Time-Resolved Tracking of Separately Internalized Neuropeptide Y2

Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE

Article

Time-Resolved Tracking of Separately Internalized Neuropeptide Y Receptors by Two-Color Pulse-Chase 2

Jonathan Lotze, Philipp Wolf, Ulrike Reinhardt, Oliver Seitz, Karin Mörl, and Annette G. Beck-Sickinger ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/acschembio.7b00999 • Publication Date (Web): 21 Dec 2017 Downloaded from http://pubs.acs.org on December 23, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

Time-Resolved Tracking of Separately Internalized Neuropeptide Y2 Receptors by Two-Color Pulse-Chase Jonathan Lotze1, Philipp Wolf1, Ulrike Reinhardt2, Oliver Seitz2, Karin Mörl1, Annette G. Beck-Sickinger1,* 1

Institute of Biochemistry, Leipzig University, 04103 Leipzig, Germany

2

Institute of Chemistry, Humboldt-University Berlin, 12489 Berlin, Germany

*

Author of correspondence ([email protected])

Dedicated to Professor Manfred Mutter on the occasion of his 75th birthday.

Key words: GPCR, Neuropeptide Y, Internalization, Pulse-Chase, Fluorescence labeling, Chemoselective labeling

Abbreviations: eYFP – enhanced yellow fluorescend protein, GPCR – G protein-coupled receptor, hY2R – human neuropeptide Y2 receptor, pNPY – porcine neuropeptide Y, GRK – G protein-coupled receptor kinase, MAPK – mitogen-activated protein kinase, TAMRA – 5(6)-tetramethylrhodamine, TGN – trans-Golgi network, LDAI - ligand-directed acyl imidazole

ACS Paragon Plus Environment

ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Internalization and intracellular trafficking of G protein-coupled receptors (GPCR) plays an important role in the signal transduction. These processes are often highly dynamic and take place rapidly. In the past ten years, it became obvious that internalized GPCRs are also capable to signal via arrestin or heterotrimeric G proteins within the endosomal compartment. Real-time imaging of receptors in living cells can help to evaluate the temporal and spatial localization. We achieved a two-color pulse-chase labeling approach, which allowed the tracking of the human neuropeptide Y2 receptor (hY2R) in the same cell at different times. The ability to visualize the internalization pathway of two separately labeled and separately stimulated subsets of hY2R in a time-resolved manner revealed a rapid trafficking. Fusion of the two hY2R subsets was already observed ten minutes after stimulation in the early endosomal compartment without subsequent separation of the fused receptor populations. The results demonstrate that the cells do not discriminate between receptors that were stimulated and internalized at different time points.


Page 2 of 30

Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION G protein-coupled receptors (GPCR) form the largest family of cell surface receptors in humans with ~800 members und are involved in diverse physiological processes, e.g. behavioral and mood responses, the visual system, the sense of taste and smell, inflammatory processes and the regulation of food intake (1-5). This class of receptors signals primarily via heterotrimeric G proteins. For many receptors, a subsequent internalization into the endosomal compartment takes place in an arrestin-dependent manner. Within this process, GPCR kinases (GRKs) phosphorylate specific recognition sequences within the intracellular site of the activated GPCR. The phosphorylated residues serve as binding sites for arrestin, an adapter protein which is recognized by key components of the endocytic machinery such as the AP-2 complex and clathrin. These proteins facilitate the internalization of many GPCRs like the human neuropeptide Y2 receptor (hY2R) into the early endosome (6). The internalization leads to desensitization of the G protein signaling at the cell surface, but also links the GPCR to further signaling pathways like the MAPK cascade, which can be mediated by the co-internalized arrestin. Depending on the physiological function of the GPCR a fast recycling back to the cell surface or a slow recycling through the recycling endosome or the late endosome and trans-Golgi network (TGN) is possible. Alternatively, some GPCRs are degraded after transport into the lysosome (7). In case of the hY2R, the majority of internalized receptors is able to recycle back to the cell surface as soon as the agonist is removed from the cells (8, 9). Despite the important role of this receptor in central and peripheral diseases such as epilepsy, little is known about the dynamics of the intracellular trafficking (10, 11). Currently, there is a controversial debate on the vesicular trafficking of subsequently internalized GPCRs. The question is whether subsequently internalized receptors gather in pool-like structures or are treated separately by the cell. It has been shown, that internalized GPCRs are able to activate additional signal transduction pathways, e.g. MAP kinases, cAMP signal cascades or heterotrimeric G proteins within the endosomal compartment (12, 13). Thus, a detailed insight into the dynamics of the intracellular trafficking will help to unravel the biology of the hY2R receptor furthermore. Pulse-chase type experiments provide the opportunity to study the internalization of distinct receptor subsets. In such an experiment, the two subsets are distinguished by different fluorescent labels, i.e. the pulse-label and the chase-label. As the hY2R is a fast internalizing receptor (9), the speed of chase labeling limits the time window of the pulse-chase analysis. ACS Paragon Plus Environment


Recently, we developed a new peptide-templated labeling technique, which enables the rapid transfer of a low molecular fluorophore to a GPCR in living cells within minutes (14, 15). The labeling is based on a de novo designed E3/K3 coiled-coil peptide (16, 17). The E3 peptide contains an N-terminal cysteine and is fused to the extracellular N-terminus of the GPCR whereas the K3 peptide is linked to a fluorescent probe by a highly reactive thioester. The coiled-coil formation induces an acyl transfer upon close proximity between the thioester and the cysteine residue, by which the fluorescent probe is covalently transferred onto the receptor (Scheme 1). The high specificity and speed of the transfer reaction as well as the small tag size are essential prerequisites for the setup of a two-color pulse-chase experiment to study the internalization of separately stimulated hY2R (14, 15). By using two differently labeled K3-peptides with different fluorophores, we tested two alternative scenarios in receptor trafficking: hypothesis A assumes the fusion of pulse- and chase-labeled hY2R in vesicles within the time course of the study; hypothesis B assumes the complete separate trafficking of the two hY2R subsets (Scheme 2).


