Tumor Progression of Non-Small Cell Lung Cancer Controlled by

Subscriber access provided by READING UNIV

Article

Tumor Progression of Non-small Cell Lung Cancer Controlled by Albumin and Micellar Nanoparticles of Itraconazole, a Multi-target Angiogenesis Inhibitor Ling Zhang, Zhengsheng Liu, Kuan Yang, Chao Kong, Chun Liu, Huijun Chen, Jinfeng Huang, and Feng Qian Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.7b00855 • Publication Date (Web): 25 Oct 2017 Downloaded from http://pubs.acs.org on October 27, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Tumor Progression of Non-small Cell Lung Cancer Controlled by Albumin and Micellar Nanoparticles of Itraconazole, a Multi-target Angiogenesis Inhibitor

Ling Zhang 1, Zhengsheng Liu 1, Kuan Yang 1, Chao Kong 1, Chun Liu 1, Huijun Chen 1, Jinfeng Huang 2 and Feng Qian 1*

1

School of Pharmaceutical Sciences and Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Tsinghua University, Beijing 100084, P.R.China

2

Department of Thoracic Surgery, National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medicine College, Beijing 100021, P.R.China

Manuscript for Molecular Pharmaceutics

* To whom correspondence should be address: Feng Qian ([email protected])

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Itraconazole (ITA), an old and widely-prescribed antifungal drug with excellent safety profile, has more recently been demonstrated to be a multi-target anti-angiogenesis agent affecting multiple angiogenic stimulatory signals and pathways, including vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), vascular endothelial growth factor receptor 2 (VEGFR2) glycosylation, and mammalian target of rapamycin (mTOR). In this study, we developed two nanoparticle formulations, i.e., polymer micelles (IP2K) and albumin nanoparticles (IBSA), to solubilize the extremely hydrophobic and insoluble ITA to allow intravenous administration and pharmacokinetics (PK)/pharmacodynamics (PD) comparisons. Although none of the formulations showed strong antiproliferation potency against non-small cell lung cancer (NSCLC) cells in vitro, when administrated at the equivalent ITA dose to a NSCLC patient-derived xenograft (PDX) model, IBSA retarded while IP2K accelerated the tumor growth. We attributed the cause of this paradox to formulation-dependent PK and vascular manipulation: IBSA demonstrated a more sustained PK with a Cmax 60-70% and an AUC ~2 times of those of IP2K, and alleviated the tumor hypoxia presumably through vascular normalization. In contrast, the high Cmax of IP2K elevated tumor hypoxia through a strong angiogenesis inhibition, which could have aggravated cancer aggressiveness and accelerated tumor growth. Furthermore, IBSA induced minimal hepatic and hematologic toxicities compared to IP2K; and significantly enhanced the in vivo tumor inhibition activity of paclitaxel albumin nanoparticles when used in combination. These findings suggest that, formulation and pharmacokinetics are critical aspects to be considered when designing the ITA angiogenesis therapy, and IBSA could potentially be assessed as a novel and safe multi-target angiogenesis therapy to be used in combination with other anti-cancer agents.

KEYWORDS: Itraconazole, angiogenesis, nanoparticle formulations, pharmacokinetics, NSCLC


Page 2 of 22

Page 3 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract Figure



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 22

1. INTRODUCTION Angiogenesis is indispensable for tumor growth and metastasis [1-2]. Over the past decade, anti-angiogenesis therapy, represented by Bevacizumab (Avastin®), a humanized anti-VEGF (vascular endothelial growth factor) monoclonal antibody first approved by US FDA to be used in combination with cytotoxic agents against colorectal cancer, metastatic non-small-cell lung cancer (NSCLC), metastatic breast cancer, etc. [3-4], has been intensively used in clinic. Although bevacizumab has shown some clinical benefits, serious and unusual toxicities have also been noted,

