Transactivation Potencies of Baikal Seal Constitutive Active

Jul 17, 2009 - To assess the potential effects of environmental pollutants in Baikal seals (Pusa sibirica), transcriptional activities of the seal CAR...
0 downloads 0 Views 358KB Size
Download PDF
Environ. Sci. Technol. 2009, 43, 6391–6397

Transactivation Potencies of Baikal Seal Constitutive Active/Androstane Receptor by Persistent Organic Pollutants and Brominated Flame Retardants H I R O K I S A K A I , † E U N - Y O U N G K I M , †,‡ EVGENY A. PETROV,§ SHINSUKE TANABE,† AND H I S A T O I W A T A * ,† Center for Marine Environmental Studies (CMES), Ehime University, 2-5 Bunkyo-cho, Matsuyama 790-8577, Japan, Department of Biology, Kyung Hee University, Hoegi-Dong, Dongdaemun-Gu, Seoul 130-701, Korea, and The Eastern-Siberian Scientific and Production Fisheries Center “VOSTSIBRYBCENTR”, Hakhalov st. 4, Ulan-Ude, Buryatia, 670034, Russia

Received April 15, 2009. Revised manuscript received June 5, 2009. Accepted July 6, 2009.

To characterize ligand-dependent transcriptional activation of constitutive active/androstane receptor (CAR) in aquatic mammals, transactivation potentials of the Baikal seal (Pusa sibirica) CAR (bsCAR) by environmental pollutants, including persistent organic pollutants (POPs) and brominated flame retardants (BFRs), were investigated using an in vitro reporter gene assay, and compared with those of the mouse CAR (mCAR). Measurement of luciferase reporter gene activities demonstrated that the seal CAR was activated by POPs, including a technical mixture of PCBs (Kanechlor-500), certain individual PCB congeners, DDT compounds, and trans-nonachlor. No or slight bsCAR-dependent activity was detected in experiments with PBDE congeners and HBCDs. The interspecies comparison of lowest observed effect concentration (LOEC) for CAR transactivation by each compound revealed that bsCAR responds more sensitively to PCBs than mCAR. In addition, bsCAR wasweaklydeactivatedbyPBDE99,whereasmCARtranscriptional activity decreased weakly by PBDE100, PBDE154, and PBDE187. Comparison of reporter gene activities by the congeners with the same IUPAC numbers among PCBs and PBDEs revealed that both bsCAR and mCAR were not activated by PBDE99 and PBDE153, but were activated by PCB99 and PCB153. The small ligand-binding pocket in CAR may contribute to difference in response between PCBs and PBDEs. Given that ethical rationale prevents dosing studies with such organohalogens in aquatic mammals, our in vitro assay system constructed with CAR cDNA from a species of interest provides a useful and realistic alternative approach in ecotoxicology. * Corresponding author phone: +81-89-927-8172; fax: +81-89927-8172; e-mail: [email protected]. † Center for Marine Environmental Studies (CMES), Ehime University. ‡ Department of Biology, Kyung Hee University. § The Eastern-Siberian Scientific and Production Fisheries Center “VOSTSIBRYBCENTR”. 10.1021/es901120r CCC: $40.75

Published on Web 07/17/2009

 2009 American Chemical Society

Introduction Constitutive active/androstane receptor (CAR), a member of the NR1I3 class of nuclear receptor superfamily, plays an important role in the transcriptional activation of multiple xenobiotic metabolizing enzymes such as cytochrome P450 (CYP) 2B, 2C, and 3A, and sulfotransferases, glucuronosyltransferases, and glutathione S-transferases in response to phenobarbital (PB)-type chemicals in rodents and human (1). CAR is retained in the cytoplasm in nonchemically exposed cells (2). Following treatment with PB-type inducers, the activated CAR translocates into the nucleus and forms a heterodimer with retinoid X receptor R (RXRR). The CAR/ RXRR complex binds to the PB-responsive enhancer module (PBREM) located in the 5′-upstream promoter region of CAR target genes (3). The CAR target genes can potentially regulate physiological conditions through the metabolism of endogenous substrates such as steroid hormones, thyroid hormones, bile acids, and bilirubin (4-6). A recent study reveals that activation of this receptor by PB-type chemicals is an essential requirement for liver tumor development (7). Therefore, identifying and quantifying PB-type environmental contaminants that can modulate the CAR-mediated signaling pathways may give an insight into the risk and effects of these contaminants in humans and wildlife. Persistent organic pollutants (POPs) such as polychlorinated biphenyls (PCBs) and dichlorodiphenyltrichloroethane (DDT) and its metabolite dichlorodiphenyltrichloroethylene (DDE) are well-known ubiquitous environmental contaminants that bioaccumulate in higher trophic animals including aquatic mammals through the food web (8). Recently, worldwide contamination by emerging POPs, brominated flame retardants (BFRs) such as polybrominated diphenyl ethers (PBDEs) and hexabromocyclododecanes (HBCDs), is also of growing concern due to their global distribution and potential toxic effects in animals (9, 10). Nevertheless, with a lack of suitable endpoint for toxicological observation, no appropriate methodology of risk assessment has been established for these environmental contaminants in aquatic mammals. Some in vivo and in vitro studies targeting experimental animals have demonstrated that expression of certain CYP genes is induced in response to POPs and BFRs exposure. For instance, treatment with ortho-chlorine substituted nonplanar PCB congeners showed an increase in hepatic CYP2B protein and its catalytic marker, pentoxyresorufin O-dealkylation (PROD) activity in rodents (11, 12). It is also known that rat CYP2B and 3A proteins are induced by exposure to organochlorine pesticides, DDTs, and chlordanes (13), and the induction of these CYPs is mediated by CAR (14). As for BFRs, treatment with technical PBDE mixtures and some individual PBDE congeners leads to the induction of hepatic CYP2B and 3A in rodents (15, 16). Furthermore, cell-based transactivation analysis demonstrated that mouse Cyp2b10 and 3a11 genes are transcriptionally induced by PBDEs through the activation of pregnane X receptor, a member of the same NR1I subfamily as CAR (16). Recent investigation suggests a significant induction of rat CYP2B1 and CYP3A1 by HBCDs (17). The Baikal seal (Pusa sibirica) is a top predator species in Lake Baikal, Russia, and is contaminated by POPs (18-20) and other organohalogen compounds (21). To understand the effects and to assess the risk of such organohalogen compounds to wild Baikal seal populations, our research group has noted lipophilic ligand receptor-mediated signaling pathways. Our eco-epidemiological and in vitro studies have VOL. 43, NO. 16, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6391

