Ultrasensitive detection of HIV DNA with polymerase chain reaction

Subscriber access provided by Kaohsiung Medical University

Article

Ultrasensitive detection of HIV DNA with polymerase chain reaction-dynamic light scattering (PCR-DLS) Li Zou, and Liansheng Ling Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b03052 • Publication Date (Web): 22 Oct 2018 Downloaded from http://pubs.acs.org on October 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Ultrasensitive detection of HIV DNA with polymerase chain reactiondynamic light scattering (PCR-DLS) Li Zou1,2 and Liansheng Ling1,* 1

School of Chemistry, Sun Yat-Sen University, Guangzhou 510275, P. R. China *Tel & Fax: 86-20-84110156. E-mail: [email protected] 2 School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006, P. R. China ABSTRACT: Early diagnosis of HIV biomarker or gene is the key to reduce acquired immunodeficiency syndrome (AIDS) mortality. In our work, we developed a novel polymerase chain reaction-dynamic light scattering (PCR-DLS) assay for one-step sensitive detection of HIV DNA based on the average diameter change of gold nanoparticles (AuNPs). It is the first PCR assay that makes use of the DLS technique as signal read-out, the particle size measured by DLS increased with the concentration of target DNA. With the help of the AuNP probes, this PCR-DLS assay can effectively improve the specificity of PCR reactions, which can greatly increase the detection sensitivity, with a detection limit of 1.8 aM (S/N = 3). In addition, the proposed strategy was successfully used to analyze target DNA in human serum samples, indicating that the PCR-DLS assay has a promising potential application for rapid and early clinical diagnosis of HIV infection.

INTRODUCTION Human immunodeficiency virus (HIV) has caused great panic all over the world since its discovery in the early 1980s, with the emergence of one the most deadly infectious diseasesacquired immunodeficiency syndrome (AIDS).1 According to the recent statistics, there were approximately 36.9 million people living with HIV worldwide. Almost half (46%) of them did not know their HIV status, and almost 60% did not receive reverse transcription treatment. Therefore, quantitative analysis of HIV-related biomarker is significant to the early diagnosis and therapy of AIDS.2 Currently, the diagnostic methods of AIDS are mainly aimed at HIV antibody or antigen detection.3,4 However, these immunoassay methods are difficult to achieve early HIV screening due to low HIV antibody levels during the window period. In addition, these methods have good specificity, but the sensitivities of them are not satisfactory.5 Therefore, it is in urgent need to develop a convenient, rapid and sensitive method for the early diagnosis of HIV infection. Nucleic acid detection methods would be desirable for the early diagnosis of AIDS without considering the window period.6 For decades, various techniques have been developed for HIV-related DNA detection, such as electrochemical method,7,8 colorimetric method,9 fluorescence resonance energy transfer (FRET),10,11 and surface plasmon resonance (SPR).12 Dynamic light scattering (DLS) is a common optical technique for measuring the size of macromolecules, colloids, and particles in the range of a few nm up to a few µm in diameter.13 The hydrodynamic diameter of the particles is determined according to the scattering light intensity fluctuations and the Stokes-Einstein equation.14 The size range of most nanomaterials is within the ideal detection range of DLS, so DLS has become an important tool in nanotechnology research.15 DLS can distinguish individual nanoparticles from nanoparticle aggregates because of their size difference, which makes DLS a potential analytical tool for quantitative analysis of disease-related

