 • Publication Date (Web): 25 Jul 2017 Downloaded from http://pubs.acs.org on July 28, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Catalysis is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

1

Thermal Cycling Cascade Biocatalysis of Myo-Inositol

2

Synthesis from Sucrose Chao Zhong,1,2 Chun You,3 Ping Wei,2 Yi-Heng Percival Zhang 1,3*

3 4

1

5

Virginia 24061, USA

6

2

7

Nanjing 211800, China

8

3

9

Avenue, Tianjin Airport Economic Area, Tianjin 300308, China

Biological Systems Engineering Department, Virginia Tech, 304 Seitz Hall, Blacksburg,

College of Biotechnology and Pharmaceutical Engineering, Nanjing Tech University,

Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, 32 West 7th

10 11

* Corresponding Author: Yi-Heng Percival Zhang ([email protected])

12

Tel: 001-540-231-7414, Fax: 001-540-231-3199

13 14

Running title: Thermal cycling cascade biocatalysis

15

1 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

16

Abstract

17

myo-Inositol belongs to the vitamin B group (vitamin B8) and is widely used in the drug,

18

cosmetic, and food & feed industries. It is produced by acid hydrolysis of phytate but this

19

method suffers from costly feedstock and serious phosphorous pollution. Here a four-enzyme

20

pathway containing thermophilic sucrose phosphorylase, phosphoglucomutase, inositol

21

1-phosphate synthase, and inositol monophosphatase was designed to convert sucrose to

22

inositol and fructose. To enable the use of enzymes with different optimal temperatures and

23

thermostabilities, we developed a thermal cycling cascade biocatalysis that can selectively

24

add less-thermostable sucrose phosphorylase immobilized on cellulose-containing magnetic

25

nanoparticles into the cold enzyme cocktail or remove it from the hot enzyme cocktail by

26

using a magnetic field (ON/OFF) switch. A series of exergonic reactions push the overall

27

reaction forward, resulting in a high product molar yield (0.98 mole of inositol per mole of

28

sucrose). This cascade biocatalysis platform could open a door to the large-scale production

29

of less-costly inositol and upgrade sucrose to the value-added nutraceutical and functional

30

sweetener.

31 32

Keywords: myo-inositol, cascade biocatalysis, magnetic relaxation switching, nutraceutical,

33

functional sweetener.

34


Page 2 of 36

Page 3 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

35

Introduction

36

Myo-inositol (called inositol later) is a member of the vitamin B group (vitamin B8).1

37

Although it has the same formula as glucose (G6H12O6), it has a unique six-carbon ring. It

38

have various biological functions on regulations of ion-channel permeability,

39

transcription-translation, metabolic flux, and etc.2 Due to its dual functions - nutraceutical

40

and functional sweetener,3 inositol can be used as a food additive for the production of health

41

products, especially the high-end functional drinks (e.g., Red Bull, vitamin drinks) and food

42

stuffs (e.g., infant formula). In the drug industry, it is a widely-used adulterant for numerous

43

drugs, such as semi-synthetic taxol, and used to treat cancer,1a nervous system disorders (e.g.,

44

depression),4 liver cirrhosis, fatty liver,5 and diabetes.6 Inositol is also essentially vital for

45

some animals lacking of its synthesis ability so that it is an important animal feed additive.7

46

In addition, inositol is used to make inositol nitrate, which can gelatinize nitrocellulose

47

applied in many modern explosives and solid rocket propellants,8 next-generation lithium ion

48

batteries,9 and numerous inositol-derived drugs.10

49 50

Nearly all inositol is produced by acid hydrolysis of phytate (inositol hexakisphosphate)

51

isolated from rice bran and corn steep liquor.11 This production method suffers from costly

52

feedstock (phytate), serious phosphorous pollution, and complicated feedstock and product

53

separation.12 Microbial fermentation of metabolically engineered microorganisms13 has been

54

developed, but it suffers from low product yields because intermediates of inositol synthesis

55

(e.g., glucose 6-phosphate) is a precursor of competitive pathways (e.g., glycolysis and 3 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

56

pentose phosphate pathway) and inositol is an important precursor for the synthesis of cell

57

mass.1c Recently, two independent groups have demonstrated the synthesis of inositol from

58

starch by using in vitro synthetic enzymatic pathways1b, 1c, but complicated characteristics of

59

starch result in incomplete utilization of all glucose units of starch.

60 61

Cascade biocatalysis or in vitro (cell-free) synthetic biology comprised of numerous

62

(purified) enzymes and/or coenzymes has been proposed to become an emerging

63

biomanufacturing platform that can catalyze complicated biotransformation.1c, 14 This

64

platform features high product yields,15 fast reaction rates,16 easy process control and

65

optimization,17 easy product separation,18 enabling construction of non-natural synthetic

66

pathways,19 and etc. However, one of the largest concerns of in vitro synthetic biology

67

platform is the unmatched characteristics of some enzyme components originated from

68

different sources, such as different optimal temperature, thermostability, pH stability, ionic

69

activation/inhibition, and etc.20 To enable high-performance for enzyme components, it is

70

essentially important to find out compromised reaction conditions or develop new solutions

71

to address these unmatched enzyme characteristics.