including

gastrointestinal

perforations,

wound

healing

complications,

arterial

thromboembolic complications, serious haemoptysis and bleeding, etc. [4-6]. Furthermore, bevacizumab poses a heavy finical burden for many patients [6-8]. Itraconazole (ITA) is a widely used triazole antifungal agent with broad spectrum activity and good tolerance, which interferes in sterol biosynthesis in fungal cell membrane by inhibiting the lanosterol 14ɑ-demethylase (cytochrome P450) of the fungi, leading to fungal cell death [9-11]. Interestingly, novel biological mechanisms of ITA, including potent antiangiogenic activity, have been discovered with drug repurposing research in the past decade [12-14]. ITA was found to be able to affect multiple angiogenic stimulatory pathways, inhibiting the vascular endothelial growth factor receptor-2 (VEGFR2) glycosylation, vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF)-mediated angiogenic stimulation, and modulating the mammalian target of rapamycin (mTOR) signaling axis in endothelia cells [5-6, 13, 15-17]. Thus, ITA could potentially be developed into a novel, safe and affordable antiangiogenesis agent that is less prone for drug resistance due to inhibit multiple downstream signaling pathways [6]. ITA could lead to a dose-dependent suppression of VEGF- and FGF-mediated endothelial cell migration and endothelial tube formation [5-6]. Therefore, precise delivery of ITA to achieve the desirable pharmacokinetics is crucial to realize its antiangiogenic effect in vivo, as angiogenesis inhibitors could retard tumor growth, they might also paradoxically increase tumor growth when delivered differently, although proof-of-concept demonstration of this notion remains scant [18-20]. ITA is a very poorly soluble weak base with a solubility in water at the order of ~ng/mL and ~1µg/mL under acidic pH in stomach [9-10]. The amorphous oral ITA capsule formulation shows low and variable bioavailability with pH and food effects [21-22], while the intravenous formulation where every 10 mg of ITA is solubilized by 400 mg


Page 5 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


hydroxypropyl-β-cyclodextrin (Sporanox® Injection) showed severe renal toxicities [23-24]. A safe and precise delivery of ITA with established pharmacokinetic/pharmacodynamics (PK/PD) relationship is indispensable for its further clinical evaluation as a novel angiogenesis inhibitor. In this study, we developed two ITA nanoparticle formulations for intravenous injection: one based on poly (ethylene glycol)-poly (D, L-lactic acid) (PEG-PLA) micelles (IP2K) and the other based on albumin complexation (IBSA), and compared them in vitro (anti-proliferation against NSCLC cells) and in vivo (systemic pharmacokinetics in rats, and tumor inhibition against a patient-derived NSCLC xenograft model). We compared the ITA formulations in NSCLC because a number of angiogenic mechanisms have been demonstrated to play an important role in NSCLC [5, 25-26]. Intriguingly, although none of the formulations showed strong anti-proliferation effect against NSCLC cells in vitro, opposite trend of tumor growth was observed when the NSCLC patient-derived xenograft (PDX) mice were treated with different formulations, which was attributed to a fine PK/PD balance required for ITA treatment.

2. MATERIALS AND METHODS 2.1. Preparation of micelle (IP2K) and albumin (IBSA) based formulations ITA was purchased from Ouhe Chemical Co., Ltd. (Beijing, China). Poly (ethylene glycol)-poly (D, L-lactic acid) (PEG-PLA) block copolymer (PEG2K-PLA2K, MW=4K Da) was obtained from Daigang Biotechnology Co., Ltd. (Jinan, China). Bovine serum albumin (BSA, Albumin Bovine V) was purchased from Amresco (USA). All organic solvents were of analytical grade. The PEG-PLA micelle formulation (IP2K) was prepared by a film hydration method [27]. Briefly, 300 mg PEG2K-PLA2K and 40 mg ITA were dissolved in acetonitrile. The organic solvent was evaporated at 60ºC by a rotary evaporator to form a clear thin film. The film was then hydrated by 10 mL normal saline at 60ºC and sonicated for ~1 min to obtain a uniform, milky colloidal solution of 4 mg/mL. For in vivo administration, the obtained micelle formulation was diluted to 2 mg/mL, filter through 0.22 µm syringe filters, and used immediately without lyophilization, due to the well-known stability challenge to lyophilize ITA micelle solution[28]. The concentration of filtered micelle formulation remain unchanged, as confirmed by HPLC. The albumin nanoparticle formulation (IBSA) was prepared similarly as the reported



