Transcriptional Regulation of Human UDP-Glucuronosyltransferase

Subscriber access provided by University of Colorado Boulder

Article

Transcriptional Regulation of Human UDP-glucuronosyltransferase 2B10 by Farnesoid X Receptor in Human Hepatoma HepG2 Cells Danyi Lu, Shuai Wang, Qian Xie, Lianxia Guo, and Baojian Wu Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.6b01103 • Publication Date (Web): 07 Mar 2017 Downloaded from http://pubs.acs.org on March 9, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Transcriptional Regulation of Human UDP-glucuronosyltransferase 2B10 by Farnesoid X Receptor in Human Hepatoma HepG2 Cells

Danyi Lu, Shuai Wang, Qian Xie, Lianxia Guo, Baojian Wu*

Division of Pharmaceutics, College of Pharmacy, Jinan University, 601 Huangpu Avenue West, Guangzhou 510632, China

Running Title: FXR-mediated regulation of UGT2B10

* Address correspondence to: Baojian Wu, Ph.D E-mail: [email protected]

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Graphic


2

Page 2 of 38

Page 3 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract Little is known about transcriptional regulators of UDP-glucuronosyltransferase 2B10 (UGT2B10), an enzyme known to glucuronidate many chemicals and drugs such as nicotine and tricyclic antidepressants. Here, we uncovered that UGT2B10 was transcriptionally regulated by farnesoid X receptor (FXR), the bile acid sensing nuclear receptor. GW4064 and chenodeoxycholic acid (two specific FXR agonists) treatment of HepG2 cells led to a significant increase in the mRNA level of UGT2B10. The treated cells also showed enhanced glucuronidation activities toward amitriptyline (an UGT2B10 probe substrate). In reporter gene assays, the extent of UGT2B10 activation by the FXR agonists was positively correlated with the amount of co-transfected FXR. Consistently, knockdown of FXR by shRNA attenuated the induction effect of FXR activation on UGT2B10 expression. Furthermore, a combination of electrophoretic mobility shift assay and chromatin immunoprecipitation showed that the FXR receptor trans-activated UGT2B10 through its specific binding to the -209- to -197-bp region (an IR1 element) of the UGT2B10 promoter. In summary, our results for the first time established FXR as a transcriptional regulator of human UGT2B10.

Keywords: UGT2B10, Glucuronidation, FXR, Transcriptional regulation.


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abbreviations used: 9-cis-RA, 9-cis-retinoid acid; BSEP, bile salt export pump; CDCA, chenodeoxycholic acid; ChIP, chromatin immunoprecipitation assays; DMEM, Dulbecco’s Modified Eagle Medium/High glucose; DMSO, dimethyl sulfoxide; EMSA, electrophoretic mobility shift assays; FBS, fetal bovine serum; FXR, farnesoid X receptor; GW4064, 3-(2,6-Dichlorophenyl)-4-(3’-carboxy-2-chlorostilben-4-yl)oxymethyl-5-isopropylisoxazole; IR1, inverted repeats separated by one nucleotide; MS, mass spectroscopy; NR, nuclear receptor; qRT-PCR, quantitative reverse-transcription polymerase chain reaction; QTOF, quadrupole time-of-flight; RXR, retinoid X-receptor; UDPGA, uridine diphosphoglucuronic acid; UGT, UDP-glucuronosyltransferase; UPLC, ultra performance liquid chromatography.


4

Page 4 of 38

Page 5 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction UDP-glucuronosyltransferase (UGT) mediated glucuronidation is responsible for metabolism and detoxification of numerous endogenous and exogenous compounds (including many drugs).1-3 Human UGTs are divided into five subfamilies of enzymes, namely, UGT1A, UGT2A, UGT2B, UGT3A and UGT8A.4 Enzymes of UGT1A and 2B are rather active in catalyzing glucuronidation reactions, contributing predominantly to body hemostasis and xenobiotic metabolism. Glucuronidation is a conjugative reaction wherein the glucuronic acid moiety from the cofactor UDPGA is added to the functional groups (e.g., hydroxyl, carboxyl and amine) in the substrates.1 N-glucuronidation refers to a type of glucuronidation reaction in which glucuronic acid is conjugated to amine groups of the substrates (e.g., primary aromatic amines, amides, hydroxylamines, tertiary aliphatic amines, and aromatic N-heterocycles).5 UGT2B10 is a UGT enzyme that efficiently catalyzed N-glucuronidation reactions.5, 6

The substrates of UGT2B10 include nicotine, cotinine, tobacco-specific nitrosamines,

and tricyclic antidepressants.7-11 Although UGT1A4 is another enzyme that catalyzes N-glucuronidation (the enzyme also catalyzes O-glucuronidation reactions), UGT2B10 may be a more important player in N-glucuronidation because of its higher catalytic efficiency.12,

13

UGT2B10 is reported to be involved in the detoxification of

4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol

(NNAL),


5

a

potent

carcinogenic


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

nitrosamine from tobacco, thus is associated with the cancer risk of individuals with exposure to tobacco smoke.14 In a recent clinical trial, a UGT2B10 allele (in 45% Africans) causes a marked reduction (< 0.01% of normal) in the intrinsic clearance of an anti-schizophrenia drug.15 These findings highlight an important role of UGT2B10 in detoxification and elimination of xenobiotics including carcinogens and drugs. UGT2B10 is mainly distributed in the liver.16 Hepatic expression of this enzyme shows a large (up to 195-fold in mRNA level, and up to 24-fold in protein level) inter-individual variability.17-19 It remains unknown as to why UGT2B10 expression is highly varied in humans. In general, the expression of drug-metabolizing enzymes (e.g., CYPs and UGTs) is transcriptionally regulated by ligand-activated transcription factors including nuclear receptors (NRs), such as aryl-hydrocarbon receptor (AhR), constitutive androstane receptor (CAR), pregnane X receptor (PXR), and peroxisome proliferator-activated receptor α (PPARα).20-24 Expression regulation of several UGTs (UGT1A1, 1A3, 1A9, 2B4, and 2B7) in the liver by AhR and NRs (CAR, PXR, PPARα) has been proposed to contribute to the inter-individual variations of these enzymes.21, 25 However, whether UGT2B10 is subjected to NR-mediated regulation and how this regulation contributes to its high inter-individual expression variability remain to be determined. UGT2B10 plays an important role in metabolism and detoxification of therapeutic


6

Page 6 of 38

Page 7 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


agents (tricyclic antidepressants), carcinogens (tobacco-specific nitrosamines), and toxins (nicotine and cotinine). In the present study, we uncovered that UGT2B10 was transcriptionally regulated by farnesoid X receptor (FXR), the bile acid sensing nuclear receptor. The regulatory effects of FXR on UGT2B10 were determined in HepG2 cells using specific FXR agonists. The regulatory effects were also evaluated through up-regulation and down-regulation of FXR. Furthermore, a combination of reporter gene

assay,

electrophoretic

mobility

shift

assay

(EMSA)

and

chromatin

immunoprecipitation (ChIP) was employed to identify the binding element of FXR in the UGT2B10 gene promoter.


