Ultrasensitive Signal-On Detection of Nucleic Acids with Surface

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

Ultrasensitive Signal-on Detection of Nucleic Acids with Surface-Enhanced Raman Scattering and Exonuclease III Assisted Probe Amplification Yingying Li, Qingcheng Zhao, Yandong Wang, Tiantian Man, Lu Zhou, Xu Fang, Hao Pei, Lifeng Chi, and Jian Liu Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b03267 • Publication Date (Web): 28 Oct 2016 Downloaded from http://pubs.acs.org on October 30, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Ultrasensitive Signal-on Detection of Nucleic Acids with Surface-Enhanced Raman Scattering and Exonuclease III Assisted Probe Amplification Yingying Li,§,† Qingcheng Zhao,§,† Yandong Wang,† Tiantian Man,‡ Lu Zhou,*,† Xu Fang,† Hao Pei,‡ Lifeng Chi,† Jian Liu*,† †

Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu, 215123, China ‡ School of Chemistry and Molecular Engineering, East China Normal University, Shanghai, 200241, China ABSTRACT: It is a rapidly-growing research field for the methodology development of nucleic acids detection. Here we report a powerful method to detect nucleic acids by an integration of surface-enhanced Raman scattering and exonuclease III assisted probe amplification. With a unique signal-on strategy, we have demonstrated that the target DNA of MnSOD gene in the concentration as low as 1 aM can reproducibly be detected, which offers a detection limit several orders of magnitude better than the previous reports in the literature. The new biosensor exhibits an excellent specificity in differentiating DNA sequences with a single-base mismatch. As a robust, flexible, and ultrasensitive approach, it promises important applications in clinical diagnostics and DNA identification where only a very limited amount of the biological sample is available.

Sensitive detection of nucleic acids is fundamentally important in life science and biomedical research as a tool of identifying various biological species,1,2 revealing the secrets of genetic circuits,3,4 and screening the diagnostic/prognostic biomarkers.5-7 A variety of techniques have been developed to analyze nucleic acids based on biochemical reactions.8-11 Though polymerase chain reaction (PCR) represents one of the most widely-used technical choices for nucleic acids research, there is also a trend of searching for non PCR-based techniques of nucleic acids analysis.12-14 Among these, the enzymes with unique selectivity in processing nucleic acids are promising to design new strategies as a critical component. Exonuclease III (Exo III) is an important exodeoxyribonuclease which can selectively digest one strand with either 5’ overhang or a blunt end, while leaving intact the other strand of the duplex DNA. Interestingly, Exo III is not active on the duplex DNA with 3’ overhangs of four or more bases in length.15,16 This predictable selectivity of Exo III allows for recycling of the intact DNA strand, as the target sequence typically, in the reaction of enzymatic cleavage. It offers a great chance to promote the detection sensitivity of nucleic acids, thus driving the research efforts for many applications in combination with fluorescence, electrochemistry, and surface plasma resonance.17-19 An inspiring design of coupling Exo III, fluorescence DNA probes, and graphene oxide together has been developed to detect two different DNA targets simultaneously with a detection limit down to the level of 1pM.20 Tang group has developed a label-free electrochemical DNA biosensor with the detection limit down to 10 fM, by using Exo IIIassisted autocatalytic target DNA recycling and simultaneously specific formation of G-quadruplex−hemin complexes.21 However, it remains a critical challenge to develop new tools of nucleic acids detection in medical diagnosis and food security analysis demanding higher sensitivity.22 Surface-enhanced Raman scattering (SERS) spectroscopy has emerged as a useful analytical tool, which allows for tremendous amplification (by a factor ranging from 105 to 1014) of the Raman signals of a molecule.23-25 This technique can provide the characteristic spectral fingerprints corresponding to the molecular structure, thus potentially offering a high specificity. Various molecules have been successfully detected using the

SERS technologies, including ions, small molecules, proteins, and nucleic acids.26-30 Ju group has developed new techniques which integrate SERS with DNA hybridization-based signal amplification for sensitive detection of nucleic acids.31,32 Ren group has demonstrated a great advance of this technology by obtaining high quality SERS signals of DNAs with single-base sensitivity and differentiating the innate characteristic peaks of the four bases.33 On the other hand, a pre-labeled SERS tag is still widely used for the detection of DNA.34-36 A SERS signaloff strategy has been developed for sensitive detection of nucleic acids in the concentration of as low as 10 fM, by employing stem-loop oligonucleotides tagged with organic dyes and the subsequent open-loop conformational change in the hybridization with the target DNA.37 However, a signal-off method typically suffers from increased uncertainty in practical detection, for instance, any defects on the SERS substrate or failure of the reagents may result in false-positive signals which are difficult to decode. A signal-on approach with high sensitivity is still in a great need for nucleic acids research. Here we report a new platform to detect nucleic acids by combining SERS technology and Exo III assisted probe amplification. This platform is featured with an ultrahigh sensitivity and a signal-on strategy, allowing for detection of manganese super oxide dismutase (MnSOD) gene in an extremely low concentration of 1 aM. The MnSOD gene encodes an important enzyme for the regulation of reactive oxygen species (ROS) produced by the cell metabolism.38,39 Disregulated expression of MnSOD gene leads to the breakdown of the redox equilibrium and many types of disease-related cell damages.40-42 Using our platform, a limited number of the target MnSOD DNA can initiate many cycles of hybridization and subsequent partial cleavage of the probe DNA, assisted by the Exo III selective digestion. It is a process of highly effective probe amplification by producing a large number of the residual probe DNAs which still keep the Cy5 dye as the SERS tags. These Cy5-tagged residual DNA segments are hybridized with the capture DNA on the Au nanoparticles decorated silicon (AuNPs@Si) substrate. Therefore, the sensitive SERS technique and Exo III assisted probe amplification have been integrated to promote the detection limit of nucleic acids with high efficiency. Distinct from