Page 4 of 30

Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS AND DISCUSSION Set-up of the Pulse Experiment This setup contains the initial labeling of unstimulated receptors at the cell surface with the TAMRA-K3 probe, which is further on named as the pulse-label. This labeling is followed by the first stimulation by incubating the system with the endogenous ligand porcine neuropeptide Y (pNPY) to induce the internalization of the receptors. Depending on the duration and concentration of the agonist, not all receptors are internalized. The remaining receptors, if not labeled by the pulse can next be treated with the ATTO488-K3 probe, which is the chase-label. At this time, the pulse-labeled hY2R represent the stimulated state, whereas the chase-labeled hY2R represent the unstimulated state. The two-color pulse-chase experiment requires that the chase labeling reaction succeeds after pulse labeling has been performed because receptors that remained on the surface after internalization was triggered should be available for the chase label. To assess the efficiency of pulse and chase labeling on living cells and to optimize the set-up we submitted HEK293 cells expressing Cys-E3-hY2R-eYFP fusion proteins to labeling reaction with the TAMRAcharged K3 peptide and measured the TAMRA/eYFP fluorescence ratio by means of flow cytometry. To determine transfer efficiency in the chase-set up we used a biotin-charged K3 peptide as a pulse and the TAMRA-bearing K3 probe for chase labeling. The mean fluorescence was normalized to the transfection efficiency after subtraction of the background. An average TAMRA/eYFP percentage of 37 ± 0.5 % was observed for the pulse labeling and 29 ± 13.1 % for the chase labeling in transiently transfected HEK293 cells, expressing the E3-hY2R-eYFP (Figure 1A). We conclude that the pulse and the chase labeling reaction proceed in comparable yields.

The two-color pulse-chase experiment served the purpose to follow the fate of the labeled hY2R after endocytic uptake. A final concentration of 500 nM pNPY was identified to keep the internalization rate in the range to be followed (Figure 1B, unstimulated). As the hY2R is a fast internalizing receptor (9), a suitable timeframe for the first stimulation and internalization period of pulse-labeled receptors needed to be identified. HEK293-E3-hY2R cells were pulselabeled with the TAMRA-K3 probe and the stimulation was induced by incubating the cells ACS Paragon Plus Environment


with 500 nM pNPY. Unstimulated cells showed a distinct distribution of pulse-labeled hY2R at the cell surface (Figure 1B). After 15 min stimulation, a considerable number of receptors was already internalized as seen by fluorescent vesicles inside the cells. However, the remaining fluorescence signal at the cell surface represented still a remarkable number of receptors. Images after 30 min stimulation revealed that the majority of hY2R was localized inside the cells. Pulse-labeled receptors at the cell surface could barely be recognized anymore. The same holds true for images after 45 and 60 min stimulation as the number of vesicles did not increase remarkably. Therefore, the first stimulation of the pulse-chase experiment was set to 30 min to keep the timeframe as short as possible.

Set-up of the Chase Experiment The second stimulation leads to the internalization of the chase-labeled receptors. The two different subsets of hY2R can now be followed in a time-resolved manner. An important prerequisite for the two-color pulse-chase experiment is the ability to label remaining receptors at the cell surface after a preceding stimulation. Studies with stably transfected HEK293 cells expressing the E3-tagged hY2R revealed a successful labeling after prior stimulation with the hY2R agonist pNPY for 60 min (Figure 2). Cells stimulated with 100 nM pNPY revealed a much higher labeling yield, representing a greater number of receptors at the surface, compared to cells that were exposed to 1 µM pNPY, because the high pNPY concentration lead to a stronger internalization in the first step and reduced number of receptors at the cell surface. A further relevant prerequisite is the ability to activate the remaining receptors. Therefore, the cells were treated a second time with the respective agonist concentration after labeling. The increasing number of fluorescent vesicles inside the cells represented the pNPY-induced internalization of hY2R and demonstrated the capability of the remaining receptors to be stimulated. The internalization rate was also dependent on the agonist concentration and confirms the previous observation that cells treated with 100 nM pNPY internalize to a much lower extent than cells treated with 1 µM pNPY.

Two-Color Pulse-Chase Studies with hY2R The two-color pulse-chase experiment was performed to track the labeled hY2R. First, a specific amount of hY2R at the cell surface was pulse-labeled with TAMRA-K3 probe (red, Figure 3A). Prior to the pNPY treatment the unstimulated receptors are exclusively located in the cell membrane. After the first stimulation with pNPY for 30 min and subsequent chase-


Page 6 of 30

Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


labeling with ATTO488-K3 probe (green) of the remaining hY2R at the cell surface, the two subsets of receptors can be clearly separated from each other (Figure 3B). Pulse-labeled receptors were internalized as seen by the red fluorescent vesicles inside the cells, whereas chase-labeled receptors were only localized in the cell membrane as seen in green. The second stimulation with pNPY induced the internalization of chase-labeled hY2R and was monitored for the next 120 min. Vesicles containing chase-labeled receptors were detected already after five minutes. At this time pulse- and chase-labeled hY2R could still be distinguished from each other (Figure 3C). Vesicles containing the pulse-label (red) only represent receptors which were internalized during the first stimulation while chase-labeled vesicles (green) represent receptors which internalized during the second stimulation. Interestingly, the distribution changed over time. The number of vesicles containing pulse-labeled hY2R only decreased, whereas the number of chase-labeled vesicles increased. Moreover, a considerable co-localization of pulse- and chase-labeled hY2R was identified as seen in the overlay images by the yellow staining of vesicular structures (Figure 3D). The co-localization was the first evidence that pulse- and chase-labeled vesicles fuse over time. This trend continued and an almost complete co-localization of pulse- and chase-labeled receptors was detected 30 min after the second stimulation (Figure 3E) Vesicles containing the pulse-label exclusively were detected only occasionally. As we are interested in the dynamics of GPCR internalization, we chose the hY2R because of its high relevance in biology. Two scenarios for the separately stimulated hY2R subsets are conceivable: the fusion of the vesicles that contain pulse- and chase-labeled receptors after internalization (hypothesis A) or the separate traveling of the vesicles with the receptors during the whole trafficking process (hypothesis B, see Scheme 2). Microscopy studies revealed a distinct discrimination of pulse- and chase-labeled hY2R just before the second stimulation. These two separated hY2R subsets could still be observed during the first phase of the second stimulation and displayed a separate trafficking in different vesicles. However, the discrete distribution was maintained only for a short period of time as co-localization of pulse- and chase-labeled hY2R was observed already after 10–12 min, which indicates the vesicle fusion. In addition, no separation of the receptor subpopulations was observable after vesicular fusion during the monitoring time of 120 min after the chase-labeling with the ATTO488 dye and second stimulation with 500 nM pNPY (Figure 4C). The fate of the fluorescence after 2 h is due to bleaching and fluorophore degradation.