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

nanoparticle albumin bound technology [24, 29]. Briefly, 400 mg ITA was dissolved in 4 mL chloroform with 1% ethanol and 3600 mg BSA was dissolved in 100 mL water. The two solutions were then mixed with each other and homogenized under 1300 bar for ten cycles. The organic solvent in the solution was removed by a rotary evaporator at 30ºC for 30 min, and then the remained solution was lyophilized. Before use, the obtained lyphile was reconstituted in normal saline into 4 mg/mL ITA concentration by shaking mildly. Similarly, the obtained albumin formulation was diluted to 2 mg/mL, filter through 0.22 µm syringe filters, and the concentration of filtered formulation was confirmed by HPLC to remain unchanged. Paclitaxel (PTX) albumin nanoparticle formulation (PBSA) prepared as IBSA did.

2.2. Transmission electron microscopic analysis of IP2K and IBSA The morphology of IP2K and IBSA was studied by transmission electron microscopy (FEI Tecnai Spirit Bio TWIN TEM D1297, USA) with negative staining of phosphotungstic acid.

2.3. Effects of IP2K and IBSA on the proliferation of A549 NSCLC cells Proliferation assay was performed to compare IP2K and IBSA in vitro using A549 NSCLC cells obtained from ATCC. The cells were grown in DMEM with 10% fetal bovine serum (FBS) supplemented with 100 units/mL penicillin and 100 mg/mL streptomycin, and was cultured at 37°C in a humidified incubator with a 5% CO2/95% air atmosphere without mycoplasma infection. For proliferation studies via MTS assay (CellTiter 96®, Promega), cells were plated into 96-well plates at 1500 cells/well and were treated after the following day either with IP2K or IBSA. Cells treated with different ITA concentrations (0, 0.25, 1, 2, 4, 8, 16, 32 µM) were recorded at 18, 26, 38, 49, 63, and 86 h post treatment. Data were expressed as mean±SEM relative proliferation and graphed as treated/control (T/C) values from six wells per treatment.

2.4. Pharmacokinetic comparison of IP2K and IBSA in rats Systemic pharmacokinetic comparison of IP2K and IBSA was performed in Sprague Dawley (SD) rats. SD rats (male, 220-300g, 6 to 8 weeks of age) were purchased from Charles River China (Beijing Vital River Laboratory Animal Technology Co., Ltd). Rats were surged with indwelling jugular vein cannulas and individually housed in suspended cages providing rodent


Page 6 of 22

Page 7 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


feed and water ad libitum. Following the single dose intravenous injection of 3 animals per dosing group, 0.3mL peripheral blood samples were collected at 5min, 10min, 15min, 30min, 1h, 2h, 3h, 5h, 7h, 9h, 24h and 48h after dosing. The obtained blood was collected in the tubes containing sodium EDTA, centrifuged 10min at 2000x g to collect plasma. ITA and its metabolite hydroxy itraconazole (OH-ITA) were extracted form 100µL plasma samples using protein precipitation with acetonitrile/methanol (1/1, v/v) containing roxithromycin (ROX) as the internal standard. The organic layers were then evaporated to dryness under a gentle stream of nitrogen at room temperature (CentriVap Concentrator, USA). The re-dissolved concentrations of ITA and OH-ITA were quantitated using a rapid resolution liquid chromatography system (Nexera UHPLC LC-30A, Shimadzu, Japan), and detection was performed on an AB SCIEX Triple Quad™ 4500 (Applied Biosystems,Foster City, CA, USA) with an electrospray ionization source (Turbo Ionspray). The range of the standard curves for ITA and OH-ITA were 5-500ng/mL and 1-500ng/mL respectively. The following pharmacokinetic parameters were evaluated for ITA and OH-ITA: the maximum concentration of the drug in plasma (Cmax), the time to Cmax (Tmax), the clearance (CL), the mean residence time (MRT), the area under the plasma concentration-time curve from 0 to 48h postdose (AUC0-48h). AUCs were calculated via trapezoidal summation. All pharmacokinetic data were LN-transformed before analysis. A 2-tailed, unpaired student’t test was used to test significance of differences.