72 73

Sucrose, a primary product of plant photosynthesis, is a disaccharide containing both glucose

74

and fructose unit.21 Commercial sucrose with very high purity is one of the purest organic

75

compounds produced on a large industrial scale.22 The sugar industry, including plantations,

76

sugar mills and sugar-to-ethanol biorefineries, produces approximately 180 million metric 4 ACS Paragon Plus Environment

Page 4 of 36

Page 5 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

77

tons per year and is one of the most important components of the bioeconomy. Relatively low

78

prices of sucrose, fluctuating profits of sucrose, and shrinking market of sucrose motivate the

79

sugar industry to diversify its few product pipeline to value-added products such as

80

cellobiose,14c kojibiose,23 and nigerose.24

81 82

In this study the four-enzyme cascade pathway that converts sucrose to inositol and fructose

83

is comprised of sucrose phosphorylase (SP, EC 2.4.1.7), phosphoglucomutase (PGM, EC

84

5.4.2.2), inositol 1-phosphate synthase (IPS, EC 5.5.1.4), and inositol monophosphatase (IMP,

85

EC 3.1.3.25) (Figure 1). This pathway driven by a series of exergonic reactions lead to the

86

theoretical yield of inositol. Also, to enable the use of enzymes with different optimal

87

temperatures and thermostabilities, we developed a thermal cycling cascade biocatalysis that

88

can selectively add or remove the less-thermostable SP immobilized on cellulose-containing

89

magnetic nanoparticles (NMPs) in enzyme cocktail by using a magnetic field (ON/OFF)

90

switch.

91 92

Experimental Section

93

Materials

94

All chemicals were reagent-grade or higher purity, purchased from Sigma-Aldrich (St. Louis,

95

MO) or Fisher Scientific (Pittsburgh, PA), unless otherwise noted. The PCR enzyme used

96

was the Phusion DNA polymerase purchased from New England BioLabs (Ipswich, MA).

97

The oligonucleotides were synthesized by Integrated DNA Technologies (Coraville, IA). 5 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

98

Avicel PH105, microcrystalline cellulose, was purchased from FMC (Philadelphia, PA). The

99

gene of SP originated from Thermoanaerobacterium thermosaccharolyticum was prepared as

100

described previously 25 and its codon-usage was optimized for better expression in

101

Escherichia coli BL21(DE3).26 Plasmid pET20b-Tkpgm encoding PGM from Thermococcus

102

kodakaraensis, pET20b-Afips encoding IPS from Archaeoglobus fulgidus, and

103

pET20b-Tmimp encoding IMP from Thermotoga maritima were obtained from Tianjin

104

Institute of Industrial Biotechnology (China) as described elsewhere.1c The gene of family 3

105

cellulose-binding module (CBM) from the cipA gene of Clostridium thermocellum was

106

described elsewhere.19b

107

Strains and Media

108

E. coli TOP10 was used as host for DNA manipulation, and E. coli BL21 Star (DE3)

109

(Invitrogen) was used for recombinant protein expression. Luria-Bertani (LB) medium was

110

used for E. coli cell culture, and LB medium supplied with isopropyl-β-d-

111

thiogalactopyranoside (IPTG) induction was used for the recombinant protein expression.

112

Plasmid Construction and Protein Expression/Purification

113

Plasmids were constructed by using prolonged overlap extension PCR (POE-PCR).27 Plasmid

114

pET20b-cbm_sp encoding the CBM fused at N-terminus of SP from T.

115

thermosaccharolyticum was prepared based on pET20b-cbm as described previously.19b

116

Primers used in this study were listed in Table 1. Expression vectors were transformed to E.

117

coli BL21(DE3), and colonies were grown on LB agar plates with the appropriate antibiotic

118

at 37 °C overnight. Colonies were chosen for inoculation in 5 mL of LB medium and seed 6 ACS Paragon Plus Environment

Page 6 of 36

Page 7 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

119

cell culture was grown at 37 °C overnight. Two mL of seed cultures were inoculated into 200

120

mL of LB culture with the antibiotic. Cultures were incubated at 37 °C in a rotary shaker at

121

250 rpm until absorbance at 600 nm reached 0.6-0.8, at which point protein expression was

122

induced by adding IPTG to a final concentration of 0.01-0.1 mM. Expression was induced at

123

37 °C for 4 h or at 18 °C for 20 h. Fermentation broth was centrifuged at 4500 ×g for 5 min,

124

and the cell pellets were washed by 50 mM 4-(2-hydroxyethyl)-1-piperazineethane sulfonic

125

acid (HEPES) buffer (pH 7.5) once and re-suspended in 20 mL of 50 mM HEPES buffer (pH

126

7.5) containing 0.1 M NaCl. Cells were lysed in an ice bath by ultra-sonication with the

127

Fisher Scientific Sonic Dismembrator Model 500 (3 s pulse, total 180 s, at 40% amplitude).

128

The lysate was centrifuged, and the target proteins were recovered from the supernatant by

129

affinity adsorption on charged nickel resins or heat-treatment purification. Protein

130

concentration was measured by using Thermo Scientific Pierce Bradford method with bovine

131

serum albumin as a reference protein.

132

High-cell density fermentation of E. coli BL21(DE3) was conducted in 6- or 20-L fermenters

133

with a fed-batch mode.1c The washed suspension cells were homogenized and then treated at

134

80 °C for 20 min. After centrifugation, the supernatant containing thermophilic enzymes was

135

re-concentrated by ultra-filtration with a molecular weight cut-off of 50,000. Re-concentrated

136

enzymes were freeze dried for storage at 4 °C. Dissolved enzyme powders were used to

137

one-pot biosynthesis.