Quantification of Two-Color Pulse-Chase Studies



Next, the microscopic images were quantified. The fusion of vesicles was measured by creating a mask based on the pulse-labeled images. The fluorescence intensity under the area of the mask was measured separately for the pulse- and the chase-label. The selected area was included in the calculation to compare the images as they do not always contain the same number and size of cells. The quantification of pulse-labeled vesicles revealed no significant changes over time (Figure 4A). The constant fluorescence intensity indicates that the pulselabeled receptors, which internalized during the first stimulation remained in vesicular structures and are not degraded. In contrast, measurements of the chase-labeled images display a significant increase in fluorescence. Before any chase-labeled receptors were stimulated and internalized only a very low background signal was determined. As soon as the second stimulation was applied the fluorescence intensity of the chase-label increased. This increase was strongest in the first 10–12 min and was detected to only a small amount at the end of the pulse-chase. As the area of the measurement was based on pulse-labeled vesicles the increase in fluorescence intensity of the chase-label implies the fusion of the two receptor subsets. This data is in agreement with the microscopic observation where pulse- and chase-labeled vesicles could be distinguished during the early phase of the second stimulation. Later on, this discrimination was not possible anymore, instead an increasing colocalization of the two different labels was observed as a result of the fusion (Figure 3). The determined values for the pulse- and chase-label intensity were also used to calculate a pulse/chase ratio. The increasing intensity of chase-labels under the area of pulse-labeled vesicles led to a decrease in the ratio and highlights once more that the majority of the fusion occurs already in the first 10–12 min after the second stimulation (Figure 4B). The decrease in the ratio for each timeframe was significant. Even the comparison of the ratio for 5–7 and 28– 30 min after stimulation revealed a significant decrease. To ensure that no degradation of pulse- or chase-labeled receptors took place during the time course of the study, which would influence the calculated ratios and their significance, the overall fluorescence was determined for each image. In case of both labels no significant loss in the fluorescence intensity could be detected and supports the validity of the calculated pulse/chase ratios (Figure 5). Only very few two-color pulse-chase experiments have been described so far. SNAP- (18), Halo- (19, 20) or tetracysteine-tags (21-23) are capable to bind different fluorescent probes and therefore enable a two-color visualization. Further approaches include the tagindependent ligand-directed acyl imidazole (LDAI) chemistry (24) and the BL-tag, which is able to discriminate proteins at the cell surface and inside the cell by labeling probes that differ in their cell membrane permeability (25). These approaches provide great tools to


Page 8 of 30

Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


visualize protein dynamics. However, tags like the SNAP-, CLIP- and BL-tag are considerably big in size, which entails the potential risk to influence the characteristics of the protein of interest. Furthermore, many studies distinguish between already expressed proteins (pulse-label) and newly translated proteins (chase-label) (18, 19, 21, 23). This implies a considerable time gap between pulse- and chase-label. Labeling periods, ranging from 3 h for the LDAI approach (24) to 15 min for the Halo- (20) or tetracysteine-tag (23) permit timedependent studies with 0.5 h as the shortest timeframe. Our new two-color pulse-chase approach based on peptide-templated transfer chemistry allows the investigation of rapid, highly dynamic processes as the required labeling time is only 5-6 min. In our experiments, most of the green, chase-labeled vesicles contained a very weak red fluorescence as well. The red fluorescence is caused by the small number of pulse-labeled receptors that did not internalize during the first stimulation and remained at the cell surface as it can be seen 30 min after the first stimulation in the pulse-labeled images (Figure 3). These pulse-labeled receptors internalized together with the chase-labeled receptors during the second stimulation and induced the very slight increase in the measured fluorescence intensity of the pulse-label after 5–7 min during the second stimulation (Figure 4A). Nevertheless, this behavior did not compromise the experiment and the ability to distinguish between the two subsets of hY2R. First, because the exclusive pulse-labeled vesicles were a clear indicator for the evaluation of the experiment and secondly, the fusion of pulse- and chase-labeled vesicles could be quantified with high significance (Figure 4).

Localization of Pulse- and Chase-labeled hY2R within the Endosome To characterize the spatial distribution of the internalized hY2R, additional endosomal markers were transiently transfected into HEK293-E3-hY2R cells. The early endosome is the first compartment in the agonist-dependent internalization for many GPCRs and can be marked with the small GTPase Rab4 (26). Rab4 was fused to the cyan fluorescent protein (CFP) to visualize the early endosomal vesicles. The pulse-labeled receptors in the unstimulated state were only located at the cell surface and exhibited no co-localization with Rab4 (Figure 6A). After the first stimulation for 30 min and the chase-labeling a clear internalization of pulse-labeled hY2R was observed in red, whereas chase-labeled hY2R in green were still located at the cell surface. Now, partial co-localization of pulse-labeled hY2R with Rab4 could be determined, which demonstrates the trafficking of the receptors into the early endosome. After the second stimulation, the chase-labeled hY2R was internalized as well. Transport into the early endosome was already seen ten minutes after stimulation. To



investigate whether the internalized hY2R are directly sorted from the early endosome to the recycling endosome during the pulse-chase experiment, the small GTPase Rab11 was used as a further marker protein. The pulse-chase experiment was carried as described above except of the exchange of Rab4 by Rab11. The spatial and temporal localization of the pulse- and chase-labeled receptors were comparable to the observations seen above. However, only very few pulse-labeled hY2R seemed to co-localize with Rab11-positiv structures (Figure 6B). After the second stimulation, which induced the internalization of chase-labeled hY2R a distinct co-localization with Rab11 could still not be observed. Thus, the internalized receptors stay in the early or sorting endosome for the whole period of internalization conditions and not further trafficking is recognized. The fusion of the vesicles took place within the early endosome as identified by colocalization with the small GTPase Rab4. Trafficking into the early endosome is common for many GPCRs (27-31). For the hY2R it is also known that the majority of receptors recycles back to the cell surface after removal of the ligand (8, 9). In general, recycling of GPCRs can take place directly from the early endosome (fast) or by passing the recycling endosome (slow). The small GTPase Rab4 is involved in the fast recycling from the early endosome, whereas the small GTPase Rab11 coordinates the transport to the recycling endosome and back to the cell membrane (32). Furthermore, it is reported that Rab11 is involved in the vesicular transport from the TGN to the recycling endosome, which is described as additional recycling pathway (27, 29, 33). The obviously missing co-localization of hY2R with Rab11positiv vesicles during the considered timeframe of the pulse-chase suggests that the majority of internalized receptors was still localized in subcellular compartments before the recycling endosome. The strong co-localization with Rab4 demonstrates the sorting of the hY2R into vesicles inside the early endosome, which are designated for a fast recycling back to the cell surface. This observation is supported by the fact that the hY2R recycles back to the cell surface within 30 min after ligand removal (9). Furthermore, the fusion of pulse- and chaselabeled hY2R indicate no further discrimination by the cells regarding the recycling trafficking. As the endosomal transport is very dynamic, a partial overlap of endosomal particles containing Rab4 and Rab11 is described (34) and explains the very minor colocalization of the different labeled hY2R subsets with Rab11.


