Thiazole orange modified carbon dots for ratiometric fluorescence

Subscriber access provided by - Access paid by the | UCSB Libraries

Biological and Medical Applications of Materials and Interfaces

Thiazole orange modified carbon dots for ratiometric fluorescence detection of G-quadruplex and double-stranded DNA Ming Jin, Xiangjun Liu, Xin Zhang, Linlin Wang, Tao Bing, Nan Zhang, Yun Zhang, and Dihua Shangguan ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b07869 • Publication Date (Web): 06 Jul 2018 Downloaded from http://pubs.acs.org on July 7, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Thiazole orange modified carbon dots for ratiometric fluorescence

detection

of

G-quadruplex

and

double-stranded DNA Ming Jin†, Xiangjun Liu*,‡,§, Xin Zhang‡,§, Linlin Wang‡,§, Tao Bing‡,§, Nan Zhang‡, Yun Zhang*,†, and Dihua Shangguan*,‡,§

†

College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, 730000, China

‡

Beijing National Laboratory for Molecular Sciences, Key Laboratory of Analytical Chemistry for

Living Biosystems, CAS Research/Education Center for Excellence in Molecular Sciences, Institute of Chemistry, Chinese Academy of Sciences, Beijing, 100190, China §

University of Chinese Academy of Sciences, Beijing, 100049, China

* Corresponding Author：： Tel&FAX：86-10-62528509, E-mail: [email protected], [email protected], [email protected]

KEYWORDS: carbon dots, thiazole orange, ratiometric fluorescence, DNA, G-quadruplex

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT A new carbon dots (CDs) based nanoprobe for ratiometric fluorescence detection of DNA was constructed in this work. Thiazole orange (TO), a specific organic small molecular probe towards DNA, is covalently linked to the surface of CDs, acting as the recognition element and fluorescence response unit. In the absence of DNA, the nanoprobe only emitted the blue fluorescence of CDs, while TO was almost non-fluorescent. Upon addition of DNA, a turn-on emission at 530 nm appeared and gradually enhanced along with the increasing of the target DNA, while the fluorescence of CDs kept unchanged, which realized the ratiometric detection of the target DNA. The CDs-TO nanoprobe showed good selectivity to parallel G-quadruplex (G4) and double-stranded (ds) DNA over antiparallel G4 and single-stranded DNA. Moreover, the ratiometric fluorescence nanoprobe exhibited high sensitivity for ssab (a dsDNA) and c-myc (a parallel G4) with a low detection limit of 0.90 and 3.31 nM, respectively. Additionally, the G4/hemin peroxidase activity inhibition experiment demonstrated that CDs-TO bound to the G4s through end-stacking mode.

INTRODUCTION Facile, sensitive, and selective recognition of various nucleic acid structures have attracted much attention because of the applications in disease diagnosis and drug design. Fluorescence probes, owing to their high sensitivity, fast response and low cost, are extensively studied in recent years. Thiazole orange (TO), an exceptional asymmetric cyanine dye, is widely used for fluorescence imaging and detection of nucleic acids1-3. This dye is almost non-fluorescence in buffer solution, whereas shows a great fluorescence enhancement when binding to double-stranded DNA (dsDNA)4. In addition to dsDNA, TO has been reported to bind G-quadruplex DNA (G4s)5, a four-stranded helical structure formed by G-rich nucleotide sequences. Many biologically related nucleotide sequences can fold into G4s, such as telomeres and promoter regions of many oncogenes, which may influence many biological activities, including apoptosis, cellular proliferation and tumorigenesis6. Hence, the ligands which can facilitate the formation and stabilization of G4 structures have attracted more and more attention as a new class of potential antitumor drugs. Such a significant fluorescence enhancement of TO is due to that the intramolecular rotation between benzothiazole and quinoline heterocycle is


Page 2 of 20

Page 3 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


restricted when TO binds to dsDNA or G4s, which hinders the excited-state twisting and reduces the rapid nonradioactive transition to the ground state7. However, the fluorescence intensity variations of TO at a single wavelength may be influenced by some factors, such as the stability of instrumental light source, the concentration of fluorescent probe, and instrumental factors. Ratiometric fluorescence probe, which determined the intensity ratio of two different emissions, can effectively eliminate the influence of these factors and achieve more precise quantitative detection. So, it is essential to design ratiometric fluorescence probes for DNA detection. In recent years, ratiometric fluorescent probes based on nanomaterials have attracted increasing attentions due to their notable advantages, such as the nanosize, good photostability, and rich surface functional groups for further modification8-11. Carbon dots (CDs), an emerging star in the nanocarbon family, have drawn great interests owing to their good photostability, strong emission, excellent water solubility, and low toxicity. Such fascinating properties make CDs especially useful in a wide range of applications, such as photocatalysis12,13, sensors14-16, bioimaging17,18, and drug delivery19-21. Because of their easy modification, some molecules with recognition ability have been covalently linked to CDs surface, realizing detection of various targets. For example, Yu et.al., developed a naphthalimide azide derivative modified CDs, which realized ratiometric fluorescence detection of H2S in aqueous media and inside live cells22; Gao et.al., prepared hydroethidine modified CDs, which realized intracellular ratiometric fluorescence bioimaging and biosensing of superoxide anion23; An et.al., developed a CDs-hemicyanine nanohybrid system, which realized ratiometric detection of hydrazine24. These results indicated that CDs is a good matrix to construct ratiometric fluorescence nanoprobe. Herein, we report a new CDs-based nanoprobe, CDs-TO, for ratiometric fluorescence detection of DNA. In this nanoprobe, TO acted as the recognition and response unit, which interacted with target DNA resulting in a strong turn-on emission at 530 nm, while CDs used as the reference unit because of their unchanged fluorescence emission (Scheme 1). The selectivity and sensitivity of CDs-TO nanoprobe for different types of DNA were investigated. And the binding mode and binding affinity of CDs-TO with G4s were also studied. Additionally, the application for ratiometric detection of a parallel G4, c-myc, in serum samples were carried out.