2.5. In vivo antitumor comparison of IP2K and IBSA in patient-derived NSCLC xenograft (PDX) model The primary patient solid tissues were collected by surgery with gland architecture. The tissues were characterized for Kras exon 2, Kras exon 3, and EGFR exon 20 mutation by DNA sequencing (Beijing Rui Biotechnology Co., Ltd). The primer pairs were listed in Table 1. Then, patient

tissues

were

cut

into

small

pieces

(about

2mm3)

and

implanted

to

NOD/SCID/IL2λ-receptor null (NSG, Bred in Laboratory Animal Research Center of Tsinghua University) mice subcutaneously as passage 0 (P0). The subsequent passages (P1-P2) were performed similarly as P0, where tumor tissue from the earlier passage was processed and re-implanted directly into a large cohort of NSG, male mice. P3 tumor tissues were processed into single cell suspensions by homogenization and ~1×106 cells (in 50% PBS and 50% Matrigel) were



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 22

implanted into the inguinal region of BALB/c nu/nu mice (Beijing Vital River Laboratory Animal Technology Co., Ltd) subcutaneously. When the tumor size reached 60-100mm3, the mice were randomized into different treatment groups and subjected to IP2K, IBSA, PBSA and IBSA/PBSA mixture by tail vein injection at ITA or PTX 15mg/kg (once every 6 days, ×4). The tumor size (V) was determined over time using the following equation: V=L x W2/2, where L and W are the major and minor axes of the tumor as measured by a caliper, respectively.

Table 1. Primer information. Screen gene region Kras exon 2 Kras exon 3 EGFR exon 20

Primer pairs AGCGTCGATGGAGGAGTTTG TGTATCAAAGAATGGTCCTGCAC CCGTCATCTTTGGAGCAGG AGGCTGTGGAGTCAAACAGG CAGTTCCCAAACTCAGAGATCAG CAGAGACATCAGACCACACTGAG

2.6. Histology and immunohistochemistry of the PDX tumor after IP2K or IBSA treatment Tumor tissues were fixed in 10% neutral buffered formalin over 24h, and then transferred to 70% ethanol. Tissues were embedded in paraffin, and 4 µm sections were processed for immunohistochemistry (IHC) by standard protocols for CD31 (Wuhan Servicebio technology, GB12063), VEGF (Wuhan Servicebio technology, GB11034), Caspase-3 (Wuhan Servicebio technology, GB11009), and Ki-67 (Wuhan Servicebio technology, GB13030-2) staining. Images were captured on an optical microscope (ZEISS imager.A2m, Germany). Positive cells were identified and scored per tumor using Image-Pro Plus 6.0.

2.7. Immunoblot analysis of the collected PDX tumors Total protein of the harvested tumors at day 44 was obtained by homogenized with RIPA buffer. Western blot did by standard protocols for HIF-1ɑ (Boster, BA0912) and β-actin (Wuhan Servicebio technology, GB13001-1).

2.8. Blood counts and biochemistry Before PDX animals sacrificed, full blood counts were obtained on terminal orbital bleeds


Page 9 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and analysis using a BC-3000Plus Auto Hematology Analyzer (Mindrary Ltd., China). Serum was analyzed by HITACH17080 Auto Chemistry Analyzer (Hitachi Ltd., Japan).

3. RESULTS AND DISCUSSION 3.1. Characterization of polymeric (IP2K) and albumin-based (IBSA) ITA nanoparticle ITA (Figure. 1A) is an extremely poorly water soluble (~1 ng/mL in water) molecule with high lipohilicity (logP 5.66) [11] and intensive albumin binding (99.8 %) [24]. Thus, we developed PEG-PLA micelles and albumin nanoparticles to encapsulate ITA into nano-sized suspensions to increase the apparent solubility to enable intravenous administration, and modify the pharmacokinetics of ITA. Formulations at 4 mg/mL and 2 mg/mL were used for in vitro and in vivo comparisons, respectively. Both nanoparticle technologies have long history of safe clinical use, proven capabilities to improve pharmacokinetics of various anti-cancer agents and offer therapeutic benefits compared with relatively conventional, solution formulations [30-33].