Page 10 of 30

Page 11 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CONCLUSION Tracking cellular transport pathways in a time-resolved manner is crucial to understand dynamics in biology. Pulse-chase experiments are a suitable approach for studying such processes. We developed a rapid and highly selective labeling technique by using the E3/K3 coiled-coil-mediated acyl transfer (14, 15), which offers all prerequisites for pulse-chase experiments with two different fluorescent labels and very short timeframes. We demonstrated the ability to study fast dynamics in GPCR trafficking, which uncovers an entire new field for research. Such insights provide valuable information as GPCR internalization has not only a desensitizing function, but rather links GPCRs to additional signaling pathways like the MAP kinase or cAMP signaling (35). Moreover, evidence was found that supports a separate heterotrimeric G protein signaling from within the endosome (36). Many receptor families display also a subtype-specific mechanism regarding the cellular trafficking like the hY5R, which possess a very slow internalization rate in contrast to the hY2R (8). Another example is the endothelin receptor A, which is able to recycle after internalization, whereas the endothelin receptor B is degraded in the lysosome (37). Even modified ligands can influence the trafficking of GPCRs as demonstrated for lipidated or PEGylated pancreatic polypeptide analogues that enhanced or blocked the internalization of selected neuropeptide Y receptors (38). This illustrates the complexity of cellular trafficking and signaling of GPCRs and the need to investigate the trafficking dynamics in great detail to understand the biology. In case of the hY2R, we could demonstrate that separately internalized receptor subsets gather in a pool-like structure within the early endosome. Pulse- and chase-labeled receptors could be discriminated during the first five to ten minutes followed by fusion of the different vesicles in Rab4-positiv vesicles, which are responsible for fast recycling processes. Recycling experiments with pulse- and chase-labeled receptors in the future will help to investigate this receptor furthermore.



METHODS Plasmid Construction The cDNA of hY2R was cloned into the eukaryotic expression vector pVitro2-hygro-mcs (InvivoGen). Fusion of the cysteine-E3-tag to the N-terminus of the hY2R was achieved by overlap-extension PCR with PCRBIOHifi-Polymerase (PCRBIOSYSTEMS). The forward primer contained a MluI restriction site at the 5′ end, followed by the genetically encoded cysteine-E3-tag with a short glycine-glycine-serine linker. The 3′ end contained a 22 base pair long overlapping sequence with the N-terminal site of the receptor. Sequence of forward primer for hY2R: 5’–AAACCACGCGTGCCACCATGTGCGAGATCGCCGCCCTGGAGAAGGAGATCGC CGCCCTGGAGAAGGAGATCGCCGCCCTGGAGAAGGGCGGCTCAATGGGTCCAAT AGGTGCAGAGG–3’ The reverse primer contained an 18-base-pair-long sequence of the hY2R C-terminus followed by a stop codon and a BSP1407I restriction site. Sequence of reverse primer for hY2R: 5’–CGGCCGCTTTACTTGTACATTAGACATTGGTAGCCTCTGT–3’ After digestion of the PCR products with the restrictions enzymes MluI and Bsp1407I, ligation in the equally digested pVitro2-hygro-mcs vector was performed. The cDNA of the human Rab4a was generously provided by M. Zerial (MPI of Molecular Cell Biology and Genetics, Dresden, Germany) and cloned into the pECFP-C1 (Clontech) using BglII and SalI restriction sites. The human Rab11a-CFP plasmid was a kind gift of R. Schülein (Leibniz-Institut of Molecular Pharmacology, Berlin, Germany). Construction of the E3-hY2R-eYFP-coding plasmid was performed as described earlier (15).

Cell Culture, Generation of Stable Cell Line and Transfection Cell culture materials were supplied by LONZA (Lonza Group Ltd.), except of fetal calf serum (FCS), which was supplied by Biochrom (Biochrom AG) and Hygromycin B, which ACS Paragon Plus Environment

Page 12 of 30

Page 13 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was supplied by InvivoGen. Ethylenediaminetetraacetic acid (EDTA) was purchased from Sigma Aldrich. HEK293 (human embryonic kidney cells) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 4.5 g L-1 glucose and HAMsF12 containing L-glutamine (1:1 v/v), supplied with 15 % (v/v) heat-inactivated FCS. Stably transfected HEK293-E3-hY2R cells were cultured in DMEM with 4.5 g L-1 glucose and HAMsF12 containing L-glutamine (1:1 v/v), supplied with 15 % (v/v) heat-inactivated FCS and 200 µg ml-1 Hygromycin B. Cells were grown as monolayers at 37 °C, 5 % CO2, and 95 % humidity. Generation of stable cell line Plasmid containing the cDNA of E3-tagged hY2R was linearized with restriction enzymes NheI or XhoI. HEK293 cells were cultured in 25 cm2 flasks. Transfection was performed with linearized plasmid DNA and LipofectaminTM 2000 (Invitrogen GmbH), as recommended by the manufacturer. For each cell culture flask 13 µg of linearized plasmid DNA and 20 µl LipofectaminTM 2000 in OptiMEM were used. HEK293 cells were incubated for 1 h with transfection mix at 37 °C. Next, cells were cultured in cell culture medium for two days before the selection of stably transfected cells was started by adding Hygromycin B to the medium (200 µg ml-1). Positive clones expressing E3-tagged hY2R were detected by peptidetemplated acyl transfer.

Cells for live cell fluorescence microscopy Stably transfected HEK293-E3-hY2R cells were seeded out into 8-well µ-slides (ibid GmbH), which were prior coated with poly-D-lysine (0.01 % w/v in DPBS w/o Ca2+ and Mg2+) and grown to 90 % confluence overnight. Labeling and microscopic studies were performed on the next day. For co-transfection with Rab4-CFP or Rab11-CFP stably transfected HEK293-E3-hY2R cells were seeded out into 8-well µ-slides, which were prior coated with poly-D-lysine (0.01 % w/v in DPBS w/o Ca2+ and Mg2+) and grown to 70 % confluence overnight. Subsequently, cells were transiently transfected with the respective plasmid DNA using LipofectaminTM 2000, as recommended by the manufacturer. For transfection 80 ng plasmid DNA with 1 µl LipofectaminTM 2000 in OptiMEM for 1 h at 37 °C per well was applied. Labeling and microscopic studies were performed on the next day.