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

138

Enzymatic Activity Assays

139

The activity of PGM, IPS, and IMP were assayed as previously described.1c The

140

phosphorolytic activity assay of SP was performed in 450 µL of the mixture containing 400

141

µL of the liquid glucose/G6PDH assay reagent (Sigma-Aldrich, St. Louis, MO) and 50 µL of

142

the other reagents with the final concentrations of 50 mM phosphate, 200 mM sucrose, 10

143

U/mL PGM, and 0.5 U/mL SP. Glucose 1-phosphate (G1P) was measured by coupling the

144

PGM and the liquid glucose/G6PDH assay kit, and the formation of NADH with time was

145

monitored spectrophotometrically at 340 nm for 10 min. One unit of SP activity was defined

146

as the amount of enzyme that liberated one µmole of G1P from sucrose per min.

147

Enzymatic Synthesis of Inositol from Sucrose

148

One-pot biotransformation was conducted in 1 mL of 50 mM HEPES buffer (pH 7.5)

149

containing 20 mM phosphate, 50 mM sucrose, 1 mM MgCl2, 0.1 mM NAD+, 1.0 U of SP, 1.0

150

U of PGM, 2.0 U of IPS and 1.5 U of IMP at 50 or 70 °C. Reaction samples were withdrawn

151

at different times. The reaction was terminated by adding HClO4 (2%, v/v) followed by

152

neutralization with 3 M KOH. After centrifugation, supernatants were used for the

153

quantification of intermediates, substrate, and products. Also, two cycles of two-step

154

temperature-switching between 50 and 70 °C were applied to the inositol synthesis. Two

155

water baths had set temperatures of 50 and 70°C, respectively. The reaction at the first step

156

was carried out in a 50 °C water bath for 24 h; then the reactor was put into another 70 °C

157

water bath as the second step. To continue the second cycle, 1.0 U/mL of SP was added into

158

the system at the end of first cycle when reaction temperature was switched back to 50 °C. 8 ACS Paragon Plus Environment

Page 8 of 36

Page 9 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

159

Concentrations of G1P/G6P, phosphate, fructose and inositol were measured by Shimadzu

160

high performance liquid chromatography (HPLC) equipped with a Bio-Rad Aminex HPLC

161

organic acid column (HPX-87H, 300 × 7.8mm) and a refractive index detector. Samples were

162

separated at 60 °C with a mobile phase of 5 mM sulfuric acid solution at a flow rate of 0.6

163

mL/min. Retention times of G1P/G6P (overlap), phosphate, inositol, and fructose were 6.26,

164

8.12, 9.30, and 10.11 min, respectively. Concentration of G6P in supernatants was measured

165

directly by using the liquid glucose/G6PDH assay kit.

166

One-step purification and immobilization of CBM-SP

167

Avicel-containing magnetic nanoparticles (A-MNPs) were prepared using a solvothermal

168

method as described previously.28 Briefly, 0.338 g of iron chloride (FeCl3•6H2O, 1.25 mM)

169

was completely dissolved in 10 mL of ethylene glycol to yield a clear yellow solution,

170

followed by the addition of 1.36 g of sodium acetate (NaAc•3H2O, 10 mM) and 0.125 of

171

Avicel or of dextran. The mixture was stirred vigorously for 30 min. The mixture was sealed

172

in the pressure container and heated at 200 oC for 12 h. The containers were then cooled

173

down slowly at room temperature. The products collected by a magnet were washed with

174

ethanol and then dried at 60 oC for 6 h. Morphology image of A-MNPs was examined with

175

the LEO 1550 as a high-performance Schottky filed-emission scanning electron microscope

176

(Carl Zeiss Micoscopy, Jena, Germany).

177

For one-step CBM-SP purification and immobilization, the E. coli cell lysate containing

178

recombinant CBM-SP was mixed with A-MNPs at room temperature for 30 min. The

179

A-MNPs containing adsorbed CBM-SP were collected by using a magnet and the supernatant 9 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

180

was decanted. The assembled A-MNPs were washed in a 50 mM HEPES buffer (pH 7.5) at

181

ratio of 1:50 (v/v) for several times. The immobilized SP activity was measured as described

182

above.

183

Thermal-Cycling Four-Step Biocatalysis via Magnetic Relaxation Switching Technique

184

Cyclic four-step biocatalysis equipped with a magnetic relaxation switching platform was

185

carried out in 1 mL of the 50 mM HEPES buffer (pH 7.5) containing 20 mM phosphate, 50

186

mM sucrose, 1 mM MgCl2, 0.1 mM NAD+, 1.0 U of PGM, 2.0 U of IPS, 1.5 U of IMP and

187

1.0 U SP of A-MNPs. Two water baths have set temperatures of 50 and 70 °C, respectively.

188

In each cycle, it contained four steps: the first step was conducted at 50 °C water batch for the

189

first 24 h without a magnetic field, where all enzymes were added in the system; the second

190

step was a switch ON of the magnetic field to remove SP followed by a movement of the

191

reactor to 70 °C water batch, where the SP was stored in a 4°C refrigerator; the third step was

192

conducted at a 70 °C water batch with an ON of magnetic field without SP; the fourth step

193

was the movement of the reactor into 50oC water batch with a switch OFF of the magnetic

194

field so that the SP was re-added into the reactor. This four-step reaction can be reiterated a

195

number of times.

196

Inositol purification

197

Soluble enzymes in aqueous reaction solution were removed by ultra-filtration. The aqueous

198

solution was then mixed with 95% ethanol at a volume ratio of 1:5 at room temperature. The

199

ethanol precipitated inositol was dissolved in 80oC deionized water, making 150 g inositol

200

per liter solution. At a concentration of the 150 g/L inositol solution was mixed with 95% 10 ACS Paragon Plus Environment

Page 10 of 36

Page 11 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

201

ethanol at a volume ratio of 1:3. The ethanol precipitated inositol crystals were dried at 50 oC

202

oven. In one-step ethanol precipitation and crystallization, inositol recovery efficiency was

203

approximately 82%. The mother liquor after re-concentration can be precipitated and

204

crystallized. The overall inositol recovery efficiency through two-round purification was

205

approximately 95%. NMR analysis for Sigma and home-made inositol samples was

206

conducted by Tianjin Institute of Industrial Biotechnology (Tianjin, China).