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2. Materials and methods 2.1. Materials 3-(2,6-Dichlorophenyl)-4-(3’-carboxy-2-chlorostilben-4-yl)oxymethyl-5-isopropylisoxazo le (GW4064), 9-cis-retinoid acid (9-cis-RA), uridine diphosphoglucuronic acid (UDPGA), D-saccharic-1,4-lactone monohydrate, chenodeoxycholic acid (CDCA), Dulbecco’s Modified Eagle Medium (DMEM, high glucose), and alamethicin, were purchased from Sigma-Aldrich (St Louis, MO). Amitriptyline was purchased from J & K Chemical Ltd. (Beijing, China). Fetal bovine serum (FBS) and trypsin were obtained from Hyclone (Logan, UT). 2.2. Cell culture and treatment HepG2 cells were purchased from the American Type Culture Collection (Manassas, VA) and maintained at 37°C under 5% CO2 in DMEM supplemented with 10% FBS. Cells were seeded in a 12-well plate (Corning Life Sciences, Acton, MA) at a density of 2 × 105 cells/well. On the next day, culture medium was changed to phenol-free DMEM containing vehicle (DMSO) or FXR agonists. 2.3. Real-time polymerase chain reaction (qPCR) Total RNA was prepared using RNAiso Plus reagent (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. The yield and quality of RNA were analyzed using a DeNovix DS-11 spectrophotometer (DeNovix, Wilmington, DE). cDNA


8

Page 8 of 38

Page 9 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was synthesized from 500 ng of total RNA using the PrimeScriptTM RT Master Mix (Perfect Real Time) (Takara Bio Inc., Shiga, Japan). Quantification of mRNA levels was performed with 50 ng cDNA and 200 nM PCR primers of each gene using a real-time PCR cycler (TOptical thermocycler, Biometra, Göttingen, Germany) using GoTaq® qPCR Master Mix (Promega, Madison, WI). The sequences of all primers were summarized (Table 1). The specificity of all primers was checked by BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/). PCR amplification reactions consisted of an initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. The amplification specificity was verified by performing a melting curve analysis with a temperature gradient of 0.1°C/s from 65 to 95°C. Glyceraldehyde-3-phosphate (GAPDH) was used as an internal control. The relative changes in gene expression were determined using the 2-∆∆CT method.26 2.4. Plasmid construction Human FXR and RXRα (GenBank accession numbers: NM_005123.3 and NM_002957.5, respectively) genes were synthesized and cloned into the EcoRI and HindIII sites of the expression vectors pcDNA3.1(-) (Invitrogen, Carlsbad, CA). A ~2-kb UGT2B10 proximal promoter (-2000/+27; +1 indicates the transcription initiation site) was synthesized and cloned into the NheI and HindIII sites of the blank pGL4.11 vector


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Promega, Madison, WI). Shorter promoter sequences (-1.8 kb, -0.3 kb and -0.15 kb) were prepared by PCR from the -2000/+27 UGT2B10 promoter plasmid using primers containing a NheI or a HindIII restriction enzyme site (Table 1). The -0.3 kb mutant sequence was synthesized, of which the UGT2B10-IR1 was mutated from ‘AGGTCAtTAAACT’ to ‘AAATCAtTACACT’. The obtained fragments were cloned into the pGL4.11 plasmid. shRNA for FXR and RXR (sequence from literatures27, 28) was synthesized and ligated into pLVX-ShRNA2-Neo plasmid as described.29 All constructs were verified by DNA sequencing. After transformed into E. coli JM109, plasmids were isolated using EasyPure HiPure Plasmid MiniPrep kits (TransGen Biotech, Beijing, China) according to the manufacturer's instructions. 2.5. Luciferase reporter assays Cells were seeded in 48-well plates (Corning Life Sciences, Acton, MA) at a density of 5 × 104 cells/well and cultured overnight. Cells were then transfected with 500 ng of UGT2B10 luciferase (firefly) reporter plasmid, 50 ng of pRL-TK vector (an internal control with renilla luciferase gene), and with or without 200 ng of FXR or FXR/RXRα expression vectors. For FXR silencing experiments, 400 ng shRNA plasmid was co-transfected with the reporter plasmids. Cell transfection was performed using the HET transfection reagent (Biowit Technologies Ltd, Shenzhen, China). On the next day, the cells were treated with vehicle or FXR agonist (CDCA or GW4064). After 24-h


10

Page 10 of 38

Page 11 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


treatment, cells were lysed in 200 µl passive lysis buffer. The cell lysate was collected and assayed for luciferase activities using the Dual-Luciferase® Reporter Assay System and GloMaxTM 20/20 luminometer (Promega). The relative luciferase activity was initially derived as the ratio of UGT2B10 luciferase (firefly) over renilla luciferase activities. The relative luciferase activity values of treated cells were normalized to that of control cells. 2.6. Electrophoretic mobility shift assays (EMSA)

Nuclear proteins from HepG2 cells were isolated using a cytoplasmic/nuclear protein extraction kit (Beyotime, Shanghai, China). Probes were prepared by annealing complementary sense and antisense oligonucleotides. EMSA assays were performed using a chemiluminescent EMSA kit (Beyotime). In brief, 6-µg of nuclear extract was mixed well with the EMSA binding buffer and the mixture was placed on an ice bath for 10-min. 200-fmol of biotin-labeled probe was then added to the reaction mixture and allowed for an another 20-min incubation at room temperature. For competition reactions, a 50-fold molar excess of unlabeled wide-type or mutated probes were added into the reaction mixture prior to the initial incubation. The DNA-protein complexes were loaded onto 5% nondenaturing polyacrylamide gels containing 2.5% glycerol in 0.5× Tris-borate-EDTA buffer (44.5 mM Tris, 44.5 mM borate, 1 mM EDTA, pH 8.3). After electrophoresis, the fragments in the gels were transferred onto HybondTM-N+ membranes (Amersham, Buckinghamshire, UK), and visualized by using