Cells for flow cytometry



HEK293 cells were seeded in12-well plates (Greiner Bio-one GmbH) and grown to 70 % confluence overnight. For E3-hY2R-eYFP expression, cells were transiently transfected with the respective plasmid DNA using LipofectaminTM 2000, as recommended by the manufacturer. For transfection 2000 ng plasmid DNA with 2 µl LipofectaminTM 2000 in OptiMEM for 1 h at 37 °C per well was applied. Labeling and flow cytometric studies were performed 36 h after transfection. Labeling with Peptide-Templated Acyl Transfer Peptide synthesis TAMRA-K3, ATTO488-K3 and Biotin-K3 containing an MPAA thioester were synthesized as earlier described (15).

Labeling of E3-tagged GPCR Unless noted otherwise all buffers were tempered at 37 °C and all incubation steps with cells were carried out at room temperature. Lyophilized K3 peptide probes were dissolved in 1 % TFA/H2O to obtain 0.1 mM stock solution. Labeling was achieved by exchange of the cell culture medium with 20 mM HEPES (SigmaAldrich) in HBSS buffer (Lonza Group Ltd.) pH 7 and 2 µl of Hoechst33342 (0.5 mg ml-1), followed by incubation for 10 min at 37 °C. Addition of Hoechst33342 was used to stain the cell nuclei. Next the cells were pulse-labeled with 150 nM TAMRA-K3 peptide probe in HBSS buffer supplemented with 0.1 mM TCEP (SigmaAldrich) and 20 mM HEPES pH 7 for 3 min. Remaining peptide probe was removed by washing with 200 mM NaHCO3 in DPBS buffer without Ca2+ and Mg2+ (Lonza Group Ltd.) pH 8.4 for 1.5 min, followed by two short washing steps with OptiMEM (ThermoFisher Scientific). Microscopic studies were finally performed in OptiMEM. Stimulation of the cells was induced with porcine neuropeptide Y (pNPY) in OptiMEM at the declared concentrations and time at 37 °C. pNPY was produced by solid-phase peptide synthesis using the Fmoc/tBu strategy as previously described.(39)

Pulse-Chase labeling for live cell microscopy Stably transfected HEK293-E3-hY2R cells in 8-well µ-slides were labeled by exchange of the cell culture medium with 20 mM HEPES in HBSS buffer pH 7 and 2 µl of Hoechst33342, followed by incubation for 10 min at 37 °C. Afterwards, the cells were pulse-labeled with 150 nM TAMRA-K3 peptide probe in HBSS buffer supplemented with 0.1 mM TCEP and 20 mM HEPES pH 7 for 3 min. Remaining peptide probe was removed by washing with


Page 14 of 30

Page 15 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


200 mM NaHCO3 in DPBS buffer (w/o Ca2+ and Mg2+) pH 8.4 for 1.5 min, followed by two short washing steps with OptiMEM before microscopic studies were performed in OptiMEM (correlates to unstimulated state). Cells were stimulated with 500 nM pNPY in OptiMEM for 30 min at 37 °C. Subsequently, a short acidic wash (50 mM glycine, 180 mM NaCl pH 3.1) and neutralization wash (20 mM HEPES in HBSS buffer pH 7) each for 20 s was performed to remove remaining pNPY. Chase-labeling with 200 nM ATTO488-K3 peptide probe in HBSS buffer supplemented with 0.1 mM TCEP and 20 mM HEPES pH 7 for 3 min was applied. Remaining labeling probe was removed by washing with 200 mM NaHCO3 in DPBS (w/o Ca2+ and Mg2+) buffer pH 8.4 for 1.5 min. Two short washing steps with OptiMEM followed before microscopic studies were performed in OptiMEM (correlates to pulse-labels stimulated and chase-label unstimulated). Second stimulation was induced with 500 nM pNPY in OptiMEM for the respective times (correlates to chase-label stimulated).

Pulse-Chase labeling and cell harvest for flow cytometry Transiently transfected HEK293-E3-hY2R-eYFP cells in 12-well plates were labeled by exchange of the cell culture medium with 20 mM HEPES in HBSS buffer pH 7 and incubation for 10 min at 37 °C. Cells were pulse-labeled with 150 nM TAMRA-K3 or BiotinK3 peptide probe in HBSS buffer supplemented with 0.1 mM TCEP and 20 mM HEPES pH 7 for 3 min. Remaining peptide probe was removed by washing with 200 mM NaHCO3 in DPBS buffer (w/o Ca2+ and Mg2+) pH 8.4 for 1.5 min, followed by two washing steps with OptiMEM. Cells were stimulated with 500 nM pNPY in OptiMEM for 30 min at 37 °C. Subsequently, a short acidic wash (50 mM glycine, 180 mM NaCl pH 3.1) and neutralization wash (20 mM HEPES in HBSS buffer pH 7) was performed to remove remaining pNPY. Chase-labeling with 200 nM Biotin-K3 or TAMRA-K3 peptide probe in HBSS buffer supplemented with 0.1 mM TCEP and 20 mM HEPES pH 7 for 3 min was applied. Remaining labeling probe was removed by washing with 200 mM NaHCO3 in DPBS (w/o Ca2+ and Mg2+) buffer pH 8.4 for 1.5 min, followed by two short washing steps with OptiMEM.

Cell Harvest and Flow Cytometry The medium of labeled HEK293-E3-hY2R-eYFP cells was replaced by warm 20 nM ethylenediaminetetraacetic acid (EDTA) in DPBS (w/o Ca2+ and Mg2+) and the cells were incubated for 10 min at 37° C. The cells were detached by resuspension in the EDTA solution and transferred to 1.5 ml tubes. The cell suspension was spun for 3 min at 500 g, the



supernatant was discarded. The pellet was resuspended in 20 mM EDTA in DPBS and spun again. After discarding the supernatant the cells were resuspended in 20 mM HEPES in HBSS (pH 7) and stored on ice until analysis. Labeled cell samples were injected into a BD FACSAriaTM SORP (BD Biosciences) cell sorter to analyse transiently transfected and TAMRA-labeled HEK293-E3-hY2R-eYFP cells in the cell suspensions. Wildtype HEK293 cells were used for gating and differentiation between single cells and cell clusters. For each experiment, a population of 10.000 living cells was analyzed using the 561 nm laser with 610/20-filter for TAMRA-fluorescence and the 488 nm laser with 530/30-filter for eYFP fluorescence. Data acquisition was achieved by using BD FACSDiva (BD Biosciences) software.