suggested that polychlorinated dibenzo-p-dioxins, dibenzofurans, and non/mono-ortho chlorine substituted coplanar PCBs activate the signaling pathway mediated by aryl hydrocarbon receptor (AHR), and subsequently induce the hepatic CYP1A1, 1A2, and 1B1 in wild Baikal seals (22-24). In addition, we have also revealed that the hepatic accumulation of perfluorochemicals elicits the activation of peroxisome proliferator-activated receptor R (PPARR), and enhances the CYP4A expression in Baikal seals (25). In Baikal seals, while the accumulation of PB-type environmental contaminants such as ortho-chlorine substituted PCBs, DDTs, and chlordanes is more predominant than that of dioxins and related compounds and perfluorochemicals, there is much less information on the receptor-mediated responses to such PB-type contaminants. Studies on the CAR signaling pathway have reported that there are distinct species differences in ligand profiles between human and rodents, while CAR can be activated by structurally and chemically diverse ligands in every mammalian species tested (26, 27). Given that the homology of CAR amino acid sequences among mammalian species is lower than that of other lipophilic ligand receptors such as estrogen receptor and androgen receptor, it is rational that CAR has a distinct ligand profile in each species. The hepatomitogen 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) is a potent mouse CAR (mCAR) agonist, but is not an agonist for human CAR (hCAR) and the Baikal seal CAR (bsCAR) (28, 29). In contrast, an imidazothiazole derivative, 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4dichlorobenzyl)oxime (CITCO) can activate hCAR and bsCAR, but not mCAR (29, 30). Furthermore, endogenous ligands, androstanol and androstenol, which are recognized as antagonists of the constitutive CAR activity in mammalian species (26, 31), showed no repression in bsCAR. Thus, interspecies differences in CAR ligand profiles suggest that the profiling of species-specific CAR activation by environmental chemicals is necessary to understand their precise toxicological risk and effects in the species of interest. To provide more information on the potential ligands for bsCAR, the present study investigates the transactivation of bsCAR by POPs and BFRs using the in vitro reporter gene assay that we have previously constructed (29). Furthermore, the CAR ligand profile is compared between the Baikal seal and mouse. Lastly, this study discusses the propensity of seal species to respond to PB-type environmental chemicals.

Materials and Methods Reagents. Five to seven chlorines substituted PCB congeners (IUPAC PCB85, PCB99, PCB101, PCB105, PCB118, PCB138, PCB153, PCB156, PCB180, and PCB187), 4-7 bromines substituted PBDE congeners (IUPAC PBDE47, PBDE99, PBDE100, PBDE153, PBDE154, and PBDE183), and transnonachlor were purchased from AccuStandard, Inc. (New Haven, CT). DDT compounds (p,p′-DDT and p,p′-DDE) and HBCDs were obtained from Sigma-Aldrich Inc. (St. Louis, MO). The structures of these chemicals are shown in Figure S1. Preparation of Plasmid. Cloning of CAR cDNAs from the Baikal seal and mouse, and construction of in vitro reporter gene assay have already been reported in detail elsewhere (29). Complementary DNAs of bsCAR and mCAR were prepared using specific sets of primers with polymerase chain reaction (bsCAR-F; 5′-CACCCGGGTCTGAAGCCATGGCCAGTG-3′, bsCAR-R; 5′-GCGGCCGCTCAGCTGCAGATCTCCTG-3′, mCAR-F; CACCCGGGACCATGGCCAGTGAAGAAGAA3′, mCAR-R; 5′-GCGGCCGCAAAGGATGCAAGCCTGGCCT3′). Amplified cDNAs were then inserted into pcDNA3.2/ V5/GW/D-TOPO Vector (Invitrogen, Carlsbad, CA). The 6392