biomolecules. In addition, due to its non-invasiveness and high sensitivity, DLS is widely used in the study of biopolymer aggregation,16 protein kinetics,17 immunoassays,18 and metal ion detection.19 Gold nanoparticles (AuNPs) are widely used in various kinds of analytical technology because of their large specific surface area, unique optical properties, good biocompatibility and easy to synthesis.20–22 Due to its unique physical and chemical properties, functionalization of gold nanoparticles attracts more and more attention.23 DNA-functionalized gold nanoparticle probes have been applied to colorimetric assay,24 fluorescence energy resonance transfer,25 surface enhanced Raman scattering (SERS),26 dynamic light scattering27 and electrochemical detection.28 Gold nanoparticles combined with some nucleic acid amplification technologies, such as PCR,29 hybridization chain reaction30 and rolling circle amplification technology,31 have also been used for sensitive detection of nucleic acids, proteins and other small molecules. In particular, the combination of gold nanoparticles and PCR can greatly improve the detection sensitivity. Herein, we propose a new PCR-DLS assay for one-step sensitive detection of HIV DNA based on the average diameter change of AuNPs. To the best of our knowledge, this is the first PCR assay that makes use of the DLS technique as signal readout. With the help of the AuNP probes, this PCR-DLS assay can effectively improve the specificity of PCR reactions.32 On the other hand, PCR amplification and gold nanoparticles assemblies are in existence simultaneously during the reaction process, which basically eliminates external interferents. Therefore, it is a highly selective and desirable HIV DNA-detecting method.

EXPERIMENTAL SECTION Materials and Chemicals. All DNA oligonucleotides, PCR reagents and Ezup Column Blood Genomic DNA Purification Kit were obtained from Sangon Biotech Co., Ltd.

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Shanghai, China), primers and thiolated DNA were purified by HPLC. Hydrogen tetrachloroaurate (HAuCl4·4H2O) and tris (2carboxyethyl) phosphine hydrochloride (TCEP) were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Trisodium citrate and other chemicals were purchased from Aladdin Industrial Corporation and used without further purification. Ultrapure water used throughout the experiment was purified by a Millipore Milli-Q water purification system (18.2 MΩ·cm at 25 °C). Healthy human real serum samples were supplied by donors from the local hospital (Guangzhou, China).

at 72 °C. Leave at room temperature for 10 minutes, the hydrodynamic size of particles was measured by DLS. In addition, genomic DNA from healthy human serum was extracted using Ezup Column Blood Genomic DNA Purification Kit according to the instructions, and the obtained sample solution was diluted 10 times for the recovery experiments. Scheme 1. Schematic illustration of the PCR-DLS assay

The sequences of the primers, DNA fragments and probes were: forward primer, 5`- GGGAGAGAAGAACT spacer18 AGTTCTTCTCTCCC GACAGGCCCGAAGGAATAGA-3`; reverse primer, 5`-GAGGAAGGAAAGCT spacer18 AGCTTTCCTTCCTC CTCTCTCTCCACCTTCTTCT-3`; HIV target DNA, 5`GACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGA GAGAG-3`; Random DNA, 5`ACGATGCTCT GAGTTCAACCTAGCTTACGAGACGGATCA-3`; probe 1, 5`TTCTTCTCTCCC-C6-SH-3`; probe 2, 5`CTTTCCTTCCTC-C6-SH-3`.