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the enhanced chemiluminesence reagent and an Omega LumTM G imaging system (Aplegen, Pleasanton, CA). 2.7. Chromatin immunoprecipitation assays (ChIP) ChIP assays were performed using a SimpleChIP® Enzymatic Chromatin IP Kit (Cell Signaling Technology, Beverly, MA) according to the manufacturer’s instructions. In brief, HepG2 cells were cultured in 10-cm dishes and treated with vehicle or 2.5-µM GW4064 for 24 h. Cells were then cross-linked with 1% formaldehyde, followed by quench with glycine and digestion with micrococcal nuclease. After sonication and centrifugation (4°C), the supernatant was transferred to Eppendorf tubes and stored at -80°C until use. The cross-linked chromatins after digestion were verified to be a length of approximately 100-1000 bp by electrophoresis (1% agarose gels). DNA concentrations were determined using the DS-11 spectrophotometer (DeNovix). Chromatin complexes were incubated overnight with 2-µg of anti-FXR or normal rabbit IgG (negative control) at 4°C. Protein G magnetic beads were then added to each ChIP sample and incubated for 2-h at 4°C. Beads were collected by placing the tubes in a magnetic separation rack, and washed with low and high salt washes. Chromatins were eluted from the antibody/protein G magnetic beads with the elution buffer (30-min, 65°C). Cross-linking was reversed by incubation with NaCl and proteinase K for 2-h at 65°C. DNA was purified using spin columns and stored at -80°C until use. Real-time PCR analyses were performed as described previously using primers encompassing


12

Page 12 of 38

Page 13 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the FXR binding sites of bile salt export pump (BSEP) and UGT2B10 promoters. 2.8. Western blot analysis Cell lysate was prepared using RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with 1 mM PMSF. Protein concentrations were determined by the bicinchoninic acid assay (BCA; Beyotime, Shanghai, China). Lysate samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10% acrylamide gels) and transferred onto PVDF membranes (Millipore, Bedford, MA). The membranes were blocked with 5% nonfat milk in Tris-buffered saline (20-mM Tris-HCl, 140-mM NaCl, pH 7.6) containing 0.1% Tween 20, and probed with primary antibody and horseradish peroxidase-conjugated secondary antibody. Protein bands were detected by enhanced chemiluminescence (ECL) and imaged by the Omega LumTM G imaging system (Aplegen). Rabbit polyclonal FXR (H-130, 1:250 dilution) and RXR (D-20, 1:250 dilution), and mouse monoclonal UGT2B (E-6, 1:200 dilution) antibodies were obtained from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Rabbit monoclonal GAPDH (ab181602, 1:5000 dilution) and UGT2B4 (ab173580, 1:500 dilution), and mouse monoclonal UGT2B10 (ab57685, 1:200 dilution) antibodies was obtained from Abcam (Cambridge, MA). 2.9. Glucuronidation assay HepG2 cells were cultured in 10-cm dishes, and treated with vehicle (0.1% DMSO),


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 38

5-µM GW4064, or 50-µM CDCA for 24 h. Cell pellets were collected in 100 mM Tris buffers (PH 7.4), and subjected to three freeze-thaw cycles and then 10-15 strokes in a tight-fitting Dounce homogenizer. After centrifugation at 4°C for 5 min, cell lysate was collected and stored at -80°C. Protein concentration of the cell lysate was determined using the BCA assay kit (Beyotime, Shanghai, China). The glucuronidation assays using cell lysate were performed as described previously with minor modifications 30. In brief, cell lysate (100 µg of total protein) was incubated with MgCl2 (4 mM), alamethicin (20 µg/ml), UDPGA (5 mM), and amitriptyline (5 µM) in 100 mM Tris buffers (pH 7.4) at 37 ℃ for 4 h. The reaction was terminated by the addition of 100 µl of ice-cold acetonitrile, followed by vortex and centrifugation (10 min; 15,000 × g). The supernatant was collected and subjected to UPLC-QTOF/MS analysis. To assess the effects of FXR activation on the glucuronidation activity of UGT2B10 in intact cells, HepG2 cells were seeded into 12-well plates and treated as indicated above. The cells were then incubated with Hanks' balanced salt solution containing 5 µM amitriptyline at 37°C for 6 h. The extracellular medium were collected and subjected to UPLC-QTOF/MS analysis. Amitriptyline glucuronide was quantified using an ACQUITY UPLC-QTOF/MS system (Waters, Milford, MA) and an ACQUITY BEH C18 column (2.1 × 50 mm, 2.6 µm; Waters, Milford, MA). The mobile phase was 0.1% formic acid (mobile phase A) and 0.1%


14

Page 15 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


formic acid in acetonitrile (mobile phase B). The flow rate was set at 0.25 ml/min. The gradient elution program was 20% B at 0 to 1 min, 20 to 95% B at 1 to 3.3 min, and 95 to 20% B at 3.3 to 4 min. Mass spectrometer was operated at the positive ion full scan mode. The capillary, sampling cone, and extraction cone voltages were 3000, 25 and 4 V, respectively. The source and desolvation temperature were 120 and 400°C, respectively. Peak area of amitriptyline glucuronide was recorded with an extract mass of m/z 454.27 ± 0.05 Da. 2.10. Statistical analysis Data are presented as mean ± SD. Statistical differences were analyzed by one-way analysis of variance or Student’s t test as appropriate, and the level of significance was set at p < 0.05 (*) or p < 0.01 (**) or p < 0.001 (***).


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 38

3. Results 3.1. FXR agonists induced UGT2B10 expression The FXR agonists GW4064 (5 µM) and CDCA (50 µM) significantly increased UGT2B10 mRNA levels in HepG2 cells (Figure 1A). These two FXR agonists also significantly enhanced the glucuronidation activities of HepG2 cells toward amitriptyline, a probe substrate of UGT2B10 (Figure 1B). We were unable to determine the changes in protein level of UGT2B10 because commercial anti-UGT2B10 antibody (ab57685; Abcam, Cambridge, MA) failed to react with UGT2B10 protein from HepG2 cells. 3.2. FXR activated UGT2B10 promoter Reporter gene assays were performed to determine the regulatory effects of FXR on UGT2B10. The luciferase reporter was driven by a 2 kb UGT2B10 promoter. GW4064 (1-10 µM) and CDCA (25-100 µM) significantly enhanced the promoter activity (Figure 2A). The enhancement effect was positively correlated with the FXR levels (Figure 2B), indicating that UGT2B10 expression can be regulated by FXR.