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 16, 2009

luciferase reporter plasmid, pGL3-(NR1)3-Luc was constructed using a synthesized complementary oligonucleotide containing three copies of NR1 site sequence (5′-AGAATCTGTACTTTCCTGACCTTGGCAC-3′) of PB-responsive enhancer module (PBREM) located in the 5′-upstream region of mouse Cyp2b10 gene, which was subcloned into KpnI/ XhoI sites of the pGL3-Promoter Vector (Promega, Madison, WI). Construction of Reporter Gene Assay. Cell culture and transfection assay were performed as reported by Sakai et al. (29) with slight modification. MCF-7 cells, a human breast cancer cell line, were maintained in Dulbecco’s modified Eagle medium (DMEM), supplemented with 5% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin. Cells were seeded into 24-well plates at 5 × 104 cells/ well and cultured at 37 °C for 24 h. The growth media was then changed to phenol red-free DMEM with 5% double charcoal/dextran-treated FBS (CDFBS), and further incubated for 24 h. Following incubation, cells were cotransfected using Lipofectamine 2000 (Invitrogen) with 100 ng of pGL3(NR1)3-Luc,200ngofCARexpressionplasmid(pcDNA3.2TOPObsCAR or pcDNA3.2TOPO-mCAR), and 10 ng of phRL-TK vector (Promega) as an internal standard and cultured at 37 °C for 5 h. The pcDNA3.2TOPO-empty plasmid with no CAR cDNA (200 ng) was also employed as a negative control for detection of CAR-dependent NR1 transactivation. The transfection was carried out in triplicate. Cells were then washed by phenol red-free DMEM, and incubated in 10% CDFBS containing DMEM treated with various concentrations of each test chemical. After incubation for 24 h at 37 °C, all the media containing chemicals were then removed. Cells were washed by PBS and were lysed by Passive Lysis Buffer (Promega). Luciferase activity in cell lysate was measured using DualLuciferase Reporter Assay System (Promega). Firefly (for chemical-dependent activity) and Renilla (for transfection control) luciferase activities were determined in each well. Luminescence assays were completed using a GloMax 96 Microplate Luminometer (Promega). The final luminescence values were expressed as the ratio of the firefly luciferase units to the Renilla luciferase unit (relative luciferase unit, RLU). Data Analysis. The firefly luciferase activities were normalized against Renilla luciferase activities of an internal control phRL-TK vector and determined from at least three independent transfections. All the data were expressed as average ( standard deviation. Statistical analysis was performed using SPSS (version 12.0, SPSS Japan Inc., Tokyo, Japan). The experimental data from reporter gene assays were analyzed by Levene’s test to check the homogeneity of variance. Differences in reporter gene activities between solvent control and chemical exposure groups were analyzed by the analysis of variance (ANOVA) followed by Dunnett’s posthoc test. Statistical significance was regarded as p < 0.05.

Results and Discussion CAR Transactivation Potency of POPs. We analyzed CAR transactivation potencies of a technical PCB mixture, Kanechlor-500 (KC-500), mostly consisting of pentachlorinated congeners. The technical mixture activated both Baikal seal and mouse CARs (Figure S2A). Similarly, 10 PCB congeners (PCB85, PCB99, PCB101, PCB105, PCB118, PCB138, PCB153, PCB156, PCB180, and PCB187), which are abundant in Baikal seals (19), were also examined for their CAR transactivation potencies. Most of the PCB congeners induced both Baikal seal and mouse CAR-mediated transcriptional activities in a dose-dependent manner (Figures S2B-K), except PCB138 for mCAR (Figure S2G). As for DDT compounds (p,p′-DDT and p,p′-DDE) and trans-nonachlor, both

FIGURE 1. Normalized fractional induction of the Baikal seal or mouse CAR by exposure to POPs. All the results are obtained by subtraction of the results from no CAR expressed cells from the activity of the seal or mouse CAR expressed cells as shown in Figure S2, then control and maximum value in each data set were further calculated as 0 and 1, respectively. Technical PCB mixture, Kanechlor-500 (A), PCB85 (B), PCB99 (C), PCB101 (D), PCB105 (E), PCB138 (F), PCB153 (G), PCB156 (H), PCB180 (I), PCB187 (J), trans-nonachlor (K), p,p′-DDT (L), and p,p′-DDE (M) treatment in the Baikal seal or mouse CAR are presented as (square) and (triangle), respectively. Mouse CAR activity by Kanechlor-500 (A), PCB85 (B), PCB99 (C), PCB101 (D), PCB138 (F), and both the Baikal seal and mouse CAR activity by PCB118 were not calculated due to no significant induction to control after the normalization. seal and mouse CARs were activated by treatment with these chemicals (Figures S2L-N). On the other hand, the luciferase activity in no CARtransfected cells was also enhanced by the treatment with these tested chemicals, although the activities in no CARtransfected cells were lower than those in the seal and mouse CAR-expressed cells (Figure S2). This suggests that some transcription factors other than CAR that are endogenously expressed in MCF-7 cells may be involved in the liganddependent transactivation of reporter gene. The reporter gene activities as RLU in no CAR-expressed cells were lower than those in bsCAR- and mCAR-expressed cells (Figure S2). Fractional induction for CAR-dependent transactivation by chemical treatment was calculated by subtracting the response for each dose of chemical in no CAR-expressed cells from that for the corresponding dose in the seal or mouse CAR-expressed cells, and further by giving 1.0 as the maximum induction value (Figure 1). The results revealed that bsCAR-dependent activity was increased by p,p′-DDE, p,p′-DDT, trans-nonachlor, and individual PCB congeners with the exception of PCB118, whereas mCAR was activated by POPs with the exception of PCB85, PCB101, PCB118, PCB138, and KC-500 (Figure 1). Therefore, it is likely that the environmental chemicals that showed no CAR-dependent activity can induce transactivation of NR1 through endogenous CAR-independent factors in MCF-7 cells.