Scheme 1. Principle of CDs-TO for ratiometirc fluorescence detection of target DNA.

EXPERIMENTAL SECTION Oligonucleotides. All oligonucleotides (Table 1) were purchased from Sangon Biotech Co. Ltd. (Shanghai, China), and dissolved in Tris-HCl buffer (10 mM Tris-HCl, 0.1 mM EDTA, 100 mM NaCl, 20 mM KCl, pH 7.4) except for 22AG. 22AG Na+ was sequence 22AG dissolved in Na+ buffer (10 mM Tris-HCl, 0.1 mM EDTA, 100 mM NaCl, pH 7.4). 22AG K+ was sequence 22AG dissolved in K+ buffer (10 mM Tris-HCl, 0.1 mM EDTA, 100 mM KCl, pH 7.4). The buffers used in binding experiments were as same as those used to dissolve the oligonucleotides. All oligonucleotides were pre-treated by heating at 95 °C for 10 min followed by rapidly cooling on ice, and kept at 4 °C overnight before use. Chemicals. 4-methylquinoline, 5-bromovaleric acid, 2-thiomethylbenzothiazole, 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), TO, and cytosine were purchased from J&K Company. 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDCI), N-Hydroxysuccinimide (NHS), 2,2 '- (ethylene dioxy) bis (ethylamine), citric acid, and thymine were purchased from Sigma-Aldrich. Iodomethane was purchased from Energy Chemical. Other reagents were purchased from Beijing Chemical Plant (Beijing, China). Hemin, ATP, BSA and HSA were purchased from Beijing XinJingKe Biotechnology Ltd. (Beijing, China). GMP was purchased from Sangon Biotech Co. Ltd. (Shanghai, China). Human serum was purchased from Jiangsu Kate Biological Technology Co., Ltd. Instruments. 1H NMR spectra were collected on a Bruker AV500M spectrometer. ESI-MS were


Page 4 of 20

Page 5 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


recorded on a Shimadzu LC-MS 2010A system. Transmission electron microscopy (TEM) assay was performed on a JEOL JEM-2100F electron microscope. High-resolution MS were measured on a Bruker Daltonics Flex-Analysis. Fluorescence spectra were collected on a Hitachi F-4600 fluorescence spectrofluorometer. Absorption spectra were measured on a Molecular Devices SpectraMax M5 instrument. Oligonucleotide concentrations were determined on a ThermoFisher NanoDrop 2000 instrument. Circular dichroism spectra were recorded on a JASCO J-815 circular dichroism spectropolarimeter.

Scheme 2. Synthetic route of TO-COOH. Reagents and conditions: (a) 130 °C, 6 h; (b) acetonitrile, 45 °C, 12 h; (c) MeOH, Et3N, 12 h, rt.

Synthesis of 1-(4-carboxybutyl) thiazole orange (TO-COOH, Scheme 2). 1-(4-carboxybutyl)-4-methylquinolin-1-ium25, 1. 4-methylquinoline (2.0 g, 14 mmol) and 5-bromopentanoic acid (3.8 g, 21 mmol) were stirred for 6 h at 130 °C. Then 20 mL of acetone was added into the reaction flask after cooling down to room temperature (RT). The precipitate was collected by filtration, washed with acetone several times, and then dried under reduced pressure. MS (ESI): m/z calcd for C15H18NO2+[M]+: 244.1; found: 244.1. 3-methyl-2-(methylthio)benzo[d]thiazol-3-ium26, 2. 2-(methylthio) benzothiazole (4.0 g, 22 mmol) and iodomethane (6.4 g, 45 mmol) were dissolved in 20 mL of acetonitrile under N2 atmosphere. The reaction mixture was stirred at 45 °C for 12 h. After cooling to RT, the precipitate was collected via vacuum filtration, washed with Et2O (3 × 20 mL), and dried under reduced pressure to yield a white solid. 1H NMR (400 MHz, Methanol-d4) δ 8.25 (dd, 1H), 8.09 (d, 1H), 7.86 (ddd, 1H), 7.80 – 7.63 (m, 1H), 4.17 (s, 3H), 3.17 (s, 3H). MS (ESI): m/z calcd for C9H10NS+ [M]+: 164.1; found: 164.1.