207 208

Results

209

Although two independent groups demonstrate cascade biosynthesis of myo-inositol from

210

starch via an in vitro four-enzmye pathway,1b, 1c we here proposed another in vitro

211

coenzyme-free four-enzyme pathway that converts sucrose to inositol (Figure 1). This

212

pathway contained four reactions: (i) phosphorylation of sucrose to glucose 1-phosphate

213

(G1P) and fructose catalyzed by SP; (ii) conversion of G1P to glucose 6-phosphate (G6P)

214

catalyzed by PGM; (iii) isomerization of G6P to inositol 1-phosphate (I1P) catalyzed by IPS;

215

and (iv) the dephosphorylation of I1P to inositol and inorganic phosphate catalyzed by IMP.

216

Inorganic phosphate can be recycled between Reaction 1 and Reaction 4 in one vessel. This

217

pathway is driven by a series of exergonic reactions, especially for the last two steps

218

catalyzed by IPS and IMP, exhibited an overall Gibbs free energy (∆Go) of -108.7 kJ/mol,29

219

pushing the overall reaction toward completeness and leading to the theoretical yield of

220

inositol.


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

221

To produce inositol at a cost-effective way, it is essentially important to produce and purify

222

enzymes at low costs and prolong their lifetime in cascade biocatalysis. The discovery and

223

use of thermophilic enzymes from hyperthermophilic microorganisms is effective to decrease

224

enzyme purification costs by heat precipitation when expressed in the mesophilic host E. coli.

225

Because the same three thermophilic enzymes (i.e., PGM from T. kodakaraensis, IPS from A.

226

fulgidus, and IMP from T. maritima) have been identified by two unrelated groups for the

227

starch-to-inositol biosynthesis,1b, 1c they were used in this study due to their great

228

thermostability and high specific activities. There are only a few thermostable SPs available.

229

The most thermostable SP for now was from T. thermosaccharolyticum but it lose its activity

230

rapidly at temperatures higher than 60 °C.25 This enzyme was chosen but its

231

thermo-deactivation issue need be addressed.

232 233

The three enzymes PGM, IPS, and IMP were over-expressed very well in E. coli and purified

234

by heat precipitation.1c However, both wild-type sp gene and codon-optimized sp gene had

235

bad functional expression levels in E. coli. The selective introduction of synonymous rare

236

codons to codon-optimized sp gene greatly increased its soluble expression levels (Sequence

237

is available in Supporting Information).26 The His-tagged recombinant SP was then purified

238

by using nickel-resins. All of the four enzymes were purified to homogeneity (Figure 2). SP,

239

PGM, IPS and IMP had molecular weights of approximately 57, 50, 44, and 28 kDa,

240

respectively. The optimal temperature of SP is around 60°C while optimal temperatures of

241

the other three were 90°C or higher (Supporting Information Figure S1). Their specific 12 ACS Paragon Plus Environment

Page 12 of 36

Page 13 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

242

activities were 12.0 U/mg for SP at 50°C, 65.0 U/mg for PGM at 70°C, 1.8 U/mg for IPS at

243

70°C, and 100 U/mg for IMP at 70°C.

244 245

We reconstituted the four-enzyme mixture at SP:PGM:IPS:IMP unit ratio of 1:1:2:1.5 in 50

246

mM HEPES buffer (pH 7.5) containing 20 mM phosphate, 50 mM sucrose, and 1 mM MgCl2.

247

At 50°C, the enzyme cocktail produced inositol gradually until 18.5 mM at hour 72 (Figure

248

3a). At 70°C, the enzyme cocktail produced 12 mM inositol at hour 2, much faster than that

249

at 50°C. However, inositol levelled off after hour 12 (Figure 3b). The low inositol yield at

250

70°C was attributed to the fast deactivation of SP at evaluated temperatures,25 in agreement

251

with no G1P generation after hour 12.

252 253

To address the different thermostability of SP versus the other three enzymes, we tested a

254

temperature-stepwise bioprocess (Figure 4). In the first step, enzyme cocktail was incubated

255

at 50 °C for 24 h, where SP was able to convert 62% of sucrose to fructose and G1P; in the

256

second step, reaction temperature was increased to 70 °C for 24 h, the enzyme cocktail

257

rapidly converted G1P to inositol, resulting in 29 mM inositol at hour 48. Finally, after two

258

cycles of this two-step bioprocess, the yield of inositol was around 94%. It was anticipated

259

that nearly theoretical yield of inositol could be achieved after more cycles being conducted.

260

However, such infrequent addition of SP in each cycle was labour-intensive and costly, like

261

the original PCR reaction without the discovery of thermostable Taq DNA polymerase.

262 13 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

263

To simplify the CBM-tagged SP purification, we applied the Avicel-magnetic nanoparticles

264

(A-MNPs) for one-step purification and immobilization of SP (Figure 5a). Actually, the key

265

function of immobilized SP was selective removal or addition of SP by switching the

266

magnetic field of ON or OFF, respectively. Less costly A-MNPs were prepared by a

267

solvothermal method, where a mixture of iron chloride, ethylene glycol, sodium and Avicel

268

was heated at 200°C for 12 h. Typical A-MNPs had a diameter of 400-600 nm under

269

scanning electron microscopy (Figure 5b). The AMNPs can be easily separated from the

270

aqueous solution by applying a magnet (Figure 5c). The sp gene fused with the 3’ end of a

271

gene of family 3 cellulose-binding module (CBM3) from C. thermocellum was inserted into

272

plasmid pET20b, yielding plasmid pET20b-cbm_sp that encoded a fusion protein CBM-SP.