Apparatus. UV-visible spectra were measured using a UVvis spectrophotometer (Shimadzu UV-1750, Japan). The purity and yields of the extracted genomic DNA were estimated with the Thermo Scientific NanoDrop 2000c UV-vis spectrophotometer. Hydrodynamic size of gold nanoparticles was measured by Malvern Nano ZS/Mastersizer 2000E. The DLS instrument was operated under the following conditions: temperature 25°C, scattering angle 90°, red laser wavelength 633 nm and laser power 4 mW. The morphology of AuNPs was characterized by atomic force microscopy (AFM, Bruker, Dimension FastScanTM) and transmission electron microscopy (TEM, JEM-3010). Preparation of DNA-functionalized AuNP probes. AuNPs with an average diameter of 13 nm were synthesized according to the classic citrate reduction method.33 DNAfunctionalized AuNP probes were prepared by addition of DNA to the AuNPs solution following a literature procedure.34 DNA was treated with TCEP at room temperature for 1.5 h, the reduced thiolated-DNA was then mixed with AuNPs in the molar ratio of 200:1, and reacted for 16 h at room temperature. In the next 44 h, the mixture was aged by the addition of NaCl to a final concentration of 0.1 M. To remove unbound DNA from the mixture, the particles were centrifuged (13800 rpm  30 min) and washed with PBS three times. Finally, the red oily precipitate was collected and resuspended with 10 mM phosphate buffer (pH 7.4) containing 0.1 M NaCl. The resulting DNA-functionalized AuNP probes were stored at 4 °C for further use. PCR amplification and detection of HIV DNA. PCR reaction was performed in a 50 μL mixture containing 5 μL of 10 × PCR buffer (50 mM KCl, 10 mM Tris–HCl pH 9.0 at 25 °C), 1.5 mM MgCl2, 0.2 mM dNTPs, 2.5 U of Taq DNA polymerase, 0.4 μM forward primer, 0.4 μM reverse primer, 2 μL HIV DNA template at different initial concentrations ranging from 10 aM to 1.9 pM, 10 μL of 10 nM AuNP probe 1, 10 μL of 10 nM AuNP probe 2 and 14.5 μL distilled H2O. The cycling procedure for the PCR amplification of target DNA was as follows: (1) pre-denaturation at 94 °C for 3 min; (2) 35 cycles of 94 °C for 15 s, 55 °C for 20 s, and 72 °C for 30 s; (3) with a final 3 min

RESULTS AND DISCUSSION The principle of the PCR-DLS assay. The principle of the PCR-DLS assay for sensitive detection of HIV DNA based on the average diameter change of AuNPs is illustrated in Scheme 1. Both forward and reverse primers form a hairpin structure with three nucleic acid segments. In detail, a nucleic acid residue (light blue) is designed to hybridize with AuNP probes, which is complementary to a nucleic acid sequence (light green) and linked by an oxyethyleneglycol tether (blocker, red). In addition, a nucleic acid segment (black/blue) in the forward/reverse primer is same/complementary to the target DNA, respectively. Before PCR amplification, the segments (light blue) in both primers cannot hybridize with AuNP probes, which keeps them well dispersed. Subsequent polymerization, the PCR process results in the opening of the hairpin structure and the generation of respective DNA templates continuously. Note that the polymerization is always terminated at the oxyethyleneglycol tethers (blocker) of both primers.35 Therefore, specific PCR product with free single-stranded DNA (ssDNA) tails at both ends that yields, which can hybridize with two types of AuNP probes simultaneously, accompanying with the aggregation of AuNPs and a dramatic increase in particle size, which can be measured by using dynamic light scattering.

The feasibility of the PCR-DLS assay. To investigate the feasibility of this strategy, the HIV-1 gp160 gene was chosen as a proof-of-concept target. As shown in Figure 1a, after 35 cycles of PCR, the mixture of PCR product and AuNP probes changed from red to purple upon the addition of 1.9 pM target DNA, accompanied by a decrease in absorbance at 522 nm (Figure 1b). In contrast, there was no color and absorbance change in the negative control (Ctrl) without target DNA or at a low concentration (1.9 fM). The PCR-induced aggregation of AuNPs was further investigated by DLS, AFM and TEM. As shown in Figure 1c, the hydrodynamic size of the dispersed AuNPs measured by DLS was around 36.2 nm without target


Page 2 of 6

Page 3 of 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry DNA. The morphology of the particles was characterized by AFM (Figure 2a) and TEM (Figure S1a), it showed that the AuNP probes were well dispersed. With addition of 1.9 fM target DNA, the hydrodynamic size of particles increased to 201.4 nm (Figure 1d), the aggregation of AuNPs linked by PCR product was confirmed by AFM (Figure 2b), and mass agglomeration was observed after PCR (Figure S1b). Figure 2c and Figure 2d illustrate the heights of the positions marked in Figure 2a and Figure 2b, respectively. The measured average heights of approximately 15 nm and 2 nm were consistent with the diameters of the AuNPs and double-stranded DNA (dsDNA), respectively. Therefore, the PCR-DLS assay based on the change of particle size for sensitive detection of HIV DNA was feasible.