TO-COOH27, 3. Compound 2 (1.0 g, 2.4 mmol) and compound 1 (0.8 g, 2.4 mmol) were dissolved in 10 mL MeOH. Et3N (0.67mL, 5.0 mmol) was added to the mixture which resulted in a red solution immediately. The reaction mixture was stirred for 12 h at RT. After evaporation of the solvent, the crude product was purified on a silica gel column using dichloromethane/methanol/HOAc (50:1:0.1, v/v/v) as eluent to give the red solid product as a final product. 1H NMR (400 MHz, DMSO-d6) δ 8.77 (d, 1H), 8.72 (d, 1H), 8.08 (d, 1H), 7.97 (d, 1H), 7.93 (d, 1H), 7.72 (d, 1H), 7.70 (d, 1H), 7.56 (t, 1H), 7.37 (t, 1H), 7.33 (d, 1H), 6.89 (s, 1H), 4.64 (t, 2H), 4.02 (s, 3H), 2.31 (t, 2H), 1.92 (p, 2H), 1.67 (q, 2H). HRMS (ESI-TOF): m/z calcd for C23H23N2O2S+[M]+: 391.14748; found: 391.14796. Preparation of amino functionalized CDs. The mixture of 2,2 '- (ethylene dioxy) bis (ethylamine) and citric acid was heated to 200 °C for 1 h. After cooling to RT, the mixture was dissolved in 50 mL of ultrapure water and dialyzed with 500 Da dialysis bag for 72 h. The water was removed using a rotary evaporator, and the final product was dissolved in 2 mL of ultrapure water for the next use. Preparation of CDs-TO. TO-COOH (2.0 mg) and a certain amount of CDs were dissolved in HEPES buffer (20 mM, pH 6.5), EDCI (5.0 mg) and NHS (3.0 mg) were added. The reaction mixture was stirred for 24 h at RT, and then dialyzed with 500 Da dialysis bag for 72 h. The water was removed by rotary evaporation and the final product was dissolved in 2 mL of Tris-HCl buffer (10 mM, pH 7.4) for further use. UV/Vis spectra measurement. Different oligonucleotides and 10 µL of CDs-TO solution were mixed in Tris-HCl buffer to give a final volume of 400 µL. After standing for 2 h at RT, absorption spectra were recorded on a SpectraMax M5 instrument. Fluorescence assay. Different oligonucleotides were mixed with 0.5 µL of CDs-TO solution in Tris-HCl buffer to give a final volume of 200 µL and the mixtures were left to stand for 2 h at RT. Then the fluorescence spectra were collected on a Hitachi F-4600 fluorescence spectrophotometer. For the sensitivity study, fluorimetric titrations of CDs-TO with different oligonucleotides were performed. CDs-TO was mixed with different concentrations of DNA for 2 h at RT, then fluorescence spectra were collected. Selectivity and interference tests. Common metal ions (Na+, K+, Ca2+, Mg2+, Zn2+, Li+, Fe2+, Fe3+, Al3+, Cu2+), four nucleic acid base derivatives (ATP, GMP, cytosine, thymine), and two proteins (HSA,


Page 6 of 20

Page 7 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


BSA) were used for the interference study. The stock solutions (10.0 mM) of metal ions and nucleic acid base derivatives (ATP, GMP, cytosine, thymine) were prepared in water. The stock solutions of two proteins (HSA, BSA) with a concentration of 1.0 mM were prepared in water. For the selectivity and interference study, a small aliquot of the stock solution of interference substances were mixed with CDs-TO solution for 2 h at RT, then the fluorescence spectra were recorded. Binding mode study. 10 µL of different oligonucleotides (ssab, c-myc, and TBA, 20 µM) were mixed with 100 µL of TO-COOH (20 µM) or 20 µL of CDs-TO solution respectively with a final volume of 172 µL. The mixture was kept in the dark for 2 h at RT, then 10 µL of hemin (20 µM) was added. After 1 h, 4 µL of ABTS (10 mM) was added, and then 4 µL of H2O2 was added to initiate the reaction. The absorbance at 415 nm was recorded within 25 min. Circular dichroism spectroscopy. Different oligonucleotides (c-myc, 22AG Na+, and 22AG K+, 5.0 µM) were mixed with TO-COOH (10.0 µM), CDs, and CDs-TO in Tris-HCl buffer respectively. After leaving the mixtures in the dark for 2.0 h at RT, circular dichroism spectra were recorded. For conformation affection of G4s in Na+ and K+ free Tris-HCl buffer, 4.0 µM of c-myc or TBA was co-annealed in the presence of CDs, TO-COOH, and CDs-TO respectively by heating 5 min at 95 oC, then cooled to 4 oC quickly and kept overnight before circular dichroism measurement. Human serum sample analysis. C-myc (a parallel G4) was selected for the serum samples investigation. CDs-TO mixed with human serum (1.0%) samples spiked with different concentrations of c-myc (0.05, 0.10 and 0.15 µM) separately. After leaving the mixtures in the dark for 2.0 h at RT, fluorescence spectra were collected.

RESULTS AND DISCUSSION Preparation and characterization of CDs and CDs-TO nanoprobe. For the construction of the ratiometric fluorescence nanoprobe, amine-coated CDs was firstly prepared by heating citric acid in 2,2'-(Ethylenedioxy) bis (ethylamine) at 200 °C directly. Same with most CDs prepared with different methods, the obtained amine-coated CDs showed different fluorescence emissions at different excitation wavelengths28-30 (Figure 1a). With the increase of the excitation wavelength, red-shifted emissions were obtained. The strongest emission of CDs was obtained at the excitation wavelength of 370 – 390 nm (Figure 1a, inset). The HR-TEM image showed that the prepared CDs with a diameter of



about 5-6 nm (Figure 1b, and inset). Additionally, dynamic light scattering measurement also showed that the average diameter of CDs in water was about 5 nm, which is consistent with the results of HR-TEM and indicates that the prepared amine-coated CDs has good dispersibility in water (Figure 1c). To modify TO on the surface of amine-coated CDs, a TO derivative, TO-COOH, was synthesized (Scheme 2) by the reaction of 3-methyl-2-(methylthio) benzothiazol-3-ium (compound 2) with 1-(4-carboxybutyl)-4-methylquinolin-1-ium (compound 1) in MeOH containing Et3N. Then TO-COOH was introduced to the surface of CDs via amide formation reaction using EDCI/NHS to obtain CDs-TO nanoprobe. The UV−vis spectrum (Figure 1d) showed typical absorption peak of CDs at 250, 280 and 350 nm30,31 (black line), which were attributed to the aromatic sp2 domains and C=O or C=N doped in CDs. TO-COOH showed an absorption band with the peak at 502 nm (red line). The absorption peak at 502 and 480 nm of CDs-TO (blue line) indicated the successful modification of TO-COOH on the surface of CDs. And the new appeared absorption peak at 480 nm may be due to the self-interaction of the TO linked on the surface of CDs.