However,

co-transfection of RXR plasmid slightly antagonized the induction by FXR activation (Figure 2C). 3.3. The FXR binding site is within the proximal region of UGT2B10 promoter Binding regions of FXR were predicted using two online algorithms, Genomatix (http://www.genomatix.de/) and NUBIScan (http://www.nubiscan.unibas.ch/). Three IR1


16

Page 17 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


motifs were predicted to be the potential binding sites of FXR (Figure 3A). Accordingly, three shorter promoter constructs (i.e., 1.8 kb, 0.3 kb, and 0.15 kb) with the deletion of one or more IR1 motifs were generated (Figure 3A). Compared to the blank vector (pGL4.11-basic), 64-fold, 45-fold and 20-fold increases (p < 0.01) in transcriptional activity were observed for the 2 kb, 1.8 kb, and 0.3 kb constructs, respectively (Figure 3B). However, the 0.15 kb construct did not exhibit significant difference in luciferase activity compared to the pGL4.11-basic vector (Figure 3B). The results suggested that the core regulatory element responsible for UGT2B10 promoter activity was located between -0.3 and -0.15 kb. Furthermore, GW4064 and CDCA consistently increased the activities of 2 kb, 1.8 kb, and 0.3 kb promoters. Co-transfection of FXR significantly enhanced the regulatory effects (Figures 4A). However, no activation effects were observed for 0.15 kb promoter (Figure 4A). Similarly, a mutant of 0.3 kb promoter (a putative FXR-IR1 binding site) abolished the transcriptional induction of UGT2B10 by FXR activation (Figure 4A). Moreover, knockdown of FXR by shRNA attenuated the induction effects (Figure 4B). Incomplete knockdown of FXR (with ~46% residual expression) might account for the activation effect of GW4064 in the presence of FXR-shRNA (Figure 4B/C). Taken together, FXR regulated UGT2B10 expression via binding to the proximal region (-0.3 ~ -0.15 kb) of the promoter.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.4. FXR binds to the IR1 motif at positions -209 to -197 in the UGT2B10 promoter Electrophoretic mobility shift assay (EMSA) was performed to determine whether FXR binds to the putative response element (UGT2B10-IR1) in the promoter. A biotin-labeled dimerized oligonucleotide (i.e., -213 to -193 bp of UGT2B10 promoter) was incubated with nuclear extracts from HepG2 cells. BSEP-IR1 (a positive control) formed a DNA-protein complex (i.e., BSEP-IR1-FXR) that disappeared with the addition of excess unlabeled BSEP-IR1 (Figure 5). Similarly, the UGT2B10-IR1 probe was able to form a complex with FXR protein (Figure 5). Formation of this complex was completely inhibited by the addition of unlabeled UGT2B10-IR1 oligonucleotides, and partially inhibited by the addition of mutated UGT2B10-IR1 oligonucleotide (Figure 5). Overall, the results indicated that the endogenous FXR protein bound to the UGT2B10-IR1 probe. Chromatin immunoprecipitation (ChIP) assays were also performed to determine the interactions of UGT2B10 promoter with FXR receptor. The sequence encompassing the UGT2B10-IR1 element was amplified from the precipitated chromatin DNA. Treatment with GW4064 (2.5 µM) significantly enhanced the binding of FXR to the UGT2B10 promoter (Figure 6A). Similar results were observed for FXR recruitment to the BSEP promoter that harbored an FXR response element IR1 (Figure 6B). The results indicated that GW4064 activated FXR receptor, resulting in the binding of the latter to UGT2B10 promoter.


18

Page 18 of 38

Page 19 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4. Discussion In the present study, we for the first time demonstrated that the nuclear receptor FXR was a positive regulator of human UGT2B10. First, the FXR agonists GW4064 and CDCA stimulated the expression of UGT2B10 enzyme in HepG2 cells, thereby increasing the cellular glucuronidation activity (Figure 1). Second, over-expression of FXR protein enhanced the activation of UGT2B10 promoter, whereas FXR knockdown attenuated the activation effect (Figures 2 & 4). Third, an IR1 binding element (-209- to -197-bp region) of FXR was identified in the UGT2B10 proximal promoter (Figures 3 & 5). This IR1 element was crucial for the basal expression of UGT2B10 gene and its induction by FXR agonists. Our results are consistent with the previous studies in which GW4064/CDCA could increase the expression of UGT2B10 in primary human hepatocytes and HepaRG cells.31-33 Our study lent a strong support to the notion that FXR binds to the cognate response element (preferably an IR1 motif) as an obligate heterodimer complex with RXR. First, the identified UGT2B10-IR1 motif is of high similarity to that of the FXR consensus IR1 motif,34 suggesting that FXR/RXR heterodimer might bind to this site. Second, UGT2B10-IR1 and BSEP-IR1 oligonucleotides formed similar DNA-protein complexes with nuclear proteins (Figure 5).35 Third, 9-cis-RA (a specific RXR agonist) significantly activated transcription of UGT2B10 promoters that contain the intact


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

UGT2B10-IR1 element (Figure S1A). By contrast, knockdown of RXR by shRNA attenuated the activation effects of FXR/RXR agonists on UGT2B10 promoter activity (Figure S1B). It was surprising that overexpression of RXR in HepG2 cells slightly antagonized the transcriptional activation of UGT2B10 promoter by FXR and FXR agonists (Figure 2C). Inhibition of UGT transcription by RXR overexpression was also noted in the literature. In the study of Barbier et al., RXR antagonized the expression induction of UGT2B4 by FXR.36 RXR suppressed the binding of FXR to the response element of UGT2B4 due to the formation of inactive FXR/RXR heterodimers.36 In another study, RXR ligands antagonized FXR agonist-induced up-regulation of BSEP.37 This antagonistic effect resulted from compromised co-activator recruitment and inhibited FXR/RXR binding to the BSEP promoter.37 However, it remained unknown as to why activation of UGT2B10 transcription by FXR was inhibited by RXR overexpression. Further studies are needed to address this question. UGT2B10 is responsible for detoxification and elimination of numerous amine-containing chemicals such as nicotine, NNAL, and anti-depressants.5, 8-11, 13 In addition, UGT2B10 is able to metabolize many compounds with hydroxyl or carboxyl group (e.g., ethanol, arachidonic and linoleic acid metabolites).38, 39 Of note, 5-, 12-, 15-hydroxyeicosatetraenoic acid and 13-hydroxyoctadecadieneoic acid, important


20

Page 20 of 38

Page 21 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mediators of many physiological and pathophysiological processes, are conjugated by UGT2B10 and other UGT enzymes.39 Therefore, the finding that UGT2B10 was regulated by FXR suggested an important role of FXR in chemical detoxification and disposition because modification of FXR activity would be associated with alterations in metabolism and disposition of a broad range of UGT2B10 substrates. Our study was not the first one to report that UGT enzyme is regulated by FXR. FXR had been implicated in the regulation of several UGT enzymes such as UGT1A3, UGT2B4, and UGT2B7.36,