To verify whether the POPs that were found to be a candidate of NR1 activation even after normalization to fractional induction are “real” activators for CAR, the transactivation potential was measured by cotreatment with a mCAR antagonist, androstenol (Figure S3). Since no specific bsCAR antagonist had been found in our previous study (29), this assay was performed only for mCAR. Treatment of 1 µM of androstenol repressed constitutive activity of mCAR as previously shown (29, 31), and cotreatment with individual candidate POPs recovered the activities in a dose dependent manner (Figure S3). This result apparently suggests that the induction of luciferase activity by these POPs is mCARdependent. Considering this result, it can be presumed that the candidate POPs extracted from the analysis of fractional induction can be agonists for bsCAR. PCB congeners and DDTs examined in this study have been primarily detected in the tissue of wild Baikal seals (18). Therefore, our results imply that these environmental contaminants can be potential activators for bsCAR. This is consistent with a study demonstrating that CYP2B, which is a preferential CAR target gene in rodents, and its catalytic reaction, pentoxyresorufin O-dealkylase activity are induced by treatment with ortho-chlorine substituted-PCB congeners in rats (11). Dioxin-like, mono ortho-coplanar PCB congener, PCB118 is an agonist for the aryl hydrocarbon receptor (AHR), which is a transcriptional factor for CYP1A gene in rodents. VOL. 43, NO. 16, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6393

FIGURE 2. Reporter gene activity in no CAR-, the Baikal seal CAR-, or mouse CAR-expressed cells treated with BFRs. All results on treatment with chemicals are expressed as relative luciferase unit calculated from firefly luciferase divided by Renilla luciferase activity. Asterisk shows statistical difference from solvent control cells at the level of p < 0.05 by one-way ANOVA and Dunnett’s test. PBDE47 (A), PBDE99 (B), PBDE100 (C), PBDE153 (D), PBDE 154 (E), PBDE183 (F), and HBCDs (G) were treated in empty (white), the Baikal seal (black), or mouse CAR (gray) transfected cells. It is also reported that such a mono ortho-PCB congener typically displays induction of both CYP1A and CYP2B in rats (13). Our recent study demonstrated that PCB118 exposure induced transactivation of the Baikal seal AHR in a cell-based reporter gene assay (24). Nevertheless, neither seal nor mouse CAR was activated by this congener in the present study (Figure 1). Hence, PCB118 can be a preferential inducer of the AHR signaling pathway in Baikal seals. CAR Transactivation Potency of BFRs. We also investigated CAR transactivation potencies of BFRs including 6 PBDE congeners (PBDE47, PBDE99, PBDE100, PBDE153, PBDE154, and PBDE183), which are predominantly detected in marine mammals (32, 33), and a HBCD mixture. Some of these PBDE congeners showed weak responses for CARdependent transactivation in both seal and mouse. Treatment with PBDE99 slightly repressed bsCAR activity at more than 10 µg/mL, while mCAR activation decreased by treatment with PBDE100, PBDE154, and PBDE183 (Figure 2). No significant effect on either seal or mouse CAR activation was detected by exposure to other PBDE congeners. Apart from the results from POPs in the present study, cells with no CAR-expression exhibited no significant response with PBDE congeners (Figure 2), suggesting that no transcriptional factor other than CAR may be involved in the activity. The luciferase activities by PBDEs were also normalized to fractional induction as shown for POPs, but the results were similar with those of prenormalization because no significant dosedependent response was detected in no CAR-expressed cells (data not shown). As for HBCDs, bsCAR was activated in response to this chemical at more than 10 µg/mL, whereas mCAR activity decreased dose-dependently at lower concentrations and increased at higher concentrations (Figure 2G). In no CAR-expressed cells, treatment with HBCDs induced reporter gene activity (Figure 2G). Furthermore, the normalized luciferase activities mediated by CAR showed a similar trend in seal and mouse; the activities were decreased by HBCDs exposure up to 5 µg/mL but increased up to the control level at more than 10 µg/mL (data not shown). From these results, we can conclude that some BFRs, including PBDEs and HBCDs, are weak deactivators of CAR in both species. Recent in vivo studies indicated that CYP2B and CYP3A genes are induced only by high doses of PBDEs and HBCDs in rodents (15, 17), although no direct evidence for the involvement in CAR was provided. Direct evidence has been provided by more recent in vivo and in vitro experiments showing that some PBDE congeners are activators of the nuclear receptor pregnane X receptor (PXR) (16). Therefore, 6394

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 16, 2009

TABLE 1. Interspecies Comparison of LOECa for CAR Activation in the Baikal Seal and Mouse chemical

seal

mouse

PCBs PCBs (KC500) 20 PCB85 5 PCB99 5 PCB101 15 PCB105 10 PCB118 >20 PCB138 10 PCB153 20 PCB156 10 PCB180 20 PCB187 1 a

LOEC (µg/mL).