273

When the total cell lysate of E. coli BL21(DE3) with pET20b-cbm_sp (Lane T, Figure 5d)

274

was mixed with A-MNPs, the immobilized SP was easily prepared by using one-step affinity

275

adsorption followed by using a magnet (Lane AMNP, Figure 5d).

276 277

We designed the thermal-cycling four-step biocatalysis (Figure 6a). In the first step with the

278

magnetic field OFF, the mixture of AMNP-immobilized SP and PGM, IPS, and IMP at 50°C

279

was mainly responsible for sucrose phosphorylation and slow inositol synthesis. In the

280

second step with the magnetic field ON that removed SP from the aqueous solution, the

281

temperature of the aqueous reactant was increased from 50°C to 70°C. In the third step with

282

the magnetic field ON, the reaction temperature was kept at 70°C, ensuring that the three

283

enzymes catalyzed G1P to inositol. When a second round was operated, the reactor 14 ACS Paragon Plus Environment

Page 14 of 36

Page 15 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

284

temperature was decreased to 50°C and then the magnetic field was OFF, letting SP back to

285

the aqueous solution (the fourth step). The sucrose phosphorylation catalyzed by SP was

286

carried out again. This four-step one-pot biotransformation can be operated reiteratively.

287 288

The four-step biotransformation was conducted on 50 mM sucrose (Figure 6b). In the first

289

step at 50°C, the four-enzyme mixture consumed 28.5 mM sucrose and converted a fraction

290

of G1P to produce 9.5 mM inositol after 24 h. When a magnetic field was ON, removing SP

291

from the aqueous solution, the three-enzyme mixture converted G1P & G6P to inositol at

292

70°C, resulting in 27 mM inositol at hour 48. When the reaction temperature was decreased

293

to 50 °C, the magnetic field was OFF, adding SP into the aqueous reactant. Sucrose was

294

phosphorolyzed again. Such operations can be reiterated again. After 108 h (two cycles), the

295

final inositol titer and yield were 48 mM and 98%, respectively. When a third cycle was

296

conducted, the final inositol yield was nearly 100% (data not shown).

297 298

Discussion

299

We demonstrated one-pot biotransformation from sucrose to value-added inostiol by using a

300

four-enzyme cocktail. This in vitro cascade biocatalysis could be a disruptive method for

301

green inositol production compared to the current phytate-based method. This bioprocess

302

features many biomanufacturing advantages: (i) high product yield without a side product; (ii)

303

much less costly substrate sucrose than phytate, and sucrose supply is much larger than

304

available phytate; (iii) lower capital investment for bioreactors compared to acid 15 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

305

corrosion-resistant high-pressure chemical reactors; (iv) nearly zero phosphorous pollutant

306

generation compared to phytate-based methods; (v) easy and scalable production and

307

purification of thermoenzymes; and (vi) nearly no odds for microbial contamination at

308

elevated temperatures or phase contamination.

309 310

Inositol synthesis from sucrose was implemented by using thermophilic SP and three

311

hyper-thermophilic enzymes (i.e., PGM, IPS, IMP), but the process is greatly restricted by

312

the thermostability inconsistency in this enzyme cocktail. Previously reported mesophilic SPs

313

lacking thermostability limited their applications.30 Typically, the stability of SP can be

314

enhanced by immobilization on the solid support 31 or by protein engineering.30a However, to

315

our limited knowledge, the hyperthermostable SPs currently reported are still not applicable

316

to bioprocess at elevated temperatures (>70°C) for long time. Therefore, it is essential to

317

develop thermal cycling cascade biocatalysis to address these unmatched characteristics.

318 319

To address different optimal temperature and thermostability in the enzyme cocktail, a cyclic

320

four-step biocatalysis was designed. By controlling a switch ON/OFF of the magnetic field

321

and reaction temperatures between 50°C and 70°C, we were able to quickly adjust the

322

enzyme composition in the reactor and then control reaction rates and directions. This

323

biocatalysis control based on magnetic relaxation switching technique would have extensive

324

applications in the future as compared to pH control or thermal temperature adjustment.32

325

Also, this technique provides a new bioprocessing strategy. Immobilized enzymes on 16 ACS Paragon Plus Environment

Page 16 of 36

Page 17 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

326

AMNPs can be easily separated from bioreactors by using a magnetic force for next-round

327

bioprocessing. Furthermore, selective removal/addition of immobilized enzymes could be

328

very effective in stopping or resuming cascade enzymatic reactions within a very short time.

329

For example, sugar-hydrogen-fuel cell electric vehicles could contain an on-board

330

bioreformer to produce high-purity hydrogen for the proton electron membrane fuel cell

331

stack.33 In response to immediate hydrogen need and sudden stoppage of hydrogen

332

production for driving, we could immobilize hydrogenase on AMNPs and control hydrogen

333

generation rates by applying this strategy, like the use of (neutron poison) control rods in

334

nuclear fission reactors.