Page 8 of 20

Page 9 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. a) Fluorescence emission spectra of CDs excited at different wavelengths (350 to 420 nm; Inset, fluorescence intensity at 450 nm). b) TEM images of CDs. c) Size distribution of the CDs. d) Absorption spectra of CDs, TO-COOH, and CDs-TO.

Absorption and fluorescence spectra of CDs-TO in the presence of various DNA. DNA sequences, used in this work were shown in table 1, including two single-stranded DNA (ss1, ss2), a duplex sequence (ssab), five parallel G4 sequences (c-kit2, pu22, c-myc32, ps2.m33, and c-kit8734), two antiparallel G4 sequences (TBA35, Hum24) and one human telomeric G4 sequence (22AG36,). The binding experiments of CDs-TO with these DNA sequences were carried out in Tris-HCl buffer except for 22AG. Since 22AG can form antiparallel G4 in Na+ buffer37 (22AG Na+) and mixed type G4 in K+ buffer38 (22AG K+), its binding experiments were performed in Na+ or K+ buffer respectively. Table 1. Oligonucleotides used in this study Name

Sequence (from 5’ to 3’)

Structure

ss1

CCAGTTCGTAGTAACCC

Single strand

ss2

GGTCAAGCATCATTGGG

Single strand

ssab

CCAGTTCGTAGTAACCC

Double strand

GGGTTACTACGAACTGG c-myc

TGAGGGTGGGGAGGGTGGGGAA

Parallel G4

c-kit2

CGGGCGGGCGCGAGGGAGGG

Parallel G4

pu22

TGAGGGTGGGTAGGGTGGGTAA

Parallel G4

ps2.m

GTGGGTAGGGCGGGTTGG

Parallel G4

c-kit87

AGGGAGGGCGCTGGGAGGAGGG

Parallel G4

TBA

GGTTGGTGTGGTTGG

Antiparallel G4

Hum24

TTAGGGTTAGGGTTAGGGTTAGGG

Antiparallel G4

22AG Na+

AGGGTTAGGGTTAGGGTTAGGG

Antiparallel G4

22AG K+

AGGGTTAGGGTTAGGGTTAGGG

mixed type G4

As shown in Figure 2a, in the presence of different types of DNA, the absorption bands of CDs-TO at 480 nm decreased greatly and red-shifted to about 488 nm, which indicated that the self-interaction of TO on the surface of CDs was decreased because of the interaction of TO with DNA. Additionally, the absorption at 502 nm of CDs-TO showed significant red shift to 513 nm in the presence of DNA.



These results illustrated that TO on the CDs surface still have the ability to interact with DNA. To further evaluate the ratiometric fluorescent response of CDs-TO to various types of DNA, the fluorescence of the nanoprobe in the presence of different DNA were measured. As shown in Figure 2, in the absence of DNA, CDs-TO nanoprobe only showed the blue emission of CDs (2b, black line), did not show the TO fluorescence (2c, black line). When DNA was added to the CDs-TO solution, the emission of TO at 530 nm appeared (Figure 2c). Especially, distinct fluorescence enhancement was found upon addition of dsDNA (ssab) and parallel G4s (c-myc, c-kit2, pu22). Otherwise, ssDNA (ss1, ss2) and antiparallel G4s (TBA, 22AG Na+) only caused slight fluorescence increase, which may be due to the weak electrostatic interaction of TO with them. Similar results were obtained from single TO-COOH in the presence of different DNA (Figure S1), which indicated that the surface modification of TO on CDs did not affect its recognition ability for dsDNA and parallel G4s. Moreover, the emission of CDs in the nanoprobe was only changed slightly upon addition of various types of DNA (Figure 2b). And same results were obtained from the CDs in the presence of different DNA (Figure S2). These results suggest that CD is a better fluorescence reference unit and an excellent matrix for constructing ratiometric nanoprobe. The fluorescence intensity ratio (F530/F450) against different DNA was shown in Figure 2d. The ratios in the presence of dsDNA (ssab) and parallel G4s (c-myc, c-kit2, pu22) were much higher than that in the presence of ssDNA (ss1, ss2) and antiparallel G4s (TBA, 22AG Na+). 22AG K+, a mixed G4 type, caused a medium ratio between antiparallel and parallel G4s. These results indicate that the CDs-TO nanoprobe can be used for selective detection of dsDNA and parallel G4s.


Page 10 of 20

Page 11 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Absorption spectra (a), fluorescence spectra (b, c) and fluorescence intensity ratio (F530/F450) (d) of CDs-TO in the presence of different DNA (a, DNA, 30 µM; b, c, d, DNA, 1.5 µM; b, λex, 370 nm; c, λex, 490 nm).

Interference tests. In order to evaluate the specificity of CDs-TO for ratiometric fluorescence detection of dsDNA and G4s, some metal ions, nucleotides, and proteins were selected for the interference tests. As shown in Figure 3, the ratio of F530/F450 was almost not changed in the presence of the tested metal ions, nucleotides and proteins, which indicates that the prepared CDs-TO nanoprobe has the potential for ratiometric fluorescence determination of dsDNA and G4s in complex sample.



Figure 3. Fluorescence intensity ratio (F530/F450) of CDs-TO in the presence of different interfering species (Na+, 100 µM; other metal ions, 20 µM; ATP, GMP, cytosine, and thymine, 10 µM; HSA, 30 µM; BSA, 50 µM).