Live Cell Fluorescence Microscopy Part of the fluorescent images were taken with a Zeiss Axio Observer.Z1 microscope including ApoTome.2 Imaging System, AxioCamMRm camera, incubation chamber and CApochromat 63×/1.20 W objective, with a 46HE filter set (excitation 488–512 nm; emission 520–550 nm), a 31 filter set (excitation 550–580 nm; emission 590–650 nm), a 47 filter set (excitation 426–446 nm; emission 460–500 nm) and a 49 filter set (excitation 335–383 nm; emission 420–470 nm). These images were processed with Zeiss ZEN2012 software. Further fluorescent images were taken with Leica TCS SP5 confocal laser scanning microscope including incubation chamber, CO2 supply and HCX PL APO CS 63.0x1.40 OIL UV objective. An argon laser with 488 nm and 496 nm was used for excitation of the ATTO488 fluorophore, a DPSS laser with 561 nm was used for excitation of the TAMRA fluorophore and a multi photon laser was utilized to excite the Hoechst33342 fluorophore. Images were processed with Leica Application Suite Software.

Quantification of Fluorescence Images Microscopic images were always processed in an identical way. The selection of the mask was made with ImageJ (version 1.50i). Briefly, a suitable color threshold was set either to select only vesicular structures or to select all areas which contained a fluorescent signal. The best appropriate threshold was retained for all images throughout the experiments. The selection was converted into a binary image. In case of the vesicle mask the watershed function in combination with the analyze particle function was utilized to filter only vesicular structure within the binary image. The respective fluorescence images (TAMRA and ATTO488) were loaded and put into a stack with the binary mask. Then the mask was used to


Page 16 of 30

Page 17 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


create a selection which could be applied to the fluorescent images within the stack. With the measure function the fluorescence intensity under the selected area was detected. The mean values were used for the quantification as outlined in the figure description. The diagrams and statistics were evaluated with GraphPad Prism 6. The statistics were determined with a oneway ANOVA test in combination with a Tukey’s multiple comparison test (confidence interval set to 0.01).

AUTHOR INFORMATION The authors declare no competing or financial interests.

ACKNOWLEDGEMENTS The financial support by the SPP1623 and BE1264-15-2 is kindly acknowledged. The support of M. Schubert in the evaluation and quantification with ImageJ is gratefully acknowledged, as well as the excellent support in the cell culture by K. Löbner. Also, the help of B. Göttgens at the laser scanning microscope is acknowledged.




Page 18 of 30

Page 19 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1. 2. 3. 4. 5. 6. 7. 8.

9.

10. 11.

12.

13. 14.

15.

16. 17.

18. 19.

20.

Cygankiewicz, A. I., Maslowska, A., and Krajewska, W. M. (2014) Molecular basis of taste sense: involvement of GPCR receptors, Crit. Rev. Food. Sci. Nutr. 54, 771-780. Katritch, V., Cherezov, V., and Stevens, R. C. (2013) Structure-Function of the G Protein– Coupled Receptor Superfamily, Annu. Rev. Pharmacol. Toxicol. 53, 531-556. Konturek, S. J., Konturek, J. W., Pawlik, T., and Brzozowski, T. (2004) Brain-gut axis and its role in the control of food intake, J. Physiol. Pharmacol. 55, 137-154. Lagerström, M. C., and Schiöth, H. B. (2008) Structural diversity of G protein-coupled receptors and significance for drug discovery, Nat. Rev. Drug. Discov. 7, 339-357. Rosenbaum, D. M., Rasmussen, S. G. F., and Kobilka, B. K. (2009) The structure and function of G-protein-coupled receptors, Nature 459, 356-363. Marchese, A., Paing, M. M., Temple, B. R. S., and Trejo, J. (2008) G Protein–Coupled Receptor Sorting to Endosomes and Lysosomes, Annu. Rev. Pharmacol. Toxicol. 48, 601-629. Hanyaloglu, A. C., and Zastrow, M. v. (2008) Regulation of GPCRs by Endocytic Membrane Trafficking and Its Potential Implications, Annu. Rev. Pharmacol. Toxicol. 48, 537-568. Babilon, S., Mörl, K., and Beck-Sickinger, A. G. (2013) Towards improved receptor targeting: anterograde transport, internalization and postendocytic trafficking of neuropeptide Y receptors, Biol. Chem. 394, 921-936. Walther, C., Nagel, S., Gimenez, L. E., Mörl, K., Gurevich, V. V., and Beck-Sickinger, A. G. (2010) Ligand-induced Internalization and Recycling of the Human Neuropeptide Y2 Receptor Is Regulated by Its Carboxyl-terminal Tail, J. Biol. Chem. 285, 41578-41590. Lindner, D., Stichel, J., and Beck-Sickinger, A. G. (2008) Molecular recognition of the NPY hormone family by their receptors, Nutrition 24, 907-917. El Bahh, B., Balosso, S., Hamilton, T., Herzog, H., Beck-Sickinger, A. G., Sperk, G., Gehlert, D. R., Vezzani, A., and Colmers, W. F. (2005) The anti-epileptic actions of neuropeptide Y in the hippocampus are mediated by Y and not Y receptors, Eur. J. Neurosci. 22, 1417-1430. Thomsen, A. R., Plouffe, B., Cahill, T. J., 3rd, Shukla, A. K., Tarrasch, J. T., Dosey, A. M., Kahsai, A. W., Strachan, R. T., Pani, B., Mahoney, J. P., Huang, L., Breton, B., Heydenreich, F. M., Sunahara, R. K., Skiniotis, G., Bouvier, M., and Lefkowitz, R. J. (2016) GPCR-G Protein-βArrestin Super-Complex Mediates Sustained G Protein Signaling, Cell 166, 907-919. Eichel, K., Jullie, D., and von Zastrow, M. (2016) β-Arrestin drives MAP kinase signalling from clathrin-coated structures after GPCR dissociation, Nat. Cell. Biol. 18, 303-310. Reinhardt, U., Lotze, J., Zernia, S., Mörl, K., Beck-Sickinger, A. G., and Seitz, O. (2014) PeptideTemplated Acyl Transfer: A Chemical Method for the Labeling of Membrane Proteins on Live Cells, Angew. Chem. Int. Ed. 53, 10237-10241. Reinhardt, U., Lotze, J., Mörl, K., Beck-Sickinger, A. G., and Seitz, O. (2015) Rapid Covalent Fluorescence Labeling of Membrane Proteins on Live Cells via Coiled-Coil Templated Acyl Transfer, Bioconjug. Chem. 26, 2106-2117. Litowski, J. R., and Hodges, R. S. (2002) Designing Heterodimeric Two-stranded α-Helical Coiled-coils, J. Biol. Chem. 277, 37272-37279. Yano, Y., Yano, A., Oishi, S., Sugimoto, Y., Tsujimoto, G., Fujii, N., and Matsuzaki, K. (2008) Coiled-Coil Tag−Probe System for Quick Labeling of Membrane Receptors in Living Cells, ACS Chem. Biol. 3, 341-345. Wang, H., and Tai, A. W. (2017) Continuous de novo generation of spatially segregated hepatitis C virus replication organelles revealed by pulse-chase imaging, J. Hepatol. 66, 55-66. Mossuto, M. F., Sannino, S., Mazza, D., Fagioli, C., Vitale, M., Yoboue, E. D., Sitia, R., and Anelli, T. (2014) A Dynamic Study of Protein Secretion and Aggregation in the Secretory Pathway, PLOS ONE 9, e108496. Wang, H. Y., Lin, Y.-P., Mitchell, C. K., Ram, S., and O'Brien, J. (2015) Two-color fluorescent analysis of connexin 36 turnover: relationship to functional plasticity, J. Cell Sci. 128, 38883897.