40, 41

It was noted that human FXR bound to the similar

promoter regions of UGT2B7 (nt -207/-194, ‘GATCCTTGATATTA’) and UGT2B10 (nt -209/-197, ‘AGGTCATTAAACT’). However, activation of FXR decreased the expression of UGT2B7 in caco-2 cells,41 but increased UGT2B10 expression in HepG2 cells (Figure 1). It was reasonable to speculate that tissue-specific transcription cofactors were critical in determination of biological consequences of FXR activation. It was also noted that the UGT2B10-IR1 motif was highly conserved in the promoters of UGT2B11 and UGT2B28. Whether activation of FXR alters the expression of UGT2B11 and UGT2B28 awaits further investigations. FXR is highly responsive to its natural ligands bile acids. Thus, bile acid fluctuations caused by liver diseases such as cholestasis most likely will change the expression level of FXR-targeted genes. In addition, modulation of FXR is an attractive therapeutic


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

strategy for liver and metabolic disorders, leading to the rapid development of a number of synthetic and natural FXR ligands as the therapeutic agents.42, 43 Furthermore, FXR single-nucleotide polymorphisms were found to be associated with alterations in its gene-regulating function.44 Therefore, our studies highlighted that the disease status, drug-drug interactions and FXR polymorphisms are critical influencing factors to the expression and activity of human UGT2B10. It was noteworthy that UGT protein levels were poorly correlated with the mRNA levels (e.g., UGT1A4, 1A6, 1A9, and 2B7).18, 45 Therefore, in addition to the mRNA level, it is informative to evaluate the changes in UGT expression at the protein level in gene regulation studies. However, the amino acid sequences of UGT isoforms are highly similar, challenging the development of isoform-specific antibodies. To date, only a monoclonal antibody against UGT1A9 was developed and verified for its selectivity.45 We have tested four commercial antibodies for their feasibilities to detect the recombinant UGT2B10 enzyme and four other UGT2B isoforms (i.e., 2B4, 2B7, 2B15, 2B17). Although anti-UGT2B10 antibodies could recognize the recombinant UGT2B10 enzyme (Figure S2), it also reacted with UGT2B4 and 2B7 proteins. Also, it failed to react with the endogenous UGT2B proteins in HepG2 cells (data not shown). This is probably due to the low UGT2B10 expression in HepG2 cells. Similar problem was noted in a previous study in which the anti-UGT1A9 antibody failed to detect UGT1A9 protein in HepG2 cells.45 Even though, the enhanced cellular glucuronidation of


22

Page 22 of 38

Page 23 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


amitriptyline was the strong evidence that the UGT2B10 protein was up-regulated upon FXR activation (Figure 1B). In summary, we uncovered that UGT2B10 was transcriptionally regulated by FXR in HepG2 cells. FXR trans-activated UGT2B10 through its specific binding to the -209- to -197-bp region (an IR1 element) in the promoter.


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 38

Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 81573488),

the

Young

Scientist

Special

Projects

in

biotechnological

and

pharmaceutical field of 863 Program (2015AA020916), the Outstanding Youth Fund from the Natural Science Foundation of Guangdong Province (No. 2014A030306014) and The PhD Start-up Fund of Natural Science Foundation of Guangdong Province (No.2015A030310339).

Competing Interests' Statement The authors report no conflict of interest.

Supporting Information. Figure S1 and Figure S2 were supplied as Supporting Information.


24

Page 25 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48


Table 1 Oligonucleotides used in this study. Forward primer (5' to 3')

Reverse primer (5' to 3')

FXR

GGGTCTGCGGTTGAAGCTAT

GTCAGAATGCCCAGACGGAA

GAPDH

CATGAGAAGTATGACAACAGCCT

AGTCCTTCCACGATACCAAAGT

RXR

GACGGAGCTTGTGTCCAAGAT

AGTCAGGGTTAAAGAGGACGAT

UGT2B10

TGACATCGTTTTTGCAGATGCTTA

CAGGTACGTAGGAAGGAGGGAA

UGT2B10(-1800/+27)

CGGCTAGCATTTGCTGTTAAATTTGAGGTTTATCCC

CCAAGCTTCCTTGTGCAATGTGATAATTCTTTTC

UGT2B10(-300/+27)

CGGCTAGCCATTCTGTGTCAAGGGGCCTGC


UGT2B10(-150/+27)

CGGCTAGCCTTGAGTAAATATGAAGTAATCG


BSEP-IR1

CCCTTAGGGACATTGATCCTTAGG

CCTAAGGATCAATGTCCCTAAGGG

UGT2B10-IR1

TGCAAGGTCATTAAACTTAGG

CCTAAGTTTAATGACCTTGCA

UGT2B10-IR1(mutant) TGCAAAATCATTACACTTAGG

CCTAAGTGTAATGATTTTGCA

qRT-PCR

Reporter plasmid

EMSA

CHIP BSEP

TGTCACTGAACTGTGCTTGGGCTG

TTCACAACCTTTTCCAACCTCGGTT

UGT2B10

TTGCCACTGTTCTTGACACTA

TGGATGGCAAGGAGACAAAGTT


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

References 1. Tukey, R. H.; Strassburg, C. P. Human UDP-glucuronosyltransferases: metabolism, expression, and disease. Annual review of pharmacology and toxicology 2000, 40, 581-616. 2. Bock, K. W. Roles of human UDP-glucuronosyltransferases in clearance and homeostasis of endogenous substrates, and functional implications. Biochemical pharmacology 2015, 96, (2), 77-82. 3. Rowland, A.; Miners, J. O.; Mackenzie, P. I. The UDP-glucuronosyltransferases: their role in drug metabolism and detoxification. The international journal of biochemistry & cell biology 2013, 45, (6), 1121-32. 4. Mackenzie, P. I.; Bock, K. W.; Burchell, B.; Guillemette, C.; Ikushiro, S.; Iyanagi, T.; Miners, J. O.; Owens, I. S.; Nebert, D. W. Nomenclature update for the mammalian UDP glycosyltransferase (UGT) gene superfamily. Pharmacogenetics and genomics 2005, 15, (10), 677-85. 5. Kaivosaari, S.; Finel, M.; Koskinen, M. N-glucuronidation of drugs and other xenobiotics by human and animal UDP-glucuronosyltransferases. Xenobiotica; the fate of foreign compounds in biological systems 2011, 41, (8), 652-69. 6. Chiu, S. H.; Huskey, S. W. Species differences in N-glucuronidation. Drug metabolism and disposition: the biological fate of chemicals 1998, 26, (9), 838-47. 7. Pattanawongsa, A.; Nair, P. C.; Rowland, A.; Miners, J. O. Human UDP-Glucuronosyltransferase (UGT) 2B10: Validation of Cotinine as a Selective Probe Substrate, Inhibition by UGT Enzyme-Selective Inhibitors and Antidepressant and Antipsychotic Drugs, and Structural Determinants of Enzyme Inhibition. Drug metabolism and disposition: the biological fate of chemicals 2016, 44, (3), 378-88. 8. Kaivosaari, S.; Toivonen, P.; Hesse, L. M.; Koskinen, M.; Court, M. H.; Finel, M. Nicotine glucuronidation and the human UDP-glucuronosyltransferase UGT2B10. Molecular pharmacology 2007, 72, (3), 761-8. 9. Chen, G.; Dellinger, R. W.; Sun, D.; Spratt, T. E.; Lazarus, P. Glucuronidation of tobacco-specific nitrosamines by UGT2B10. Drug metabolism and disposition: the biological fate of chemicals 2008, 36, (5), 824-30. 10. Zhou, D.; Guo, J.; Linnenbach, A. J.; Booth-Genthe, C. L.; Grimm, S. W. Role of human UGT2B10 in N-glucuronidation of tricyclic antidepressants, amitriptyline, imipramine, clomipramine, and trimipramine. Drug metabolism and disposition: the biological fate of chemicals 2010, 38, (5), 863-70. 11. Kato, Y.; Izukawa, T.; Oda, S.; Fukami, T.; Finel, M.; Yokoi, T.; Nakajima, M. Human UDP-glucuronosyltransferase (UGT) 2B10 in drug N-glucuronidation: substrate screening and comparison with UGT1A3 and UGT1A4. Drug metabolism and disposition: the biological fate of