335 336

Less costly inositol would increase its potential market size. First, the product mixture-

337

inositol and fructose after enzymes removal via ultrafiltration can be added directly to

338

functional soft drinks (e.g., Red Bull, vitamin or energy drinks). The mixture of inositol (50%

339

sweetness) and fructose (175% sweetness) has a little higher sweetness than sucrose. Also,

340

phosphate is a common component of soft drinks, there is no need for further separation of

341

product mixture for its use in the soft drinks. The consumption of inositol-rich drinks would

342

help meet the recommended supplementary inositol uptake of approximately one to two

343

grams per day per person. Second, another under-explored market of inositol is animal feed

344

additive. It is well-known that animal lacking inositol synthesis ability may develop the

345

lipodystrophies (fatty livers, fatty intestines, low blood lipoproteins).7, 34 Inositol-added feed

346

can promote growth and prevent animal death. For example, inositol addition can stimulate 17 ACS Paragon Plus Environment

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

347

growth rates of fish and shrimp by 20-30% and improve their meat texture and taste.6 By

348

considering the market of animal feed (i.e., nearly 1 billion tons of feed consumption per

349

year), 0.1-0.3% addition could allow inositol to become the largest vitamin. Third, inositol is

350

a precursor of glucaric acid,35 which is among DOE’s top 12 renewable chemical compounds.

351

Glucaric acid can be used to make biodegradable polymer and replace chelating agent

352

ethylenediaminetetraacetic acid (EDTA),36 which has been banned by Western Europe.

353 354

Conclusion

355

In a word, we developed a thermal cycling four-step cascade biocatalysis to convert sucrose

356

to approximately 10-fold value-added inositol via an in vitro synthetic biology platform

357

equipped with the magnetic relaxation switching technique. This biocatalysis could help the

358

sugar industry to diversify its product pipeline and increase value greatly. Also, less-costly

359

inositol would find its more applications in soft drinks, animal feed additive, biochemicals,

360

and biopolymers.

361 362

Supporting Information

363

Sequence alignment of sp gene for enhanced functional expression and cbm_sp gene, optimal

364

temperature profiles of enzyme components, and characterization of inositol by 1H-NMR is

365

available in Supporting Information.

366


Page 18 of 36

Page 19 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

367

Acknowledgements

368

This project was jointly supported by Biological System Engineering Department, Virginia

369

Polytechnic Institute and State University, Virginia, Nanjing Tech University and Tianjin

370

Institute of Industrial Biotechnology (TIB). CZ was partially funded by the Priority

371

Academic Program Development of Jiangsu Higher Education Institutions in Nanjing Tech

372

University and PZ was partially supported by the Virginia Agricultural Experiment Station

373

and the Hatch Program of the National Institute of Food and Agriculture, USA. Recombinant

374

IPS, PGM, and FBP were provided from TIB. Product purification and NMR analysis were

375

conducted by TIB.

376 377


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

378

References

379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418

1. (a) Vucenik, I.; Shamsuddin, A. M. J Nutr 2003, 133, 3778S-3784S; (b) Fujisawa, T.; Fujinaga, S.; Atomi, H., Appl. Environ. Microbiol. 2017, DOI: 10.1128/aem.00550-17; (c) You, C.; Shi, T.; Li, Y.; Han, P.; Zhou, X.; Zhang, Y.-H. P. Biotechnol Bioeng 2017, 114, 1855-1864. 2. Holub, B. J. Annu Rev Nutr 1986, 6, 563-597. 3. Thomas, M. P.; Mills, S. J.; Potter, B. V. L., T. Angew Chem Int Ed 2016, 55, 1614-1650. 4. Levine, J.; Kurtzman, L.; Rapoport, A.; Zimmerman, J.; Bersudsky, Y.; Shapiro, J.; Belmaker, R. H.; Agam, G., CSF. J Neural Trans 1996, 103, 1457-1462. 5. Kenney, J. L.; Carlberg, K. A., Int J Sports Med 1995, 16, 114-116. 6. Croze, M. L.; Vella, R. E.; Pillon, N. J.; Soula, H. A.; Hadji, L.; Guichardant, M.; Soulage, C. O. J Nutr Biochem 2013, 24, 457-466. 7. EFSA Panel (FEEDAP). EFSA J 2014, 12, 3671. 8. Ledgard, J., The Preparatory Manual of Explosives, 3rd ed; Seattle, WA, 2007, 243-244. 9. Armand, M.; Tarascon, J. M., Nature 2008, 451, 652-7. 10. Herrera-Salgado, Y.; Garduno-Ramirez, M. L.; Vazquez, L.; Rios, M. Y.; Alvarez, L. J Nat Prod 2005, 68, 1031-1036. 11. (a) Shirai, M.; Yonehara, T., US patent 5618708, 1997; (b) Marounek, M.; Dušková, D.; Skřivanová, V., Br J Nutr 2003, 89, 287-294. 12. Rapp, C.; Lantzsch, H. J.; Drochner, W., J Anim Physiol Anim Nutr 2001, 85, 420-430. 13. Agrawal, P. US patent 5,296,364, 1994. 14. (a) Guterl, J.-K.; Garbe, D.; Carsten, J.; Steffler, F.; Sommer, B.; Reiße, S.; Philipp, A.; Haack, M.; Rühmann, B.; Koltermann, A.; Kettling, U.; Brück, T.; Sieber, V. ChemSusChem 2012, 5, 2165-2172; (b) Tessaro, D.; Pollegioni, L.; Piubelli, L.; D’Arrigo, P.; Servi, S., ACS Catal 2015, 5, 1604-1608; (c) Zhong, C.; Wei, P.; Zhang, Y.-H. P. Chem Eng Sci 2017, 161, 159-166; (d) Opgenorth, P. H.; Korman, T. P.; Bowie, J. U. Nat Chem Biol 2016, 12, 393-395; (e) Schrittwieser, J. H.; Sattler, J.; Resch, V.; Mutti, F. G.; Kroutil, W. Curr Opin Chem Biol 2011, 15, 249-256; (f) Simon, R. C.; Richter, N.; Busto, E.; Kroutil, W. ACS Catal 2014, 4, 129-143. 15. Rollin, J. A.; Tam, T. K.; Zhang, Y.-H. P. Green Chem 2013, 15, 1708-1719. 16. Zhu, Z.; Kin, T. T.; Sun, F.; You, C.; Zhang, Y.-H. P. Nat Commun 2014, 5, 3026. 17. Bujara, M.; Schümperli, M.; Pellaux, R.; Heinemann, M.; Panke, S. Nat Chem Biol 2011, 7, 271-277. 18. Kim, E. J.; Wu, C. H.Adams, M.; Zhang, Y.-H. P. Chemistry 2016, 22, 16047-16051. 19. (a) Kim, J. E.; Zhang, Y.-H.P. Biotechnol Bioeng 2015, 113, 275-282; (b) You, C.; Chen, H. G.; Myung, S. W.; Sathitsuksanoh, N.; Ma, H.; Zhang, X. Z.; Li, J. Y.; Zhang, Y.-H. P. Proc Natl Acad Sci USA 2013, 110, 7182-7187. 20. (a) Hold, C.; Billerbeck, S.; Panke, S. Nat Commun 2016, 7, 12971; (b) Zhang, Y.-H. P.; Huang, W. D. Trends Biotechnol 2012, 30, 301-306. 21. Reid, S. J.; Abratt, V. R. Appl Microbiol Biotechnol 2005, 67, 312-321. 20 ACS Paragon Plus Environment