Figure. 1. (A) Chemical structure of ITA, PEG-PLA and cartoon structure of BSA. (B), (C) Appearance and TEM pictures of PEG-PLA based ITA nanosuspension (IP2K) and albumin-based ITA nanoparticles (IBSA), both at 4mg/mg or 2mg/mL in solution. Both IP2K and IBSA nanoparticles have ~10 wt% ITA loading and could achieve high ITA concentration (>1mg/mL, ~106 increase compared with free ITA) in aqueous solution (Table S1). IP2K has a slight negative zeta potential of -0.91mV, and remains stable for at least 4 h at 4 mg/mL. IBSA has a strong negative zeta potential of -6.6mV, and remains stable for at least 3 days



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

after reconstitution from lyophile. To more accurately dose the formulation by volume, lower concentration formulations at 2 mg/mL were used for the in vivo study. Both formulations remained visually uniform without solid precipitations or particle size change for at least 4 hours, which is sufficient to complete the in vivo comparison. Shown as Figure. 1B, 1C and Figure. S1, the 4 mg/mL IP2K formulation appeared to be particularly milky due to the formation of large reversible agglomerates with size >200 nm. After diluted to 2 mg/mL，the agglomerates dissociated into individual micelles with size of 20-30 nm. In comparison, the particle size of IBSA formulation remained constant at ~80 nm regardless of the concentration.

3.2. Impact of IP2K and IBSA nanoparticles on the in vitro proliferation of A549 NSCLC cells

Figure. 2. IP2K and IBSA are equally efficacious against A549 cells in vitro. A549 cells were treated by IP2K (A) and IBSA (B) and its relative proliferation was assessed by CellTiter 96®assay.


Page 10 of 22

Page 11 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Relative proliferation was defined as treated/control (T/C) values from six wells per treatment (mean ± SEM).

We first assessed the effects of IP2K and IBSA on the proliferation of NSCLC cells. Treated with either formulation with escalating doses from 0.25-32 µM, the proliferation of A549 cells was slowed down only when ITA concentration reached 2 µM and above (Figure. 2A and B), while remained unaffected by the presence of lower concentration ITA, suggesting that either IP2K or IBSA have limited effect on cancer cell themselves directly. Although inhibition of cell proliferation was observed after 86 h treatment by high concentration ITA (> 4 µM), such conditions where tumor cells undergo a sustained exposure of high ITA concentration could hardly be reached in vivo.

Also, there was no noticeable difference in antiproliferation between IP2K

and IBSA against A549 cells.

3.3. Pharmacokinetic comparison of IP2K and IBSA nanoparticles Figure. 3 compared the average plasma concentration-time curves of ITA and its major active metabolite, hydroxyitraconazole (OH-ITA), after intravenous bolus injection of IP2K and IBSA nanoparticles into Sprague-dawley (SD) rats at the same 15 mg/kg ITA dose. All pharmacokinetic parameters were calculated and listed.

Analyte

tmax

Cmax

t2max

C2max

AUC0-48h

CL

(h)

(ng/mL)

(h)

(ng/mL)

(ng*h/mL)

(L/h/kg)

Formulation

MRT0-48h (h)

ITA

IP2K

0.08

4773±122

24

138±25

17218±425

0.87±0.02

5.37±0.32

ITA

IBSA

0.08

3087±239***

24

548±334

33140±8512*

0.47±0.12**

10.62±3.42

OH-ITA

IP2K

3

808±121

24

288±37

14727±507

1.02±0.03

15.99±0.32

3

*

*

20.15±1.88*

OH-ITA

IBSA

612±21

24

655±197

*

23071±5362

0.67±0.14

Figure. 3. (A) Plasma concentration-time profiles of ITA and (B) its metabolite hydroxy itraconazole (OH-ITA) after intravenous injection of IP2K and IBSA in SD rats at ITA dose of 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

mg/kg. The inserts show the first hour pharmacokinetic profiles. (C) Rats body weight changes over 1 week. All pharmacokinetic parameters were listed in the table. Noncompartmental model, data represent mean ± STD, for three rats. * Represents P

Tumor Progression of Non-Small Cell Lung Cancer Controlled by

Recommend Documents