26

Page 26 of 38

Page 27 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chemicals 2013, 41, (7), 1389-97. 12. Breyer-Pfaff, U.; Fischer, D.; Winne, D. Biphasic kinetics of quaternary ammonium glucuronide formation from amitriptyline and diphenhydramine in human liver microsomes. Drug metabolism and disposition: the biological fate of chemicals 1997, 25, (3), 340-5. 13. Kaivosaari, S.; Toivonen, P.; Aitio, O.; Sipila, J.; Koskinen, M.; Salonen, J. S.; Finel, M. Regio- and stereospecific N-glucuronidation of medetomidine: the differences between UDP glucuronosyltransferase (UGT) 1A4 and UGT2B10 account for the complex kinetics of human liver microsomes. Drug metabolism and disposition: the biological fate of chemicals 2008, 36, (8), 1529-37. 14. Chen, G.; Luo, S.; Kozlovich, S.; Lazarus, P. Association between Glucuronidation Genotypes and Urinary NNAL Metabolic Phenotypes in Smokers. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2016, 25, (7), 1175-84. 15. Fowler, S.; Kletzl, H.; Finel, M.; Manevski, N.; Schmid, P.; Tuerck, D.; Norcross, R. D.; Hoener, M. C.; Spleiss, O.; Iglesias, V. A. A UGT2B10 splicing polymorphism common in african populations may greatly increase drug exposure. The Journal of pharmacology and experimental therapeutics 2015, 352, (2), 358-67. 16. Ohno, S.; Nakajin, S. Determination of mRNA expression of human UDP-glucuronosyltransferases and application for localization in various human tissues by real-time reverse transcriptase-polymerase chain reaction. Drug metabolism and disposition: the biological fate of chemicals 2009, 37, (1), 32-40. 17. Margaillan, G.; Rouleau, M.; Klein, K.; Fallon, J. K.; Caron, P.; Villeneuve, L.; Smith, P. C.; Zanger, U. M.; Guillemette, C. Multiplexed Targeted Quantitative Proteomics Predicts Hepatic Glucuronidation Potential. Drug metabolism and disposition: the biological fate of chemicals 2015, 43, (9), 1331-5. 18. Izukawa, T.; Nakajima, M.; Fujiwara, R.; Yamanaka, H.; Fukami, T.; Takamiya, M.; Aoki, Y.; Ikushiro, S.; Sakaki, T.; Yokoi, T. Quantitative analysis of UDP-glucuronosyltransferase (UGT) 1A and UGT2B expression levels in human livers. Drug metabolism and disposition: the biological fate of chemicals 2009, 37, (8), 1759-68. 19. Fallon, J. K.; Neubert, H.; Hyland, R.; Goosen, T. C.; Smith, P. C. Targeted quantitative proteomics for the analysis of 14 UGT1As and -2Bs in human liver using NanoUPLC-MS/MS with selected reaction monitoring. J Proteome Res 2013, 12, (10), 4402-13. 20. Nakata, K.; Tanaka, Y.; Nakano, T.; Adachi, T.; Tanaka, H.; Kaminuma, T.; Ishikawa, T. Nuclear Receptor-Mediated Transcriptional Regulation in Phase I, II, and III Xenobiotic Metabolizing Systems. Drug Metabolism and Pharmacokinetics 2006, 21, (6), 437-457. 21. Hu, D. G.; Meech, R.; McKinnon, R. A.; Mackenzie, P. I. Transcriptional regulation of human UDP-glucuronosyltransferase genes. Drug metabolism reviews 2014, 46, (4), 421-58.


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

22. Aleksunes, L. M.; Klaassen, C. D. Coordinated regulation of hepatic phase I and II drug-metabolizing genes and transporters using AhR-, CAR-, PXR-, PPARalpha-, and Nrf2-null mice. Drug metabolism and disposition: the biological fate of chemicals 2012, 40, (7), 1366-79. 23. Tolson, A. H.; Wang, H. Regulation of drug-metabolizing enzymes by xenobiotic receptors: PXR and CAR. Advanced drug delivery reviews 2010, 62, (13), 1238-49. 24. Urquhart, B. L.; Tirona, R. G.; Kim, R. B. Nuclear receptors and the regulation of drug-metabolizing enzymes and drug transporters: implications for interindividual variability in response to drugs. Journal of clinical pharmacology 2007, 47, (5), 566-78. 25. Bock, K. W. Functions and transcriptional regulation of adult human hepatic UDP-glucuronosyl-transferases (UGTs): mechanisms responsible for interindividual variation of UGT levels. Biochemical pharmacology 2010, 80, (6), 771-7. 26. Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, (4), 402-8. 27. Liu, X.; Zhang, X.; Ji, L.; Gu, J.; Zhou, M.; Chen, S. Farnesoid X receptor associates with beta-catenin and inhibits its activity in hepatocellular carcinoma. Oncotarget 2015, 6, (6), 4226-38. 28. Zeisig, B. B.; Kwok, C.; Zelent, A.; Shankaranarayanan, P.; Gronemeyer, H.; Dong, S.; So, C. W. Recruitment of RXR by homotetrameric RARalpha fusion proteins is essential for transformation. Cancer cell 2007, 12, (1), 36-51. 29. Quan, E.; Wang, H.; Dong, D.; Zhang, X.; Wu, B. Characterization of chrysin glucuronidation in UGT1A1-overexpressing HeLa cells: elucidating the transporters responsible for efflux of glucuronide. Drug metabolism and disposition: the biological fate of chemicals 2015, 43, (4), 433-43. 30. Lu, D.; Ma, Z.; Zhang, T.; Zhang, X.; Wu, B. Metabolism of the anthelmintic drug niclosamide by cytochrome P450 enzymes and UDP-glucuronosyltransferases: metabolite elucidation and main contributions from CYP1A2 and UGT1A1. Xenobiotica; the fate of foreign compounds in biological systems 2016, 46, (1), 1-13. 31. Zhan, L.; Liu, H. X.; Fang, Y.; Kong, B.; He, Y.; Zhong, X. B.; Fang, J.; Wan, Y. J.; Guo, G. L. Genome-wide binding and transcriptome analysis of human farnesoid X receptor in primary human hepatocytes. PloS one 2014, 9, (9), e105930. 32. Barrett, K.; Duniec-Dmuchowski, Z.; Kocarek, T.; Runge-Morris, M. Characterization of UDP-glucuronosyltransferase 2B expression and regulation by nuclear signaling pathways in HepaRG cells. Faseb J 2014, 28, (1). 33. Krattinger, R.; Bostrom, A.; Lee, S. M. L.; Thasler, W. E.; Schioth, H. B.; Kullak-Ublick, G. A.; Mwinyi, J. Chenodeoxycholic acid significantly impacts the expression of miRNAs and genes involved in lipid, bile acid and drug metabolism in human hepatocytes. Life Sci 2016, 156, 47-56.