)

lowest

>50 >20 15 >20 15 >20 >20 50 1 50 10

chemical

seal

pesticides p,p′-DDT 1 p,p′-DDE 10 trans-nonachlor 15 BFRs PBDE47 PBDE99 PBDE100 PBDE153 PBDE154 PBDE183 HBCDs

observable

effect

>50 10 >20 >20 >20 >50 10

mouse 10 10 10 >50 >50 1 >20 1 20 0.1

concentration

PBDEs may be more efficient inducers of PXR rather than of CAR, whereas there is no information on PXR-dependent transactivation potencies by PBDEs in seal species. Interspecies Differences in CAR Activation between Seal and Mouse. To compare CAR ligand profiles between seal and mouse, we estimated the lowest observable effect concentration (LOEC) of each chemical for CAR activation (Table 1). For this estimation, we employed the results on normalized fractional induction. LOEC of KC-500 for bsCAR activation (20 µg/mL) was lower than that of mCAR (>50 µg/mL). Regarding PCB congeners, with the exception of PCB118 and 156, bsCAR-mediated transcriptional activity was more sensitively induced than mCAR (Table 1). This result suggests that these PCB congeners may contribute to the difference in sensitivity to PCB mixture for CAR activation between seal and mouse. Interspecies comparison of hepatic microsomal PROD induction by PCB153 between mouse and rat indicated that this PCB congener induced the PROD activity in both species, but the potency was lower in mouse (12). Although the PROD activity is an indicator for CYP2B protein expression, but not for CAR transactivation potency, low potency of CAR-mediated transcriptional activity by PCB exposure may result in low induction ability of its target gene, CYP2B in mouse. Overall, these results suggest that bsCAR may be more sensitive to PCBs than mCAR with regard to the transcriptional activities, as described previously (29).

As for DDT compounds, LOEC of p,p′-DDT for bsCAR activation (1 µg/mL) was 10-fold lower than that for mCAR (10 µg/mL), while similar LOECs (10 µg/mL) were observed in p,p′-DDE for both seal and mouse CARs (Table 1). In contrast, LOEC of trans-nonachlor for bsCAR activation (15 µg/mL) was slightly higher than that (10 µg/mL) for mCAR (Table 1). Due to the normalization of CAR transactivation potency, the LOEC for p,p′-DDT estimated in the present study (1 µg/mL) was lower than that (10 µg/mL) presented in our previous study (29). Considering that the residue levels of p,p′-DDT in the liver of wild Baikal seals were in the range from 0.12 to 4.0 µg/g wet weight (29), comparison of the LOEC with the residue level of p,p′-DDT indicates that about 10% of wild Baikal seal population accumulates this chemical at the level exceeding the LOEC. Weak alterations of CAR transactivation potency by certain PBDE congeners were detected in both seal and mouse (Figure 2). This indicates that some PBDE congeners might be partial ligands for CARs. It is reported that CYP2B and CYP3A genes are induced only by high doses of PBDEs in rats (15) and also some PBDE congeners are activators of PXR (16). Therefore, it seems that rather than CAR, PXR is activated more by PBDE congeners in mammalian species. To evaluate the structure-activity relationship for CAR activation, we compared CAR activities between PCB and PBDE congeners with the same IUPAC number (halogens (Cl or Br) are substituted in the identical positions of the phenyl rings). Both bsCAR and mCAR were activated by PCB99 and PCB153 but not by PBDE99 and PBDE153. As a result of evaluating CYP2B6 and CYP3A4 inducers in two separate studies, it has been suggested that hCAR is less flexible in its interactions with xenobiotics, when compared with the highly promiscuous hPXR (34, 35). This observation is supported by the recently characterized crystal structure for the CAR ligand binding domain, which reveals the volume of the hCAR ligand binding pocket (675 Å3) to be remarkably smaller than that of hPXR (1290-1540 Å3) (36-39). Although only a few studies are available on the direct interaction between CAR and chemicals (26, 37-39), and particularly, there is no direct evidence on interaction of CAR with POPs and BFRs, the small ligand-binding pocket in CAR may be the reason for the differences in responses to PCBs and PBDEs. PBDEs may not be able to enter the CAR ligand-binding pocket due to their higher molecular sizes than PCBs (e.g., molecular weight of PBDE99 564.7, PBDE153 643.6 vs. PCB99 326.4, PCB153 360.9). Potential of Seal Species to Respond to PB-Type Environmental Chemicals. The present study demonstrated that bsCAR could actually respond to PB-type environmental contaminants, although the ligand profile in bsCAR is different from that in mCAR. During the past several decades, some investigations have focused on elucidating the association between residue levels of PBtype environmental chemicals and expression levels of CYP2B in aquatic mammals like seals. Data on the occurrence of the CYP2B subfamily and its catalytic properties, which have been mostly reported in rodents and humans, are still limited for seal species. Some immunoblotting analyses revealed that seal liver expresses one or multiple CYP2B-like protein(s) that can cross-react with polyclonal antibodies against dog CYP2B11 (40), or monoclonal antibodies against rat CYP2B1/2 (41, 42). Even if CYP2B enzymes are present in seal species, they probably have a different catalytic function from CYP2B enzymes in terrestrial mammals, and there is a still doubt if CYP2B expression is a good biomarker of exposure to “classical” PB-type contaminants in seals (43). For example, several previous studies have shown that a marker for CYP2B

activity, pentoxyresorufin O-dealkylation, is measurable in seal liver microsomes, but this enzyme activity is not associated with CYP2B expression in these seal species, but rather with CYP1A (44-46). Therefore, there has been a question whether or not seals can react to PB-type environmental chemicals like POPs. Our in vitro approach using a cell-based bioassay constructed with CAR cDNA from species of interest could give an answer to the longterm question. On the other hand, molecular mechanisms underlying the species differences in the CAR signaling pathway are not yet elucidated. While in experimental animals such as rodents and human, CYP2B and CYP3A have been identified as typical CAR target genes by transactivation analysis of the promoter region of these genes, several questions remain regarding the seal species. Are CYP2B and 3A real target genes of CAR in the seal? If so, how do the transactivation potentials of these CYP genes by PB-type environmental chemicals occur through the seal CAR? In addition, there are only a few reports available on direct interaction between CAR and chemicals. Quantification of the ligand binding affinity and understanding the correlation between the affinity to CAR and transactivation potential are important to clarify species differences in the CAR signaling pathway.