Page 20 of 36

Page 21 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442

ACS Catalysis

22. Renouf, M. A.; Wegener, M. K.; Nielsen, L. K. Biomass Bioenergy 2008, 32, 1144-1155. 23. Kitao, S.; Yoshida, S.; Horiuchi, T.; Sekine, H.; Kusakabe, I. Biosci Biotechnol Biochem 1994, 58, 790-791. 24. Kraus, M.; Görl, J.; Timm, M.; Seibel, J.. Chem Commun 2016, 52, 4625-4627. 25. Qi, P.; You, C.; Zhang, Y.-H. P. ACS Catal 2014, 4, 1311-1317. 26. Zhong, C.; Wei, P.; Zhang, Y.-H. P. Biotechnol Bioeng 2017, 114, 1054-1064. 27. You, C.; Zhang, X.-Z.; Zhang, Y.-H. P. Appl Environ Microbiol 2012, 78, 1593-1595. 28. Myung, S.; You, C.; Zhang, Y.-H. P. J Mater Chem B 2013, 1, 4419-4427. 29. Flamholz, A.; Noor, E.; Bar-Even, A.; Milo, R., Nucleic Acids Res 2012, 40, 770-775. 30. (a) Cerdobbel, A.; De, W. K.; Aerts, D.; Kuipers, R.; Joosten, H. J.; Soetaert, W.; Desmet, T.. Protein Eng Des Sel 2011, 24, 829-834; (b) Kim, M.; Kwon, T.; Lee, H. J.; Kim, K. H.; Chung, D. K.; Ji, G. E.; Byeon, E. S.; Lee, J. H. Biotechnol Lett 2003, 25, 1211-1217. 31. Goedl, C.; Schwarz, A. A.; Nidetzky, B. J Biotechnol 2007, 129, 77-86. 32. (a) Weemaes; Ludikhuyze, C.; Broeck, L. V. D.; Hendrickx, I.; Marc, J Agr Food Chem 1998, 46, 2785-2792; (b) Schoevaart, R.; Rantwijk, F. V.; Sheldon, R. A. Cheminform 1999, 31, 2465-2466; (c) Jafari Khorshidi, K.; Lenjannezhadian, H.; Jamalan, M.; Zeinali, M. J Chem Technol Biotechnol 2016, 91, 539-546; (d) Doğaç, Y. I.; Çinar, M.; Teke, M. Prep Biochem Biotechnol 2015, 45, 144-157. 33. Zhang, Y.-H. P. Energy Environ Sci 2009, 2, 272-282. 34. Tilman, D.; Clark, M. Nature 2014, 515, 518-22. 35. (a) Moon, T. S.; Dueber, J. E.; Shiue, E.; Prather, K. L. J. Metab Eng 2010, 12, 298-305; (b) Shiue, E.; Prather, K. L. Metab Eng 2013, 22, 22-31. 36. Lake, J. A.; Adams, S. D. US patent 8513329, 2013.

443 444


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

445

Figures

446 447

Figure 1. Scheme of in vitro synthetic enzymatic pathway for myo-inositol synthesis from

448

sucrose. SP, sucrose phosphorylase; PGM, phosphoglucomutase; IPS, inositol-1-phosphate

449

synthase; and IMP, inositol monophosphatase.

450 451


Page 22 of 36

Page 23 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

452

453 454

Figure 2. SDS-PAGE analysis of purified recombinant enzymes for the sucrose-to-inositol

455

pathway: M, Pierce™ unstained protein marker; 1, sucrose phosphorylase (SP); 2,

456

phosphoglucomutase (PGM); 3, inositol-1-phosphate synthase (IPS); and 4, inositol

457

monophosphatase (IMP).

458


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

459

460 461

Figure 3. Profiles of inositol biosynthesis from sucrose at temperatures of 50 oC (a) and 70 oC

462

(b).

463


Page 24 of 36

Page 25 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

464

465 466

Figure 4. Profiles of inositol synthesis in two cycles of two-step temperature switching

467

bioprocess, where ■ presents sucrose, ● presents inositol, ▲ presents fructose, □ presents

468

G1P, ∆ presents G6P; Grey area indicates synthesis at 50 oC, light-blue area indicates

469

synthesis at 70 oC.