28

Page 28 of 38

Page 29 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


34. Laffitte, B. A.; Kast, H. R.; Nguyen, C. M.; Zavacki, A. M.; Moore, D. D.; Edwards, P. A. Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor. The Journal of biological chemistry 2000, 275, (14), 10638-47. 35. Ananthanarayanan, M.; Balasubramanian, N.; Makishima, M.; Mangelsdorf, D. J.; Suchy, F. J. Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. The Journal of biological chemistry 2001, 276, (31), 28857-65. 36. Barbier, O.; Torra, I. P.; Sirvent, A.; Claudel, T.; Blanquart, C.; Duran-Sandoval, D.; Kuipers, F.; Kosykh, V.; Fruchart, J. C.; Staels, B. FXR induces the UGT2B4 enzyme in hepatocytes: a potential mechanism of negative feedback control of FXR activity. Gastroenterology 2003, 124, (7), 1926-40. 37. Kassam, A.; Miao, B.; Young, P. R.; Mukherjee, R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. The Journal of biological chemistry 2003, 278, (12), 10028-32. 38. Schwab, N.; Skopp, G. Identification and preliminary characterization of UDP-glucuronosyltransferases catalyzing formation of ethyl glucuronide. Analytical and bioanalytical chemistry 2014, 406, (9-10), 2325-32. 39. Turgeon, D.; Chouinard, S.; Belanger, P.; Picard, S.; Labbe, J. F.; Borgeat, P.; Belanger, A. Glucuronidation of arachidonic and linoleic acid metabolites by human UDP-glucuronosyltransferases. Journal of lipid research 2003, 44, (6), 1182-91. 40. Erichsen, T. J.; Aehlen, A.; Ehmer, U.; Kalthoff, S.; Manns, M. P.; Strassburg, C. P. Regulation of the human bile acid UDP-glucuronosyltransferase 1A3 by the farnesoid X receptor and bile acids. Journal of hepatology 2010, 52, (4), 570-8. 41. Lu, Y.; Heydel, J. M.; Li, X.; Bratton, S.; Lindblom, T.; Radominska-Pandya, A. Lithocholic acid decreases expression of UGT2B7 in Caco-2 cells: a potential role for a negative farnesoid X receptor response element. Drug metabolism and disposition: the biological fate of chemicals 2005, 33, (7), 937-46. 42. Carotti, A.; Marinozzi, M.; Custodi, C.; Cerra, B.; Pellicciari, R.; Gioiello, A.; Macchiarulo, A. Beyond bile acids: targeting Farnesoid X Receptor (FXR) with natural and synthetic ligands. Current topics in medicinal chemistry 2014, 14, (19), 2129-42. 43. Wang, L.; Si, P.; Sheng, Y.; Chen, Y.; Wan, P.; Shen, X.; Tang, Y.; Chen, L.; Li, W. Discovery of new non-steroidal farnesoid X receptor modulators through 3D shape similarity search and structure-based virtual screening. Chemical biology & drug design 2015, 85, (4), 481-7. 44. Koutsounas, I.; Theocharis, S.; Delladetsima, I.; Patsouris, E.; Giaginis, C. Farnesoid x receptor in human metabolism and disease: the interplay between gene polymorphisms, clinical phenotypes and disease susceptibility. Expert opinion on drug metabolism & toxicology 2015, 11,


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(4), 523-32. 45. Oda, S.; Nakajima, M.; Hatakeyama, M.; Fukami, T.; Yokoi, T. Preparation of a specific monoclonal antibody against human UDP-glucuronosyltransferase (UGT) 1A9 and evaluation of UGT1A9 protein levels in human tissues. Drug metabolism and disposition: the biological fate of chemicals 2012, 40, (8), 1620-7.


30

Page 30 of 38

Page 31 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure Legends Figure 1

Effects of FXR agonists on mRNA expression and enzyme activity of UGT2B10 in HepG2 cells. (A) HepG2 cells were seeded onto 12-wells plates, and 24 h later were treated with GW4064 (5 µM) or CDCA (50 µM) for 3 to 24 h. UGT2B10 mRNA was quantified by qRT-PCR from total RNA. (B) HepG2 cells in 12-wells plates were treated with FXR agonists for 24 h. Cells were then incubated with Hanks' balanced salt solution containing 5 µM amitriptyline for 6 h. Extracellular medium were harvested and subjected to UPLC-QTOF/MS analysis. (C) HepG2 cells were seeded onto 10-cm dishes and treated with FXR agonists for 24 h. Cell lysate was prepared and used to measure the UGT2B10 enzyme activity using amitriptyline (5 µM) as substrate. Data shown are the mean ± SD of three independent experiments. p < 0.05 (*) or p < 0.01 (**) or p < 0.001 (***) compared with vehicle control.

Figure 2

Effects of FXR agonists and FXR/RXR over-expression on transcriptional activity of UGT2B10 promoter. All cells were transfected with a UGT2B10 luciferase reporter construct (-2000/+27; +1 indicates the transcription initiation site) and pRL-TK vector (internal control). (A) HepG2 cells were transfected for 24 h and then treated with different concentration of GW4064 or CDCA as indicated for another 24 h. (B) HepG2 cells were co-transfected with different amount of FXR expression plasmid for 24 h and then treated with GW4064 (1 µM) for another 24 h. (C) HepG2 cells were co-transfected with FXR/RXR expression plasmid for 24 h and then treated with GW4064 (1 µM) or CDCA (50 µM) for another 24 h. Luciferase activity was determined as described in ‘Materials and methods’. The relative luciferase activity was standardized against vehicle-treated control cells. Data shown are the mean ± SD of three independent experiments. p < 0.05 (*) or p < 0.01 (**) or p < 0.001 (***) compared with vehicle control.