Binding mode to G4s. G4s mainly have two interaction sites with ligand molecules, including G-quartet and groove. End-stacking on G-quartet are the usually binding mode39-41. To investigate the binding mode, a G4/hemin peroxidase activity inhibition experiment by CDs-TO and TO-COOH was carried out. Hemin has been proved to bind parallel G4s through end-stacking. The G4/hemin complexes exhibit peroxidase activity, catalyzing oxidation of ABTS2+ to colored ABTS·- by H2O242. If other ligand molecules bind G4s at the same site, they will compete with hemin, leading to the inhibition of oxidation of ABTS2+ and resulting in the green product ABTS·- reduced. From the Figure 4, only parallel G4 c-myc showed strong peroxidase activity, antiparallel G4 TBA and dsDNA ssab didn’t have the peroxidase activity. However, the peroxidase activity of c-myc was significantly inhibited by not only TO-COOH, but also CDs-TO nanoprobe, indicating that TO bind to parallel G4s with an end-stacking mode. The immolization of TO on CDs did not affect the binding behavior of TO with DNA.

Figure 4. Inhibition of peroxidase activity of G4/hemin complexes by CDs-TO and TO-COOH.

The effect of CDs-TO nanoprobe on the conformation of G4s. Circular dichroism spectroscopy is a widely used tool for tracing conformational transition of G4s. C-myc exhibited typical circular dichroism signal of parallel G4 in Tris-HCl buffer (positive around 265 nm and negative around 240 nm); 22AG Na+ showed typical antiparallel G4 signal in Na+ buffer (positive around 295 nm and negative around 265 nm); and 22AG K+ showed mixed-type hybrid G4 signals in K+ buffer (positive around 295 nm and shoulder band around 265 nm)

43

(Figure 5a-c, black line). The addition of


Page 12 of 20

Page 13 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TO-COOH, CDs, and CDs-TO nanoprobe almost did not change the circular dichroism signals of these G4s (Figure 5a-c), suggesting that not only CDs-TO, but also TO-COOH and CDs did not affect the G4 conformations. It is well known that Na+ and K+ ions play important role in the formation of G4 structure, the effect of CDs, TO-COOH, and CDs-TO on G4s were further studied in Tris-HCl buffer without containing Na+ and K+. C-myc showed weaker circular dichroism signals of parallel G4 in Na+ and K+ free buffer (Figure 5d, black line). CDs did almost not change the circular dichroism signal of c-myc, whereas CDs-TO nanoprobe greatly enhanced the parallel G4 signals at about 260 nm and 240 nm (Figure 5d, cyanine line), and TO-COOH greatly enhanced the positive signal at about 260 nm (Figure 5d, red line), suggesting that CDs-TO can induce c-myc to form more compacted G4 structure. Otherwise, TBA (antiparallel G4) did not show typical circular dichroism signals in Na+ and K+ free buffer, and the addition of TO-COOH, CDs, and CDs-TO nanoprobe did not change the circular dichroism signals either (Figure 5e), suggesting that TBA did not interact with them.

Figure 5. Circular dichroism spectra of different G4 DNA in the absence and presence of TO-COOH, CDs, and CDs-TO nanoprobe. (a) c-myc, (b) 22AG Na+, and (c) 22AG K+ were mixed with TO-COOH, CDs, and CDs-TO nanoprobe at RT respectively; (d) c-myc, and (e) TBA were co-annealed with TO-COOH, CDs, and CDs-TO nanoprobe respectively in Na+ and K+ free Tris-HCl buffer.

Sensitivity for ssab and c-myc. The sensitivity of CDs-TO as a ratiometric fluorescent nanoprobe was investigated by the fluorometric titration of ssab and c-myc, respectively. The TO fluorescence intensity of the nanoprobe was remarkably enhanced along with the addition of ssab (Figure S3) and



c-myc (Figure S4) respectively, while the CDs fluorescence emission intensity at 450 nm of the nanoprobe was almost not changed in the presence of different concentration of ssab (Figure S5) or c-myc (Figure S6). The fluorescence ratio of F530/F450 increased significantly along with the increasing of ssab, and a plateau was arrived at the concentration of 1.0 µM (Figure 6a). A good linearity was obtained from 0.01 to 0.05 µM (Figure 6a, inset). The detection limit for ssab was calculated to be 0.90 nM according to the 3σ criterion. Moreover, similar result was obtained for a parallel G4, c-myc (Figure 6b). Unlikely, the fluorescence ratio of F530/F450 increased slower along with the increasing of c-myc than that of ssab. A plateau was obtained above the concentration of 2.5 µM, which may be due to the weaker interaction of TO with parallel G4 than dsDNA. Similarly, a good linearity was obtained from 0.01 to 0.25 µM (Figure 6b, inset), and a low detection limit of 3.31 nM for c-myc was obtained according to the 3σ criterion.

Figure 6. Fluorimetric titration of CDs-TO with different concentration of ssab (a, 0.01, 0.02, 0.03, 0.04, 0.05, 0.10, 0.15, 0.20, 0.25, 0.50, 0.75, 1.00, 1.25 and 1.50 µM), and c-myc (b, 0.01, 0.02, 0.03, 0.04, 0.05, 0.10, 0.15, 0.20, 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 2.0, 2.50 and 3.0 µM). Inset: corresponding linear fitting curve.