470 471 472


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

473

474 475

Figure 5. Scheme of one-step CBM-SP purification and immobilization based on

476

Avicel-magnetic nanoparticles (AMNPs) (a), image of scanning electron microscopy of

477

AMNPs (b), photos of the AMNP-suspension solution without and with a magnetic field (c),

478

and SDS-PAGE analysis of the E. coli cell lysate containing the fusion protein CBM-CP and

479

the purified CBM-CP adsorbed on the surface of AMNPs (d).

480 481 482 483 484 485 486


Page 26 of 36

Page 27 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

487

488 489

Figure 6. The thermal cycling four-step biocatalysis for inositol synthesis by the selective

490

removal and addition of immobilized SP (a) and profile of one-pot inositol synthesis with a

491

temperature shift between 50 and 70 oC (b). Symbols: ■, sucrose; ●, inositol; ▲, fructose; □,

492

G1P; and ∆, G6P. Grey area indicates synthesis at 50 oC and light-blue area indicates

493

synthesis at 70 oC.

494


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

495

Table 1.

496

Plasmids and primers used in this study Plasmids pET20b-Ttsp

Features

Page 28 of 36

Ref.

AmpR, sp expression cassette containing SP protein from T.

26

thermosaccharolyticum, which was purified based on the C-terminal 6× His tag

pET20b-Tmpgm

AmpR, pgm expression cassette containing PGM protein from T. kodakaraensis,

1c

which was purified by using the C-terminal 6× His tag or heat precipitation

pET20b-Afips

AmpR, ips expression cassette containing IPS protein from A. fulgidus, which was

1c

purified by using the C-terminal 6× His tag or heat precipitation

pET20b-Tmimp

AmpR, imp expression cassette containing IMP protein from T. maritima, which

1c

was purified by using the C-terminal 6× His tag or heat precipitation

pET20b-cbm_sp

AmpR, expression cassette containing CBM fused at N-terminus of SP from T.

This work

thermosaccharolyticum

Primers

Sequence (5’ to 3’)

Purpose

IF-CBM_SP

ACCGCCGTCAGATGATCCGAATGCAATGGCTCTGAAAAATAAAGTGCAACT

pET20b-cbm_sp

IR-CBM_SP

GTGGTGGTGGTGGTGGTGCTCGAGCACCAGGTATTTCACTTCTTCGCC

pET20b-cbm_sp

VF-CBM_SP

GGCGAAGAAGTGAAATACCTGGTGCTCGAGCACCACCACCACCACCAC

pET20b-cbm_sp

VR-CBM_SP

AGTTGCACTTTATTTTTCAGAGCCATTGCATTCGGATCATCTGACGGCGGT

pET20b-cbm_sp

497 498


Page 29 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

499

Table of Content

500

A series of exergonic reactions catalyzed by a four-enzyme cocktail were designed to convert

501

sucrose at theoretical yield. A thermal cycling cascade biocatalysis equiped with

502

cellulose-containing magnetic nanoparticles immobilized enzyme and a magnetic field switch

503

was developed to compromise different optimal temperatures and thermostability of enzyme

504

components. This biocatalysis would assist the sugar industry to diversify the production of

505

value-added nutriceuticals from sucrose.

506 507


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Scheme of in vitro synthetic enzymatic pathway for myo-inositol synthesis from sucrose. SP, sucrose phosphorylase; PGM, phosphoglucomutase; IPS, inositol-1-phosphate synthase; and IMP, inositol monophosphatase. 254x190mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 30 of 36

Page 31 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 2. SDS-PAGE analysis of purified recombinant enzymes for the sucrose-to-inositol pathway: M, Pierce™ unstained protein marker; 1, sucrose phosphorylase (SP); 2, phosphoglucomutase (PGM); 3, inositol-1-phosphate synthase (IPS); and 4, inositol monophosphatase (IMP). 254x190mm (300 x 300 DPI)


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Profiles of inositol biosynthesis from sucrose at temperatures of 50 oC (a) and 70 oC (b). 254x190mm (300 x 300 DPI)


Page 32 of 36

Page 33 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 4. Profiles of inositol synthesis in two cycles of two-step temperature switching bioprocess, where ■ presents sucrose, ● presents inositol, ▲ presents fructose, □ presents G1P, ∆ presents G6P; Grey area indicates synthesis at 50 oC, light-blue area indicates synthesis at 70 oC. 254x190mm (300 x 300 DPI)


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Scheme of one-step CBM-SP purification and immobilization based on Avicel-magnetic nanoparticles (AMNPs) (a), image of scanning electron microscopy of AMNPs (b), photos of the AMNPsuspension solution without and with a magnetic field (c), and SDS-PAGE analysis of the E. coli cell lysate containing the fusion protein CBM-CP and the purified CBM-CP adsorbed on the surface of AMNPs (d). 254x190mm (300 x 300 DPI)


Page 34 of 36

Page 35 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 6. The thermal cycling four-step biocatalysis for inositol synthesis by the selective removal and addition of immobilized SP (a) and profile of one-pot inositol synthesis with a temperature shift between 50 and 70 oC (b). Symbols: ■, sucrose; ●, inositol; ▲, fructose; □, G1P; and ∆, G6P. Grey area indicates synthesis at 50 oC and light-blue area indicates synthesis at 70 oC.

254x190mm (300 x 300 DPI)


ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table of Content -- Graph 40x30mm (300 x 300 DPI)


Page 36 of 36

Thermal Cycling Cascade Biocatalysis of myo-Inositol Synthesis from

Recommend Documents