Figure 3

Transcriptional activity of pGL4-UGT2B10 constructs containing three putative FXR binding sites. (A) Schematic diagram of the human UGT2B10 promoter deletion constructs cloned in pGL4.11-basic vector. Sequences are potential FXR binding elements in UGT2B10 promoter region predicted from Genomatix and NUBIScan. Capitals indicate the putative binding motifs for FXR. (B) HepG2 cells were transfected with 5’-deletion constructs of pGL4-UGT2B10 and pRL-TK plasmid. After 24 h transfection, culture solution was refreshed with DMEM medium containing 10% FBS. Cells were cultivated for another 24 h and luciferase


31


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

activity was determined. Data shown are the mean ± SD of three independent experiments. p < 0.05 (*) or p < 0.01 (**) or p < 0.001 (***) compared with promoterless vector pGL4.11-basic. Figure 4

FXR is required for activation effect of FXR agonist on the region -300 to -150 nt of the UGT2B10 promoter. HepG2 cells were transfected with pGL4-UGT2B10 constructs and treated with vehicle, GW4064 (1 µM), or CDCA (50 µM). (A) Effects of FXR agonists on the transcriptional activity of UGT2B10 promoter constructs in the absence or presence of FXR expression plasmid. (B) Knockdown of FXR reduces the induction effects on pGL4-UGT2B10 by FXR agonists. Data shown are the mean ± SD of three independent experiments. p < 0.05 (*) or p < 0.01 (**) or p < 0.001 (***) compared with vehicle control. (C) Effect of FXR-shRNA on the expression of FXR in HepG2 cells. HepG2 cell lysate (20 µg per lane) was assayed to western blot analysis using FXR antibody as described in ‘Materials and methods’. The number in bracket represents the relative expression of FXR protein as calculated from the band intensity.

Figure 5

Endogenous FXR binds to a putative FXR-binding element in the UGT2B10 promoter. EMSAs were performed with labeled UGT2B10-IR1 probes or labeled BSEP-IR1 probe as indicated in the presence of nuclear extracts from HepG2 cells. Competition EMSAs on labeled UGT2B10-IR1 probes or labeled BSEP-IR1 probe were performed by adding 50-fold molar excess of the indicated cold/mutant consensus UGT2B10-IR1 or BSEP-IR1 oligonucleotides in EMSA with nuclear extracts from HepG2 cells.

Figure 6

GW4064 enhances the FXR transactivation effect on the UGT2B10 promoter. Recruitment of FXR onto (A) UGT2B10 promoter and (B) BSEP promoter were analyzed by ChIP assay in HepG2 cells treated with vehicle (DMSO) or GW4064 (2.5 µM). Data were presented as mean ± SD. p < 0.01 (**) or p < 0.001 (***) compared with vehicle treatment.


32

Page 32 of 38

Page 33 of 38

Figure 1 A R e la t iv e E x p r e s s io n

3 V e h ic le G W 4064 CDCA

***

2

***

**

*

1

0

0 .5

e V


A C D C

D

ic

C

le

A

0 .0

C

4 W G

V

e

h

0

ic

6

4

le

0 .0

1 .0

4

0 .5

**

6

1 .0

*** 1 .5

0

**

4

1 .5

C e ll ly s a te

2 .0

W

In ta c t c e lls *

24 h

G

2 .0

12 h

h

B

6 h

R e la t iv e a c t iv it y ( f o ld )

3 h

R e la t iv e a c t iv it y ( f o ld )

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42



Figure 2


R

+ R F

X

N D c p

X R

(,1

F

A

+

3

R

X

)

R

R X

)

R

(-

X R

R X F

F X R (n g )

N

(μ M )

D

(μ M )

F

400

X

300

,1

200

3

100

F

50

X

0

c

CDCA

p

G W 4064

R

* A

***

R

***

+

0

* *

A

100

50

25

5

2.5

1

veh icle

0

***

**

N

50

)

*

***

***

50 50 40 30 20 10 0 (-

2

**

100

***

100

D

**

CDCA

X

4

***

150

,1

***

G W 4064

F

**

R L U ( f o ld )

150

***

v e h ic le

200

3

6

***

250

c

G W 4064

***

R L U ( f o ld )

v e h ic le

p

200

R

C

B

8

10

A R L U ( f o ld )

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Page 34 of 38

Page 35 of 38

Figure 3

B -1846

ccaagAGGTAAcTGTGCTtgtca

-1230

gtggaAGGAAAcTTTCCTttctt

-214

ttgcaAGGTCAtTAAACTtaggt

100 80 60 40 20

** **

RLU (fold)

A

**


pGL4-UGT2B10

kb -0 .1 5

kb -0 .3

kb -1 .8

-2

kb

10 8 6 4 2 0

pG L4 -B as ic

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42



Figure 4 A pcDNA3.1

***

** **

***

20

*

**

15 RLU (Fold)

**

(-0.3 kb)

**

Vehicle GW4064 CDCA

b t n

.3 u

ta

-0

5 .1 -0

k

k

b k

m

***

0 FXR-shRNA

Scramble (1.00)

FXR-shRNA (0.46) FXR

* Scramble

.3

C

10 5

0

-0

p G L 4 -U G T 2 B 1 0

Vehicle GW4064 CDCA

(-2 kb)

b

ic s a -B 4 L G p

pGL4-UGT2B10

10

5

-0 m .3 k ut an b t

kb -0 .1 5

kb -0 .3

kb -1 .8

-2

kb

0

pG L4 -B as ic

0

b

**

200

15

**

400

20

B

**

k

*

600

.8

40

CDCA

-1

60

G W 4064

**

b

***

***

800

k

RLU (fold)

**

V e h ic le

p c D N A 3 .1 - F X R

-2

80

1000

Vehicle GW4064 CDCA

R L U ( f o ld )

100

RLU (Fold)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Page 36 of 38

Scramble

FXR-shRNA


GAPDH

Page 37 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42


Figure 5

DNA-protein complexes

Free probes

BSEP-IR1 UGT2B10-IR1 Protein Competitor Mutant competitor

+ -

+ + -

+ + + -

+ -

+ + -

+ + + -


+ + +


Figure 6 A

B

4

1 .5

***

**

FXR Ig G

FXR Ig G

% In p u t

3

% In p u t

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Page 38 of 38

2

1 .0

0 .5

1

0

0 .0 DM SO

G W 4064

DM SO


G W 4064

Transcriptional Regulation of Human UDP-Glucuronosyltransferase

Recommend Documents