Acknowledgments We thank Prof. An. Subramanian, Ehime University, for critical reading of this manuscript. This study was supported by Grants-in-Aid for Scientific Research (A) (17208030) and (S) (21221004 and 20221003) from Japan Society for the Promotion of Science, and “21st Century COE Program” and “Global COE Program” from the Ministry of Education, Culture, Sports, Science and Technology, Japan. This research was also supported in part by Basic Research in ExTEND2005 (Enhanced Tack on Endocrine Disruption) from the Ministry of Environment, Japan.

Supporting Information Available Chemical structure of environmental chemicals tested; transactivation potential of CAR by POPs or androstenol and POPs cotreatment. This material is available free of charge via the Internet at http://pubs.acs.org.

Literature Cited (1) Timsit, Y. E.; Negishi, M. CAR and PXR: the xenobiotic-sensing receptors. Steroids 2007, 72, 231–246. (2) Yoshinari, K.; Kobayashi, K.; Moore, R.; Kawamoto, T.; Negishi, M. Identification of the nuclear receptor CAR: HSP90 complex in mouse liver and recruitment of protein phosphatase 2A in response to phenobarbital. FEBS Lett. 2003, 548, 17–20. (3) Sueyoshi, T.; Negishi, M. Phenobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu. Rev. Pharmacol. Toxicol. 2001, 41, 123–143. (4) Lee, A. J.; Cai, M. X.; Thomas, P. E.; Conney, A. H.; Zhu, B. T. Characterization of the oxidative metabolites of 17betaestradiol and estrone formed by 15 selectively expressed human cytochrome p450 isoforms. Endocrinology 2003, 144, 3382–3398. (5) Qatanani, M.; Zhang, J.; Moore, D. D. Role of the constitutive androstane receptor in xenobiotic-induced thyroid hormone metabolism. Endocrinology 2005, 146, 995–1002. (6) Wagner, M.; Halilbasic, E.; Marschall, H. U.; Zollner, G.; Fickert, P.; Langner, C.; Zatloukal, K.; Denk, H.; Trauner, M. CAR and PXR agonists stimulate hepatic bile acid and bilirubin detoxification and elimination pathways in mice. Hepatology 2005, 42, 420–430. (7) Yamamoto, Y.; Moore, R.; Goldsworthy, T. L.; Negishi, M.; Maronpot, R. R. The orphan nuclear receptor constitutive active/ androstane receptor is essential for liver tumor promotion by phenobarbital in mice. Cancer Res. 2004, 64, 7197–7200. (8) Tanabe, S.; Iwata, H.; Tatsukawa, R. Global contamination by persistent organochlorines and their ecotoxicological impact on marine mammals. Sci. Total Environ. 1994, 154, 163–177. VOL. 43, NO. 16, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6395