Figure 1. Photograph (a) and UV-vis absorbance spectra (b) of AuNP probes upon addition of different concentrations of HIV-1 DNA (0, 1.9 fM and 1.9 pM). Hydrodynamic size distribution of AuNP probes without (c) and with (d) addition of the HIV-1 DNA.

The effect of PCR cycle number. We studied the correlation between the hydrodynamic size of AuNPs and the number of PCR cycles. More PCR cycles produce more PCR products, which can trigger the aggregation of AuNPs, accompanying with a dramatic increase in particle size. As demonstrated in Figure 3, the hydrodynamic diameter of particles increased with the cycle number ranging from 0 to 35, and the hydrodynamic size ceased to increase after 35 cycles. This possibly indicated that the dNTPs in the system was run out and PCR had reached full capacity at 35 cycles, so no more PCR products were generated with further increase of cycle number. It was also possible that the aggregation of AuNPs had reached its maximum extent and the particle size did not increase any more after 35 cycle. Therefore, PCR using 35 cycles was determined as the most suitable for sensing target DNA.

Figure 3. Correlation of the hydrodynamic size measured by DLS with number of PCR cycles (target DNA: 1.9 fM). Error bars represent standard deviations of sample measurements (n = 3).

PCR-DLS assay performance. To investigate the sensitivity of this PCR-DLS assay, different concentrations of target DNA were used to perform PCR. As shown in Figure 4a, a good linear correlation was obtained between the hydrodynamic size of particles and the logarithm of target DNA concentrations ranging from 10 aM to 1.9 pM, with a linear equation of D = – 8.88 + 60.32log10C (where D was the diameter of AuNPs measured by DLS, and C was the concentration of target DNA) and a correlation coefficient of 0.994. The limit of detection (LOD) was as low as 1.8 aM (S/N = 3), the excellent sensitivity of PCR-DLS assay may be derived from the PCR amplification of target DNA and the inherent advantage of DLS technique for particle size analysis. According to the World Health Organization 2010 criterion for switching to second-line treatment, a clinically relevant viral load is around 5000 copies mL-1 of HIV (corresponding to 10 aM) http://apps.who.int/iris/bitstream/10665/44379/1/9789241599764_eng.pdf. Therefore, the high sensitivity of PCR-DLS assay enables it to be used to diagnose AIDS in the future.

Figure 2. (a) AFM images of AuNP probes in the absence of HIV1 DNA. (b) AFM images of PCR product-linked AuNPs with addition of 1.9 fM HIV-1 DNA. (c) The height of AuNP probes. (d) The height of ds-DNA in PCR product.



Page 4 of 6

Table 1. Detection of target HIV DNA added in diluted nucleic acid samples from healthy human serum with the PCR-DLS assay (n =3)

Figure 4. (a) The calibration curve for the hydrodynamic diameter of particles plotted against the logarithm of target DNA concentrations ranging from 10 aM to 1.9 pM. (b) Hydrodynamic size of the AuNPs upon addition of different DNA sequence. Error bars are standard deviations of three replicates.

In order to assess the selectivity of the proposed strategy for target DNA, a randomly designed DNA sequence was added into the reaction system. After the same PCR procedure, the hydrodynamic size of particles was measured by DLS. As shown in Figure 4b, the particle size had no noticeable changes compared to the background signal (Ctrl), while the diameter was greatly increased by the addition of HIV DNA, which demonstrated that the sensing system could recognize target DNA with excellent selectivity. Furthermore, we investigated the effect of cycle number on the background signal of PCR-DLS assay and fluorescence PCR method, respectively. As can be seen from Figure 5, the background signal of fluorescence PCR method increased with the increase of cycle number, while that of the PCR-DLS assay hardly changed within 40 cycles. These results indicated that this PCR-DLS assay can effectively avoid nonspecific PCR reactions and reduce background signal.