21.

22.

23. 24.

25.

26. 27.

28.

29.

30. 31. 32. 33. 34.

35. 36.

37.

38.

39.

Boassa, D., Solan, J. L., Papas, A., Thornton, P., Lampe, P. D., and Sosinsky, G. E. (2010) Trafficking and Recycling of the Connexin43 Gap Junction Protein during Mitosis, Traffic 11, 1471-1486. Das, S. C., Panda, D., Nayak, D., and Pattnaik, A. K. (2009) Biarsenical Labeling of Vesicular Stomatitis Virus Encoding Tetracysteine-Tagged M Protein Allows Dynamic Imaging of M Protein and Virus Uncoating in Infected Cells, J. Virol. 83, 2611-2622. Rodriguez, A. J., Shenoy, S. M., Singer, R. H., and Condeelis, J. (2006) Visualization of mRNA translation in living cells, J. Cell Biol. 175, 67-76. Miki, T., Fujishima, S.-h., Komatsu, K., Kuwata, K., Kiyonaka, S., and Hamachi, I. (2014) LDAIBased Chemical Labeling of Intact Membrane Proteins and Its Pulse-Chase Analysis under Live Cell Conditions, Chem. Biol. 21, 1013-1022. Mizukami, S., Watanabe, S., Akimoto, Y., and Kikuchi, K. (2012) No-Wash Protein Labeling with Designed Fluorogenic Probes and Application to Real-Time Pulse-Chase Analysis, J. Am. Chem. Soc. 134, 1623-1629. Seachrist, J. L., and Ferguson, S. S. G. (2003) Regulation of G protein-coupled receptor endocytosis and trafficking by Rab GTPases, Life Sci. 74, 225-235. Esseltine, J. L., Dale, L. B., and Ferguson, S. S. G. (2011) Rab GTPases Bind at a Common Site within the Angiotensin II Type I Receptor Carboxyl-Terminal Tail: Evidence that Rab4 Regulates Receptor Phosphorylation, Desensitization, and Resensitization, Mol. Pharmacol. 79, 175-184. Holmes, K. D., Babwah, A. V., Dale, L. B., Poulter, M. O., and Ferguson, S. S. G. (2006) Differential regulation of corticotropin releasing factor 1α receptor endocytosis and trafficking by β-arrestins and Rab GTPases, J. Neurochem. 96, 934-949. Li, H., Li, H.-F., Felder, R. A., Periasamy, A., and Jose, P. A. (2008) Rab4 and Rab11 coordinately regulate the recycling of angiotensin II type I receptor as demonstrated by fluorescence resonance energy transfer microscopy, J. Biomed. Opt. 13, 031206-031206031210. Rosenfeld, J. L., Knoll, B. J., and Moore, R. H. (2002) Regulation of G-protein-coupled receptor activity by rab GTPases, Recept. Channels 8, 87-97. Tower-Gilchrist, C., Lee, E., and Sztul, E. (2011) Endosomal trafficking of the G proteincoupled receptor somatostatin receptor 3, Biochem. Biophys. Res. Commun. 413, 555-560. Stenmark, H. (2009) Rab GTPases as coordinators of vesicle traffic, Nat. Rev. Mol. Cell. Biol. 10, 513-525. Welz, T., Wellbourne-Wood, J., and Kerkhoff, E. (2014) Orchestration of cell surface proteins by Rab11, Trends Cell Biol. 24, 407-415. Sönnichsen, B., Renzis, S. D., Nielsen, E., Rietdorf, J., and Zerial, M. (2000) Distinct Membrane Domains on Endosomes in the Recycling Pathway Visualized by Multicolor Imaging of Rab4, Rab5, and Rab11, J. Cell Biol. 149, 901-914. Calebiro, D., Nikolaev, V. O., Persani, L., and Lohse, M. J. (2010) Signaling by internalized Gprotein-coupled receptors, Trends Pharmacol. Sci. 31, 221-228. Tsvetanova, N. G., Irannejad, R., and Zastrow, M. v. (2015) G Protein-coupled Receptor (GPCR) Signaling via Heterotrimeric G Proteins from Endosomes, J. Biol. Chem. 290, 66896696. Paasche, J. D., Attramadal, T., Sandberg, C., Johansen, H. K., and Attramadal, H. (2001) Mechanisms of Endothelin Receptor Subtype-specific Targeting to Distinct Intracellular Trafficking Pathways, J. Biol. Chem. 276, 34041-34050. Mäde, V., Babilon, S., Jolly, N., Wanka, L., Bellmann-Sickert, K., Diaz Gimenez, L. E., Mörl, K., Cox, H. M., Gurevich, V. V., and Beck-Sickinger, A. G. (2014) Peptide Modifications Differentially Alter G Protein-Coupled Receptor Internalization and Signaling Bias, Angew. Chem. Int. Ed. 53, 10067-10071. Hofmann, S., Frank, R., Hey-Hawkins, E., Beck-Sickinger, A. G., and Schmidt, P. (2013) Manipulating Y receptor subtype activation of short neuropeptide Y analogs by introducing carbaboranes, Neuropeptides 47, 59-66. ACS Paragon Plus Environment

Page 20 of 30

Page 21 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure Legends Scheme 1. Principle of the peptide-templated acyl transfer. The GPCR is genetically fused to the cysteine-E3-tag (dark blue) at its N-terminus. The K3 peptide (light blue) is linked to a fluorescent probe by a mercaptophenylacetic thioester. Incubation of the E3-tagged GPCR with the fluorophore-conjugated K3 peptide leads to the formation of a E3/K3 coiled-coil. This positions the N-terminal cysteine-residue in close proximity to the mercaptophenylacetic thioester and facilitates an acyl transfer of the fluorophore onto the E3-tagged GPCR. The remaining K3 peptide is washed away. The labeling procedure requires 5 min.