(9) Gill, U.; Chu, I.; Ryan, J. J.; Feeley, M. Polybrominated diphenyl ethers: human tissue levels and toxicology. Rev. Environ. Contam. Toxicol. 2004, 183, 55–97. (10) Hites, R. A. Polybrominated diphenyl ethers in the environment and in people: A meta-analysis of concentrations. Environ. Sci. Technol. 2004, 38, 945–956. (11) Connor, K.; Safe, S.; Jefcoate, C. R.; Larsen, M. Structuredependent induction of CYP2B by polychlorinated biphenyl congeners in female Sprague-Dawley rats. Biochem. Pharmacol. 1995, 50, 1913–1920. (12) Craft, E. S.; DeVito, M. J.; Crofton, K. M. Comparative responsiveness of hypothyroxinemia and hepatic enzyme induction in Long-Evans rats versus C57BL/6J mice exposed to TCDDlike and phenobarbital-like polychlorinated biphenyl congeners. Toxicol. Sci. 2002, 68, 372–380. (13) Nims, R. W.; Lubet, R. A. Induction of cytochrome P-450 in the Norway rat Rattus norvegicus, following exposure to potential environmental contaminants. J. Toxicol. Environ. Health 1995, 46, 271–292. (14) Wyde, M. E.; Bartolucci, E.; Ueda, A.; Zhang, H.; Yan, B.; Negishi, M.; You, L. The environmental pollutant 1,1-dichloro-2,2-bis (p-chlorophenyl)ethylene induces rat hepatic cytochrome P450 2B and 3A expression through the constitutive androstane receptor and pregnane X receptor. Mol. Pharmacol. 2003, 64, 474–481. (15) Sanders, J. M.; Burka, L. T.; Smith, C. S.; Black, W.; James, R.; Cunningham, M. L. Differential expression of CYP1A, 2B, and 3A genes in the F344 rat following exposure to a polybrominated diphenyl ether mixture or individual components. Toxicol. Sci. 2005, 88, 127–133. (16) Pacyniak, E. K.; Cheng, X.; Cunningham, M. L.; Crofton, K.; Klaassen, C. D.; Guo, G. L. The flame retardants, polybrominated diphenyl ethers, are pregnane X receptor activators. Toxicol. Sci. 2007, 97, 94–102. (17) Germer, S.; Piersma, A. H.; van der Ven, L.; Kamyschnikow, A.; Fery, Y.; Schmitz, H. J.; Schrenk, D. Subacute effects of the brominated flame retardants hexabromocyclododecane and tetrabromobisphenol A on hepatic cytochrome P450 levels in rats. Toxicology 2006, 218, 229–236. (18) Nakata, H.; Tanabe, S.; Tatsukawa, R.; Amano, M.; Miyazaki, N.; Petrov, E. A. Persistent organochlorine residues and their accumulation kinetics in Baikal seal (Phoca sibirica) from Lake Baikal, Russia. Environ. Sci. Technol. 1995, 29, 2877–2885. (19) Nakata, H.; Tanabe, S.; Tatsukawa, R.; Amano, M.; Miyazaki, N.; Petrov, E. A. Bioaccumulation profiles of polychlorinated biphenyls including coplanar congeners and possible toxicological implications in Baikal seal (Phoca sibirica). Environ. Pollut. 1997, 95, 57–65. (20) Iwata, H.; Watanabe, M.; Okajima, Y.; Tanabe, S.; Amano, M.; Miyazaki, N.; Petrov, E. A. Toxicokinetics of PCDD, PCDF, and coplanar PCB congeners in Baikal seals, Pusa sibirica: age-related accumulation, maternal transfer, and hepatic sequestration. Environ. Sci. Technol. 2004, 38, 3505–3513. (21) Ishibashi, H.; Iwata, H.; Kim, E. Y.; Tao, L.; Kannan, K.; Amano, M.; Miyazaki, N.; Tanabe, S.; Batoev, V. B.; Petrov, E. A. Contamination and effects of perfluorochemicals in Baikal seal (Pusa sibirica). 1. Residue level, tissue distribution, and temporal trend. Environ. Sci. Technol. 2008, 42, 2295–2301. (22) Kim, E. Y.; Iwata, H.; Suda, T.; Tanabe, S.; Amano, M.; Miyazaki, N.; Petrov, E. A. Aryl hydrocarbon receptor (AHR) and AHR nuclear translocator (ARNT) expression in Baikal seal (Pusa sibirica) and association with 2,3,7,8-TCDD toxic equivalents and CYP1 expression levels. Comp. Biochem. Physiol. C 2005, 141, 281–291. (23) Hirakawa, S.; Iwata, H.; Takeshita, Y.; Kim, E. Y.; Sakamoto, T.; Okajima, Y.; Amano, M.; Miyazaki, N.; Petrov, E. A.; Tanabe, S. Molecular characterization of cytochrome P450 1A1, 1A2, and 1B1, and effects of polychlorinated dibenzo-p-dioxin, dibenzofuran, and biphenyl congeners on their hepatic expression in Baikal seal (Pusa sibirica). Toxicol. Sci. 2007, 97, 318–335. (24) Kim, E. Y.; Suda, T.; Iwata, H.; Petrov, E. A.; Tanabe, S. Relative potencies for AHR-mediated toxicity of dioxins and related compounds in Baikal seal (Pusa sibirica) estimated by in vitro bioassay. Organohalogen Compd. 2007, 69, 1850–1853. (25) Ishibashi, H.; Iwata, H.; Kim, E. Y.; Tao, L.; Kannan, K.; Tanabe, S.; Batoev, V. B.; Petrov, E. A. Contamination and effects of perfluorochemicals in Baikal seal (Pusa sibirica). 2. Molecular characterization, expression level, and transcriptional activation of peroxisome proliferator-activated receptor alpha. Environ. Sci. Technol. 2008, 42, 2302–2308. 6396