Page 14 of 20

Page 15 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Apparent equilibrium dissociation constants (Kd) between CDs-TO nanoprobe with different DNA. The fluorometric titration of CDs-TO with different DNA were further carried out, and the results were shown in Figure 7. Parallel G4s (c-myc, ps2.m, c-kit2, c-kit87, and pu22) and dsDNA (ssab) increased the ratio (F530/F450) of CDs-TO greatly with the rising of DNA concentration; whereas antiparallel G4s (Hum24, 22AG Na+) and ssDNA (ss1) almost did not increase the ratio. The apparent equilibrium dissociation constants (Kd) of CDs-TO nanoprobe with ssab, c-myc, ps2.m, c-kit2, c-kit87, and pu22 were calculated to be 0.1878±0.0221, 1.3331±0.0978, 0.4820±0.0365, 0.4415±0.0308, 1.3981±0.1013, and 0.5176±0.0706 µM, respectively. Additionally, the fluorometric titration of single TO with ssab. c-myc, and ps2.m were also carried out, and the Kd were calculated to be 0.7099±0.0350, 1.7943±0.1037, and 2.8354±0.1411 µM (Figure S7), respectively. The Kd of CDs-TO and single TO with ssab were less than that of the parallel G4s, which indicated that the affinity of TO intercalated into dsDNA is higher than that of end-stacking with parallel G4s. Moreover, the Kd of CDs-TO nanoprobe with DNA were lower than that of TO. The higher binding ability of CDs-TO nanoprobe may due to two reasons: (1) the high density of TO on the surface of CDs, (2) the interaction of the nanomaterials with DNA due to the unreacted amino group of CDs.

Figure 7. Fluorimetric titration curves of CDs-TO nanoprobe with different DNA.

Analysis of c-myc in serum samples. Cell free circulating DNA are useful markers of many diseases. To investigate the potential practical applicability of the ratiometric nanoprobe in complex samples, the detection of c-myc spiked in human serum was carried out. Typically, CDs-TO was incubated with human serum samples (1%) spiked with different concentrations of c-myc at RT in the dark. Then the fluorescence of CDs-TO was measured. The ratio of F530/F450 increased with the c-myc



concentration increasing (Figure S8). And good recoveries were obtained in three spiked levels (Table 2). These results indicated that the components in diluted serum do not affect the detection of c-myc, which suggest that the ratiometric nanoprobe, CDs-TO, has the potential for the detection of dsDNA and parallel G4s in crude DNA simply extracted from complex sample, such as cell lysate and serum. Table 2. Detection of c-myc spiked in human serum (n=3) sample

added (µM)

found (µM)

recovery (%)

1

0

not detected

-

2

0.05

0.0675 ± 0.0041

135.0 ± 8.19

3

0.10

0.1113 ± 0.0034

111.3 ± 3.43

4

0.15

0.1490 ± 0.0063

99.3 ± 4.21

CONCLUSIONS In summary, a CDs-based fluorescence nanoprobe for ratiometric detection of DNA was developed, in which CDs served as reference unit and TO acted as both recognition element and response unit. The CDs-TO nanoprobe showed high sensitivity and good selectivity for dsDNA and parallel G4s over ssDNA and antiparallel G4s. Some common metal ions, nucleotides and proteins did not interfere the detection. Circular dichroism spectra showed that CDs-TO, CDs, and TO-COOH did not affect the conformation of G4s. Additionally, CDs-TO was demonstrated to bind to the parallel G4s through end-stacking mode. Compared with single TO, the ratiometric nanoprobe, CDs-TO, showed stronger binding ability towards target DNA, and could eliminate the influence from instrumental factors and the concentration of probe. This CDs-based ratiometric detection strategy could be expanded to other targets through changing the specific recognition moieties. ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: Fluorescence spectra of TO-COOH in the presence of different DNA; Fluorescence spectra of CDs in the presence of different DNA; Fluorescence spectra of CDs-TO in the presence of different concentration of ssab and c-myc upon excitation at 490 nm; Fluorescence emission intensity at 450


Page 16 of 20

Page 17 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nm of CDs-TO in the presence of different concentration of ssab and c-myc upon excitation at 370 nm; Fluorimetric titration curves of TO with different DNA; Fluorescence ratio of F530/F450 of CDs-TO in the presence of different concentration of c-myc spiked in serum samples. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected], [email protected], [email protected]. Phone/fax: 86-10-62528509. ORCID Xiangjun Liu: 0000-0002-0119-2134 Dihua Shangguan: 0000-0002-5746-803X Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS We gratefully acknowledge the financial support from National Natural Science Foundation of China (21575147, 21535009, 21635008, 21705153, and 21621062). REFERENCES (1) Prodhomme, S.; Demaret, J. P.; Vinogradov, S.; Asseline, U.; Morin-Allory, L.; Vigny, P. A Theoretical and Experimental Study of Two Thiazole Orange Derivatives with Single- and Double-Stranded Oligonucleotides, Polydeoxyribonucleotides and DNA. J. Photochem. Photobiol. B 1999, 53, 60-69. (2) Hanafi-Bagby, D.; Piunno, P. A. E.; Wust, C. C.; Krull, U. J. Concentration Dependence of a Thiazole Orange Derivative That Is Used to Determine Nucleic Acid Hybridization by an Optical Biosensor. Anal. Chim. Acta 2000, 411, 19-30. (3) Lee, L. G.; Chen, C. H.; Chiu, L. A. Thiazole Orange - a New Dye for Reticulocyte Analysis. Cytometry 1986, 7 (6), 508-517. (4) Timtcheva, I.; Maximova, V.; Deligeorgiev, T.; Zaneva, D.; Ivanov, I. New Asymmetric Monomethine Cyanine Dyes for Nucleic-Acid Labelling: Absorption and Fluorescence Spectral Characteristics. J. Photochem. Photobiol. A 2000, 130 (1), 7-11. (5) Lubitz, I.; Zikich, D.; Kotlyar, A. Specific High-Affinity Binding of Thiazole Orange to Triplex and G-Quadruplex DNA. Biochemistry 2010, 49 (17), 3567-3574. (6) Mata, J. E.; Joshi, S. S.; Palen, B.; Pirruccello, S. J.; Jackson, J. D.; Elias, N.; Page, T. J.; Medlin, K. L.; Iversen, P. L. A Hexameric Phosphorothioate Oligonucleotide Telomerase Inhibitor Arrests Growth of Burkitt's Lymphoma Cells in Vitro and in Vivo. Toxicol. Appl. Pharmacol. 1997, 144 (1), 189-197. (7) Nygren, J.; Svanvik, N.; Kubista, M. The Interactions between the Fluorescent Dye Thiazole Orange and DNA. Biopolymers 1998, 46 (1), 39-51. (8) Vikesland, P. J.; Wigginton, K. R. Nanomaterial Enabled Biosensors for Pathogen Monitoring - A Review. Environ. Sci. Technol. 2010, 44 (10), 3656-3669.