Real sample assay. In order to evaluate the applicability of the proposed strategy in complex biological samples, recovery experiments for three different target DNA concentrations (100 aM, 10 fM, 1 pM) were conducted with standard addition method in 10-fold diluted nucleic acid samples obtained from serum of healthy individuals. As shown in Table 1, the calculated recovery values were between 95.5% and 102.3%, with a relative standard deviation (RSD) of 2.4−5.4%. These results demonstrated that the PCR-DLS assay can specifically recognize target DNA from a complex nucleic acid extractive, which has good potential for HIV DNA detection in real samples.

Sample

Added

Found

Recovery (%)

RSD (%)

1

100 aM

2

10 fM

95.5 aM

95.5

2.4

10.23 fM

102.3

5.4

3

1 pM

0.98 pM

97.7

5.1

CONCLUSION In summary, we have developed a low-cost and effective PCRDLS assay for ultrasensitive HIV-1 gene detection based on the average diameter change of AuNPs. In this study, PCR product containing free ssDNA tails at both ends can be generated by application of special primers, which can hybridize with AuNP probes, resulting in the aggregation of AuNPs and a significant increase in particle size. Our method has several advantages. Firstly, with addition of the AuNP probes prior to PCR amplification, the proposed strategy can simultaneously realize the PCR amplification and the hybridization reaction between PCR product and AuNP probes. Moreover, it can not only improve the amplification efficiency, but also reduce the risk of DNA contamination. Secondly, the PCR amplification of target DNA and the inherent advantage of DLS technique can greatly improve the sensitivity of this method with a detection limit at attamolar level. Thirdly, this PCR-DLS assay exhibits good specificity for target DNA, which enables its potential application in complex genomic DNA. Finally, the proposed strategy can be further expanded to detect other virus DNA by alternation of nucleic acid segment in primers.

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. TEM images of AuNPs without/with addition of HIV-1 DNA, data to determine the LOD, comparison of the proposed method with other methods in literatures (PDF).

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Tel & Fax: 86-20-84110156.

Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT Figure 5. Effect of cycle number on the background signal of PCRDLS assay and fluorescence PCR method, respectively. (A) PCRDLS assay, (B) SYRB-Green based fluorescence PCR.

This work was supported by the National Natural Science Foundation of China (Grant No. 21375153).

REFERENCES (1) Malm, K.; Sydow, M.; Andersson, S. Performance of three automated fourth-generation combined HIV antigen/antibody assays in large-scale screening of blood donors and clinical samples, Transfus. Med. 2009, 19, 78–88.