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 16, 2009

(26) Moore, L. B.; Parks, D. J.; Jones, S. A.; Bledsoe, R. K.; Consler, T. G.; Stimmel, J. B.; Goodwin, B.; Liddle, C.; Blanchard, S. G.; Willson, T. M.; Collins, J. L.; Kliewer, S. A. Orphan nuclear receptors constitutive androstane receptor and pregnane X receptor share xenobiotic and steroid ligands. J. Biol. Chem. 2000, 275, 15122–15127. (27) Moore, L. B.; Maglich, J. M.; McKee, D. D.; Wisely, B.; Willson, T. M.; Kliewer, S. A.; Lambert, M. H.; Moore, J. T. Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define three pharmacologically distinct classes of nuclear receptors. Mol. Endocrinol. 2002, 16, 977–986. (28) Tzameli, I.; Pissios, P.; Schuetz, E. G.; Moore, D. D. The xenobiotic compound 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene is an agonist ligand for the nuclear receptor CAR. Mol. Cell. Biol. 2000, 20, 2951–2958. (29) Sakai, H.; Iwata, H.; Kim, E. Y.; Tsydenova, O.; Miyazaki, N.; Petrov, E. A.; Batoev, V. B.; Tanabe, S. Constitutive androstane receptor (CAR) as a potential sensing biomarker of persistent organic pollutants (POPs) in aquatic mammal: molecular characterization, expression level, and ligand profiling in Baikal seal (Pusa sibirica). Toxicol. Sci. 2006, 94, 57–70. (30) Maglich, J. M.; Parks, D. J.; Moore, L. B.; Collins, J. L.; Goodwin, B.; Billin, A. N.; Stoltz, C. A.; Kliewer, S. A.; Lambert, M. H.; Willson, T. M.; Moore, J. T. Identification of a novel human constitutive androstane receptor (CAR) agonist and its use in the identification of CAR target genes. J. Biol. Chem. 2003, 278, 17277–17283. (31) Forman, B. M.; Tzameli, I.; Choi, H. S.; Chen, J.; Simha, D.; Seol, W.; Evans, R. M.; Moore, D. D. Androstane metabolites bind to and deactivate the nuclear receptor CAR-beta. Nature 1998, 395, 612–615. (32) Kajiwara, N.; Ueno, D.; Takahashi, A.; Baba, N.; Tanabe, S. Polybrominated diphenyl ethers and organochlorines in archived northern fur seal samples from the Pacific coast of Japan, 1972-1998. Environ. Sci. Technol. 2004, 38, 3804–3809. (33) Ramu, K.; Kajiwara, N.; Lam, P. K.; Jefferson, T. A.; Zhou, K.; Tanabe, S. Temporal variation and biomagnification of organohalogen compounds in finless porpoises (Neophocaena phocaenoides) from the South China Sea. Environ. Pollut. 2006, 144, 516–523. (34) Faucette, S. R.; Sueyoshi, T.; Smith, C. M.; Negishi, M.; Lecluyse, E. L.; Wang, H. Differential regulation of hepatic CYP2B6 and CYP3A4 genes by constitutive androstane receptor but not pregnane X receptor. J. Pharmacol. Exp. Ther. 2006, 317, 1200– 1209. (35) Faucette, S. R.; Zhang, T. C.; Moore, R.; Sueyoshi, T.; Omiecinski, C. J.; LeCluyse, E. L.; Negishi, M.; Wang, H. Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CYP3A4 inducers. J. Pharmacol. Exp. Ther. 2007, 320, 72–80. (36) Watkins, R. E.; Wisely, G. B.; Moore, L. B.; Collins, J. L.; Lambert, M. H.; Williams, S. P.; Willson, T. M.; Kliewer, S. A.; Redinbo, M. R. The human nuclear xenobiotic receptor PXR: structural determinants of directed promiscuity. Science 2001, 292, 2329–2333. (37) Shan, L.; Vincent, J.; Brunzelle, J. S.; Dussault, I.; Lin, M.; Ianculescu, I.; Sherman, M. A.; Forman, B. M.; Fernandez, E. J. Structure of the murine constitutive androstane receptor complexed to androstenol: a molecular basis for inverse agonism. Mol. Cell 2004, 16, 907–917. (38) Suino, K.; Peng, L.; Reynolds, R.; Li, Y.; Cha, J. Y.; Repa, J. J.; Kliewer, S. A.; Xu, H. E. The nuclear xenobiotic receptor CAR: structural determinants of constitutive activation and heterodimerization. Mol. Cell 2004, 16, 893–905. (39) Xu, R. X.; Lambert, M. H.; Wisely, B. B.; Warren, E. N.; Weinert, E. E.; Waitt, G. M.; Williams, J. D.; Collins, J. L.; Moore, L. B.; Willson, T. M.; Moore, J. T. A structural basis for constitutive activity in the human CAR/RXRalpha heterodimer. Mol. Cell 2004, 16, 919–928. (40) Goksøyr, A.; Beyer, J.; Larsen, H. E.; Andersson, T.; Fo¨rlin, L. Cytochrome P450 in seals: monooxygenase activities, immunochemical cross-reactions and response to phenobarbital treatment. Mar. Environ. Res. 1992, 34, 113116. (41) Wolkers, J.; Witkamp, R. F.; Nijmeijer, S. M.; Burkow, I. C.; de Groene, E. M.; Lydersen, C.; Dahle, S.; Monshouwer, M. Phase I and phase II enzyme activities in ringed seals (Phoca hispida): characterization of hepatic cytochrome P450 by activity patterns, inhibition studies, mRNA analyses, and western blotting. Aquat. Toxicol. 1998, 44, 103–115.

(42) Wolkers, J.; Burkow, I. C.; Monshouwer, M.; Lydersen, C.; Dahle, S.; Witkamp, R. F. Cytochrome P450-mediated enzyme activities and polychlorinated biphenyl accumulation in harp seal (Phoca groenlandica). Mar. Environ. Res. 1999, 48, 5972. (43) Nyman, M.; Raunio, H.; Taavitsainen, P.; Pelkonen, O. Characterization of xenobiotic-metabolizing cytochrome P450 (CYP) forms in ringed and grey seals from the Baltic Sea and reference sites. Comp. Biochem. Physiol. C 2001, 128, 99–112. (44) Mattson, M.; Raunio, H.; Pelkonen, O.; Helle, E. Elevated levels of cytochrome P4501A (CYP1A) in ringed seals from the Baltic Sea. Aquat. Toxicol. 1998, 43, 41–50.

(45) Nyman, M.; Raunio, H.; Pelkonen, O. Expression and inducibility of members in the cytochrome P4501 (CYP1) family in ringed and grey seals from polluted and less polluted waters. Environ. Toxicol. Pharmacol. 2000, 8, 217–225. (46) Chiba, I.; Sakakibara, A.; Iwata, T. H.; Ishizuka, M.; Tanabe, S.; Akahori, F.; Kazusaka, A.; Fujita, S. Hepatic microsomal cytochrome P450s and chlorinated hydrocarbons in largha and ribbon seals from Hokkaido, Japan: differential response of seal species to Ah receptor agonist exposure. Environ. Toxicol. Chem. 2002, 21, 794–806.

ES901120R

VOL. 43, NO. 16, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6397