Scheme 2. Setup of the two-color pulse-chase experiment. Unstimulated HEK293-E3hY2R cells are labeled with the TAMRA-K3 probe, which is the pulse-label. In vitro measurements exhibit a transfer efficiency of ~60% for the TAMRA probe (15). The first stimulation with the agonist NPY induces receptor internalization. Owing to the chosen agonist concentration and stimulation time a subset of receptors will remain at the cell surface. The remaining unlabeled receptors in the cell membrane are labeled with the ATTO488 probe during the next step, which is the chase-label. In vitro measurements exhibit a higher transfer efficiency with ~80% for the ATTO488 probe (15). A second stimulation with the agonist is applied, which induces the internalization of the chase-labeled receptors. Subsequently, the spatial distribution of pulse- and chase-labeled receptors can be observed in a time-resolved manner.

Figure 1. Optimization of set-up of pulse-chase experiment. A) Normalized mean fluorescence of TAMRA-bearing K3-probe transferred to HEK293 cells transfected with Cys-E3-hY2R-eYFP fusion. Yellow bars represent fluorescence of receptors, red bars represent labelled receptors with TAMRA-K3-peptide as pulse (left) or chase (right) Fluorescence analysis was performed by flow cytometry. Total, background and specific fluorescence signals were normalized by the transfection efficiency of the individual experiments (n=2). For each experiment, populations of 10.000 living cells were analyzed using the 561 nm laser with 610/20-filter for TAMRA-fluorescence and the 488 nm laser with 530/30-filter for eYFP fluorescence. Measurements were performed in duplicates for which the average relative mean fluorescence (with standard deviation) is shown. B) Time-resolved internalization of pulse-labeled HEK293-E3-hY2R cells. Cells were pulse-labeled with ACS Paragon Plus Environment


150 nM TAMRA-K3 probe and stimulation was performed with 500 nM pNPY at 37 °C for the indicated time. Cell nuclei were stained with Hoechst33342. Images were taken with a Leica TCS SP5 confocal laser scanning microscope. Scale bar: 20 µm

Figure 2. Labeling and internalization studies of HEK293-E3-hY2R cells. HEK293-E3hY2R cells were stimulated with pNPY at the indicated concentration for 60 min at 37 °C prior to labeling. (A) Stimulation with 100 nM pNPY and (B) stimulation with 1 µM pNPY. Next, labeling with 150 nM TAMRA-K3 probe was applied and fluorescent images were taken. Subsequently, the labeled cells were stimulated a second time with the respective pNPY concentration for 10 min and 30 min at 37 °C. Cell nuclei were stained with Hoechst33342. Images were taken with a Leica TCS SP5 confocal laser scanning microscope. Scale bar: 20 µm

Figure 3. Two-color pulse-chase experiment with HEK293-E3-hY2R cells. (A) Initially cells were pulse-labeled with 150 nM TAMRA-K3 probe (= unstimulated). (B) Subsequently, the first stimulation with 500 nM pNPY for 30 min at 37 °C was applied, followed by chaselabeling with 200 nM ATTO488-K3 probe (= 1st Stimulation for 30 min). (C-E) Next, a second stimulation with 500 nM pNPY was applied and images were taken in a time-resolved manner (= 2nd Stimulation for x min). Cell nuclei were stained with Hoechst33342. Images were taken with a Leica TCS SP5 confocal laser scanning microscope. Scale bar: 20 µm

Figure 4. Quantification of the fluorescence intensity in vesicular structures. (A) For each timeframe and microscopic image a mask was selected to cover only the area of particles inside the cells based on the pulse-labeled images. The mask was utilized to measure the fluorescence intensity under this area for the pulse- and chase-label separately. The values represent the sum of the pixel intensity divided by the number of pixels (= area of the mask). All data was normalized to the pulse-label fluorescence intensity at 0 min. (B) For better comparison the measured data in A was used to calculate the ratio between pulse- and chaselabel. The data was normalized to set the pulse/chase ratio at 0 min to 1. The significance was determined by a one-way ANOVA test in combination with a Tukey’s multiple comparison test (∗ ≤ 0.05, ∗∗ ≤ 0.01, ∗∗∗∗ ≤ 0.0001). Five independent experiments were performed. For each experiment 2-3 images per timeframe were analyzed. (C) The time-resolved colocalization of pulse- (TAMRA, red) and chase-labeled (ATTO488, green) cells was analyzed over a two hour period, while maintaining 500 nM pNPY in the medium. Cell nuclei were ACS Paragon Plus Environment

Page 22 of 30

Page 23 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


stained with Hoechst33342. Images were taken with a Zeiss Axio Observer.Z1 microscope with ApoTome unit. Scale bar: 20 µm Figure 5. Quantification of the fluorescence intensity of the total area. A mask was selected for each timeframe, microscopic image and fluorescent label to measure the total fluorescence including vesicular structures and cell surface areas. Five independent experiments were performed. For each experiment 2-3 images per timeframe were analyzed. (A) The data of the overall fluorescence intensity for the pulse-label is shown. The values were normalized to 0 min. (B) The data of the overall fluorescence intensity for the chaselabel is shown. The values were normalized to 0 min.

Figure 6. Two-color pulse-chase experiment with HEK293-E3-hY2R cells and endosomal markers. Initially, cells were pulse-labeled with 150 nM TAMRA-K3 probe (= unstimulated). The first stimulation was performed with 500 nM pNPY for 30 min at 37 °C, followed by chase-labeling with 200 nM ATTO488-K3 probe (= 1st Stimulation for 30 min). Next, a second stimulation with 500 nM pNPY was applied (= 2nd Stimulation for 10 min). (A) Represents the approach with Rab4 as marker for the early endosome and (B) represents the approach with Rab11 as marker for the recycling endosome. Cell nuclei were stained with Hoechst33342. Images were taken with a Zeiss Axio Observer.Z1 microscope with ApoTome unit. Scale bar: 10 µm.



355x180mm (300 x 300 DPI)


Page 24 of 30

Page 25 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figures Scheme 1

Scheme 2



Figure 1

Figure 2


Page 26 of 30

Page 27 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3



Figure 4


Page 28 of 30

Page 29 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5



Figure 6


Page 30 of 30

Time-Resolved Tracking of Separately Internalized Neuropeptide Y2

Recommend Documents