(9) Alivisatos, P. The Use of Nanocrystals in Biological Detection. Nat. Biotechnol. 2004, 22 (1), 47-52. (10) Karthik, S.; Saha, B.; Ghosh, S. K.; Singh, N. D. P. Photoresponsive Quinoline Tethered Fluorescent Carbon Dots for Regulated Anticancer Drug Delivery. Chem. Commun. 2013, 49 (89), 10471-10473. (11) Lim, E. K.; Kim, T.; Paik, S.; Haam, S.; Huh, Y. M.; Lee, K. Nanomaterials for Theranostics: Recent Advances and Future Challenges. Chem. Rev. 2015, 115 (1), 327-394. (12) Qiao, S.; Fan, B. H.; Yang, Y. M.; Liu, N. Y.; Huang, H.; Liu, Y. Copper Nanoparticle/Carbon Quantum Dots Hybrid as Green Photocatalyst for High-Efficiency Oxidation of Cyclohexane. Rsc Adv. 2015, 5 (54), 43058-43064. (13) Liu, R. H.; Liu, J.; Kong, W. Q.; Huang, H.; Han, X.; Zhang, X.; Liu, Y.; Kang, Z. H. Adsorption Dominant Catalytic Activity of a Carbon Dots Stabilized Gold Nanoparticles System. Dalton Trans. 2014, 43 (28), 10920-10929. (14) Qian, Z. S.; Chai, L. J.; Tang, C.; Huang, Y. Y.; Chen, J. R.; Feng, H. Carbon Quantum Dots-Based Recyclable Real-Time Fluorescence Assay for Alkaline Phosphatase with Adenosine Triphosphate as Substrate. Anal. Chem. 2015, 87 (5), 2966-2973. (15) Liu, X. J.; Zhang, N.; Bing, T.; Shangguan, D. H. Carbon Dots Based Dual-Emission Silica Nanoparticles as a Ratiometric Nanosensor for Cu2+. Anal. Chem. 2014, 86 (5), 2289-2296. (16) Guo, Y. M.; Zhang, L. F.; Cao, F. P.; Leng, Y. M. Thermal Treatment of Hair for the Synthesis of Sustainable Carbon Quantum Dots and the Applications for Sensing Hg2+. Sci. Rep. 2016, 6, 35795. (17) Wang, L.; Zhou, H. S. Green Synthesis of Luminescent Nitrogen-Doped Carbon Dots from Milk and Its Imaging Application. Anal. Chem. 2014, 86 (18), 8902-8905. (18) Yang, S. T.; Cao, L.; Luo, P. G. J.; Lu, F. S.; Wang, X.; Wang, H. F.; Meziani, M. J.; Liu, Y. F.; Qi, G.; Sun, Y. P. Carbon Dots for Optical Imaging in Vivo. J. Am. Chem. Soc. 2009, 131 (32), 11308-11309. (19) Wang, Q. L.; Huang, X. X.; Long, Y. J.; Wang, X. L.; Zhang, H. J.; Zhu, R.; Liang, L. P.; Teng, P.; Zheng, H. Z. Hollow Luminescent Carbon Dots for Drug Delivery. Carbon 2013, 59, 192-199. (20) Yang, L.; Wang, Z. R.; Wang, J.; Jiang, W. H.; Jiang, X. W.; Bai, Z. S.; He, Y. P.; Jiang, J. Q.; Wang, D. K.; Yang, L. Doxorubicin Conjugated Functionalizable Carbon Dots for Nucleus Targeted Delivery and Enhanced Therapeutic Efficacy. Nanoscale 2016, 8 (12), 6801-6809. (21) Feng, T.; Ai, X. Z.; An, G. H.; Yang, P. P.; Zhao, Y. L. Charge-Convertible Carbon Dots for Imaging-Guided Drug Delivery with Enhanced in Vivo Cancer Therapeutic Efficiency. Acs Nano 2016, 10 (4), 4410-4420. (22) Yu, C. M.; Li, X. Z.; Zeng, F.; Zheng, F. Y.; Wu, S. Z. Carbon-Dot-Based Ratiometric Fluorescent Sensor for Detecting Hydrogen Sulfide in Aqueous Media and Inside Live Cells. Chem. Commun. 2013, 49 (4), 403-405. (23) Gao, X.; Ding, C. Q.; Zhu, A. W.; Tian, Y. Carbon-Dot-Based Ratiometric Fluorescent Probe for Imaging and Biosensing of Superoxide Anion in Live Cells. Anal. Chem. 2014, 86 (14), 7071-7078. (24) An, Z.; Li, Z. X.; He, Y. Y.; Shi, B. J.; Wei, L. H.; Yu, M. M. Ratiometric Luminescence Detection of Hydrazine with a Carbon Dots-Hemicyanine Nanohybrid System. Rsc Adv. 2017, 7 (18), 10875-10880. (25) Fei, X. N.; Li, R.; Lin, D. Y.; Gu, Y. C.; Yu, L. Spectra, Stability and Labeling of a Novel Carbazole Derivative as a Fluorescent Turn-on DNA Probe. J. Fluoresc. 2015, 25 (5), 1251-1258. (26) Xiang, J. F.; Liu, Y. X.; Sun, D.; Zhang, S. J.; Fu, Y. L.; Zhang, X. H.; Wang, L. Y. Synthesis, Spectral Properties of Rhodanine Complex Merocyanine Dyes as well as Their Effect on K562 Leukemia Cells. Dyes Pigments 2012, 93, 1481-1487. (27) Watkins, D.; Ranjan, N.; Kumar, S.; Gong, C. J.; Arya, D. P. An Assay for Human Telomeric G-Quadruplex DNA Binding Drugs. Bioorg. Med. Chem. Lett. 2013, 23 (24), 6695-6699. (28) Bourlinos, A. B.; Stassinopoulos, A.; Anglos, D.; Zboril, R.; Karakassides, M.; Giannelis, E. P. Surface Functionalized Carbogenic Quantum Dots. Small 2008, 4 (4), 455-458.