Page 5 of 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry (2) Fatin, M. F.; Ruslinda, A. R.; Arshad, M. K. M.; Tee, K. K.; Ayub, R. M.; Hashim, U.; Kamarulzaman, A.; Gopinath, S. C. B. HIV-1 Tat biosensor: current development and trends for early detection strategies, Biosens. Bioelectron. 2016, 78, 358–366. (3) Wang, L.; Tian, J.; Huang, Y.; Lin, X.; Yang, W.; Zhao, Y.; Zhao, S. Homogenous fluorescence polarization assay for the DNA of HIV A T7 by exploiting exonuclease-assisted quadratic recycling amplification and the strong interaction between graphene oxide and ssDNA, Microchim. Acta. 2016, 183, 2147–2153. (4) Ma, Y.; Shen, X. L.; Zeng, Q.; Wang, H. S.; Wang, L. S. A multiwalled carbon nanotubes based molecularly imprinted polymers electrochemical sensor for the sensitive determination of HIV-p24, Talanta 2017, 164, 121–127. (5) Ly, T. N.; Park, S.; Park, S. J. Detection of HIV-1 antigen by quartz crystal microbalance using gold nanoparticles, Sens. Actuators B 2016, 237, 452–458. (6) Majd, S. M.; Salimi, A.; Astinchap, B. The development of radio frequency magnetron sputtered p-typenickel oxide thin film field-effect transistor device combined with nucleic acid probe for ultrasensitive label-free HIV-1 gene detection, Sens. Actuators B 2018, 266, 178–186. (7) Wang, J.; Cai, X. H.; Rivas, G.; Shiraishi, H.; Farias, P. A. M.; Dontha, N. DNA electrochemical biosensor for the detection of short DNA sequences related to the human immunodeficiency virus, Anal. Chem. 1996, 68, 2629−2634. (8) Hu, Y. W.; Li, F. H.; Bai, X. X.; Li, D.; Hua, S. C.; Wang, K. K.; Niu, L. Label-free electrochemical impedance sensing of DNA hybridization based on functionalized graphene sheets, Chem. Commun. 2011, 47, 1743−1745. (9) Zhou, W. J.; Gong, X.; Xiang, Y.; Yuan, R.; Chai, Y. Q. Quadratic recycling amplification for label-free and sensitive visual detection of HIV DNA, Biosens. Bioelectron. 2014, 55, 220−224. (10) Enkin, N.; Wang, F.; Sharon, E.; Albada, H. B.; Willner, I. Multiplexed analysis of genes using nucleic acid-stabilized silver-nanocluster quantum dots, ACS Nano 2014, 8, 11666−11673. (11) Qaddare, S. H.; Salimi, A. Amplified fluorescent sensing of DNA using luminescent carbon dots and AuNPs/GO as a sensing platform: a novel coupling of FRET and DNA hybridization for homogeneous HIV-1 gene detection at femtomolar level, Biosens. Bioelectron. 2017, 89, 773–780. (12) Diao, W.; Tang, M.; Ding, S.; Li, X. M.; Cheng, W. B.; Mo, F.; Yan, X. Y.; Ma, H. M.; Yan, Y. R. Highly sensitive surface plasmon resonance biosensor for the detection of HIV-related DNA based on dynamic and structural DNA nanodevices, Biosens. Bioelectron. 2018, 100, 228–234. (13) Barth, H. G. Modern Methods of Particle Size Analysis; John Wiley & Sons: New York, 1984. (14) Berne, B. J.; Pecora, R. Dynamic Light Scattering: With Applications to Chemistry, Biology, and Physics; John Wiley & Sons: New York, 1976. (15) Zheng, T. Y.; Bott, S.; Huo, Q. Techniques for accurate sizing of gold nanoparticles using dynamic light scattering with particular application to chemical and biological sensing based on aggregate formation, ACS Appl. Mater. Interfaces 2016, 8, 21585–21594. (16) Shibayama, M.; Fujikawa, Y.; Nomura, S. J. Dynamic light scattering study of poly(N-isopropylacrylamide-co-acrylic acid) gels, Macromolecules 1996, 29, 6535–6540. (17) Mikol, V.; Hirsch, E.; Giegé, R. Monitoring protein crystallization by dynamic light scattering, FEBS Lett. 1989, 258, 63–66. (18) Liu, X.; Dai, Q.; Austin, L.; Coutts, J.; Knowles, G.; Zou, J. H.; Chen, H.; Huo, Q. A one-step homogeneous immunoassay for cancer biomarker detection using gold nanoparticle probes coupled with dynamic light scattering, J. Am. Chem. Soc. 2008, 130, 2780–2782.