Page 18 of 20

Page 19 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29) Wang, F.; Pang, S. P.; Wang, L.; Li, Q.; Kreiter, M.; Liu, C. Y. One-Step Synthesis of Highly Luminescent Carbon Dots in Noncoordinating Solvents. Chem. Mater. 2010, 22 (16), 4528-4530. (30) Wang, B. G.; Song, A. X.; Feng, L.; Ruan, H.; Li, H. G.; Dong, S. L.; Hao, J. C. Tunable Amphiphilicity and Multifunctional Applications of Ionic-Liquid-Modified Carbon Quantum Dots. Acs Appl. Mater. Inter. 2015, 7 (12), 6919-6925. (31) Lim, S. Y.; Shen, W.; Gao, Z. Q. Carbon Quantum Dots and Their Applications. Chem. Soc. Rev. 2015, 44 (1), 362-381. (32) Phan, A. T.; Kuryavyi, V.; Gaw, H. Y.; Patel, D. J. Small-Molecule Interaction with a Five-Guanine-Tract G-Quadruplex Structure from the Human MYC Promoter. Nat. Chem. Biol. 2005, 1 (4), 234-234. (33) Lin, S.; Wang, W.; Hu, C.; Yang, G.; Ko, C. N.; Ren, K.; Leung, C. H.; Ma, D. L. The Application of a G-Quadruplex Based Assay with an Iridium(III) Complex to Arsenic Ion Detection and Its Utilization in a Microfluidic Chip. J. Mater. Chem. B 2017, 5, 479-484. (34) Wang, M.; Mao, Z.; Kang, T. S.; Wong, C. Y.; Mergny, J. L.; Leung, C. H.; Ma, D. L. Conjugating a Grrove-Binding Motif to an Ir(III) Complex for the Enhancement of G-Quadruplex Probe Behavor. Chem. Sci. 2016, 7, 2516-2523. (35) Martino, L.; Virno, A.; Randazzo, A.; Virgilio, A.; Esposito, V.; Giancola, C.; Bucci, M.; Cirino, G.; Mayol, L. A New Modified Thrombin Binding Aptamer Containing a 5'-5' Inversion of Polarity Site. Nucleic Acids Res. 2006, 34 (22), 6653-6662. (36) He, Y.; Neumann, R. D.; Panyutin, I. G. Intramolecular Quadruplex Conformation of Human Telomeric DNA Assessed with 125I-Radioprobing. Nucleic Acids Res. 2004, 32 (18), 5359-5367. (37) He, Y.; Panyutin, I. G.; Karavanov, A.; Demidov, V. V.; Neumann, R. D. Sequence-Specific DNA Strand Cleavage by 111In-Labeled Peptide Nucleic Acids. Eur. J. Nucl. Med. Mol. Imaging 2004, 31 (6), 837-845. (38) Rachwal, P. A.; Brown, T.; Fox, K. R. Sequence Effects of Single Base Loops in Intramolecular Quadruplex DNA. FEBS Lett. 2007, 581 (8), 1657-1660. (39) Nikan, M.; Di Antonio, M.; Abecassis, K.; McLuckie, K.; Balasubramanian, S. An Acetylene-Bridged 6,8-Purine Dimer as a Fluorescent Switch-on Probe for Parallel G-Quadruplexes. Angew. Chem., Int. Edit. 2013, 52 (5), 1428-1431. (40) Dai, J. X.; Carver, M.; Hurley, L. H.; Yang, D. Z. Solution Structure of a 2:1 Quindoline-c-MYC G-Quadruplex: Insights into G-Quadruplex-Interactive Small Molecule Drug Design. J. Am. Chem. Soc. 2011, 133 (44), 17673-17680. (41) Li, T.; Wang, E. K.; Dong, S. J. Parallel G-Quadruplex-Specific Fluorescent Probe for Monitoring DNA Structural Changes and Label-Free Detection of Potassium Ion. Anal. Chem. 2010, 82 (18), 7576-7580. (42) Cheng, X. H.; Liu, X. J.; Bing, T.; Cao, Z. H.; Shangguan, D. H. General Peroxidase Activity of G-Quadruplex-Hemin Complexes and Its Application in Ligand Screening. Biochemistry 2009, 48 (33), 7817-7823. (43) Wu, S.; Wang, L.; Zhang, N.; Liu, Y.; Zheng, W.; Chang, A.; Wang, F.; Li, S.; Shangguan, D. A Bis(methylpiperazinylstyryl)phenanthroline as a Fluorescent Ligand for G-Quadruplexes. Chem. Eur. J. 2016, 22, 6037-6047.



For TOC


Page 20 of 20

Thiazole orange modified carbon dots for ratiometric fluorescence

Recommend Documents