(19) Kalluri, J. R.; Arbneshi, T.; Khan, S. A.; Neely, A.; Candice, P.; Varisli, B.; Washington, M.; McAfee, S.; Robinson, B.; Banerjee, S.; Singh, A. K.; Senapati, D.; Ray, P. C. Use of gold nanoparticles in a simple colorimetric and ultrasensitive dynamic light scattering assay: selective detection of arsenic in groundwater, Angew. Chem. Int. Ed. 2009, 121, 9848–9851. (20) Ma, X.; Wang, M.; Chen, C.; Isbell, M. A.; Wang, R.; Liu, D. S.; Yang, Z. Q. Improving the sensitivity for DNA sensing based on double-anchored DNA modified gold nanoparticles, Sci. China Chem. 2016, 59, 765–769. (21) Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles, Science 1997, 277, 1078–1081. (22) Adnan, N. N. M.; Cheng, Y. Y.; Ong, N. M. N.; Kamaruddin, T. T.; Rozlan, E.; Schmidt, T. W.; Duong, H. T. T.; Boyer, C. Effect of gold nanoparticle shapes for phototherapy and drug delivery, Polym. Chem. 2016, 7, 2888–2903. (23) Zhou, W.; Gao, X.; Liu, D.; Chen, X. Y. Gold Nanoparticles for in vitro diagnostics, Chem. Rev. 2015, 115, 10575–10636. (24) Long, Y.; Zhou, C.; Wang, C.; Cai, H.; Yin, C.; Yang, Q.; Xiao, D. Ultrasensitive visual detection of HIV DNA biomarkers via a multiamplification nanoplatform, Sci. Rep. 2016, 6, 23949. (25) Qian, R.; Ding, L.; Yan, L.; Lin, M.; Ju, H. A robust probe for lighting up intracellular telomerase via primer extension to open a nicked molecular beacon, J. Am. Chem. Soc. 2014, 136, 8205–8208. (26) Zhang, H.; Liu, Y.; Gao, J.; Zhen, J. A sensitive SERS detection of miRNA using a label-free multifunctional probe, Chem. Commun. 2015, 51, 16836–16839. (27) Miao, X. M.; Xiong, C.; Wang, W. W.; Ling, L. S. Dynamiclight-scattering-based sequence-specific recognition of double-strand DNA with oligonucleotide-functionalized gold nanoparticles, Chem. Eur. J. 2011, 17, 11230–11236. (28) Zhang, H.; Dong, H.; Yang, G.; Chen, H.; Cai, C. Sensitive electrochemical detection of human methyltransferase based on a dual signal amplification strategy coupling gold nanoparticle-DNA complexes with Ru(III) redox recycling, Anal. Chem. 2016, 88, 11108–11114. (29) Li, A.; Zhou, B.; Alves, C. S.; Xu, B.; Guo, R.; Shi, X.; Cao, X. Mechanistic studies of enhanced PCR using PEGylated PEI-entrapped gold nanoparticles, ACS Appl. Mater. Interfaces 2016, 8, 25808–25817. (30) Zou, L.; Li, R.; Zhang, M.; Luo, Y.; Zhou, N.; Wang, J.; Ling, L. A colorimetric sensing platform based upon recognizing hybridization chain reaction products with oligonucleotide modified gold nanoparticles through triplex formation, Nanoscale 2017, 9, 1986–1992. (31) Wang, P.; Zhang, T.; Yang, T.; Jin, N.; Zhao, Y.; Fan, A. A cascade amplification strategy based on rolling circle amplification and hydroxylamine amplified gold nanoparticles enables chemiluminescence detection of adenosine triphosphate, Analyst 2014, 139, 3796– 3803. (32) Li, H. K.; Huang, J. H.; Lv, J. H.; An, H. J.; Zhang, X. D.; Zhang, Z. Z.; Fan, C. H.; Hu, J. Nanoparticle PCR: nanogold-assisted PCR with enhanced specificity, Angew. Chem., Int. Ed. 2005, 44, 5100–5103. (33) Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes, J. Am. Chem. Soc. 1998, 120, 1959–1964. (34) Hurst, S. J.; Lytton-Jean, A. K. R.; Mirkin, C. A. Maximizing DNA loading on a range of gold nanoparticle sizes, Anal. Chem. 2006, 78, 8313–8318. (35) Zou, L.; Shen, R. D.; Ling, L. S.; Li, G. K. Sensitive DNA detection by polymerase chain reaction with gold nanoparticles, Anal. Chim. Acta 2018, https://doi.org/10.1016/j.aca.2018.07.006



Page 6 of 6

For TOC only


6

Ultrasensitive detection of HIV DNA with polymerase chain reaction

Recommend Documents