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the methods in the previous reports,37,43 the signal-on design in our approach can reduce undesired false-positive risks. We have demonstrated that our platform works well in a wide range of DNA concentrations. It enables the detection of the MnSOD gene with an ultrahigh sensitivity and specificity of differentiating the single-base mismatched DNA sequences. This new platform promises a useful and robust tool for important applications in nucleic acids research.

EXPERIMENTAL SECTION Chemicals and Reagents. Exonuclease III was provided from Thermo Scientfic Co., Ltd (Shanghai, China). Disodium hydrogen phosphate dodecahydrate (Na2HPO4), potassium phosphate monobasic (KH2PO4), magnesium chloride hexahydrate (MgCl2), sodium chloride (NaCl) and potassium chloride (KCl) were purchased from Sinopharm Chemical Reagent Co., Ltd (China). TRIS, TE, SDS (10%, w/v) and SSC (20X) buffer solutions were obtained by Beijing Solarbio Science & Technology Co., Ltd (Beijing, China). Cy5-NHS was purchased from Lumiprobe Co., Ltd (USA). Polyacrylamide was purchased from Sigma-Aldrich Co., Ltd (Shanghai, China). All chemicals in our experiments were of analytical grade and used without further purification. Aqueous solutions were prepared using ultrapure water (≥18 MΩ, Milli-Q, Millipore).The SERS substrates were manufactured by Nanova Inc. (Columbia, MO, USA). Oligonucleotides were synthesized and HPLC purified by Sangon Biotechnology Co., Ltd (Shanghai, China), including the sequences (From 5’ to 3’) as the following Table 1: Table 1. A List of the Oligonucleotide Sequences (5’ the Experiments. DNA

Sequences (5’

Probe Capture Target Single-base mismatch Scramble Residual

3’) in

3’)

Cy5-AAAAGAGAATGGGTAGGGCGGGTTGGGCCC ATTCTCCCAGTTGATT CATTCTCTTTTTTTTTTTTTT-SH AATCAACTGGGAGAATGTAACT AATCAACTCGGAGAATGTAACT CTGCACACCCAGTAAAGAGCAT Cy5-AAAAGAGAATGGGTAGGGCGGGTTGGGCCC

Instrumentation. SEM images were acquired with a scanning electron microscopy (FEI Quanta 200F) equipped with energy-dispersive X-ray (EDX) spectroscopy. The contact angle images were recorded by contact angle measurement instrument (DataPhysics OCA). The gel electrophoresis image was obtained using a Gel Images System (Tanon-2500). The Raman spectra were collected by a Raman microscope (HR800, Horiba JobinYvon, France) equipped with a He−Ne laser (633 nm, 20 mW) and a 100× objective (NA: 0.9), followed by the analysis with the LabSpec5 software. Enhancement Factor (EF) of the Substrate. The EF value was calculated by referring to the standard method described elsewhere,44 througth the following equation: 𝐼𝐼

×𝑁𝑁

𝐸𝐸𝐸𝐸 = 𝐼𝐼𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆×𝑁𝑁 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏 = 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏

𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆

𝐼𝐼𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆 𝑆𝑆 ×𝑉𝑉 ×𝐶𝐶 × 𝑆𝑆 𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆×𝑉𝑉 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏×𝐶𝐶 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏 𝐼𝐼𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏 𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆 𝑆𝑆𝑆𝑆𝑆𝑆𝑆𝑆

Here in the SERS measurements, 10 μl of 1 μM Cy5 aqueous solution was dispersed on the Au NPs@Si substrate, and 10 μl of 10 mM Cy5 solution was dispersed on the clean silicon wafer. The Raman intensities at 1366 cm-1 were respectively meas-

Page 2 of 13

ured for these two different types of substrates. All probe molecules within the laser spot were assumed to contribute to SERS signals. Separate SERS measurements were performed on 50 randomly-selected locations of each substrate. 4 identical substrates of each type were tested in parallel for validation of reproducibility. Based on the results of the measurements, the averaged EF value was determined to be 1.8×106 for the Au NPs@Si substrate. Electrophoresis Experiment. Polyacrylamide gel electrophoresis (PAGE) was performed by referring to the standard protocol described elsewhere,45 in order to verify the Exo III assisted cleavage of the probe DNA. PAGE (10%, w/w) in the buffer of 1×TAE was used to test different samples, under the voltage of 100 V at 4 oC. DNA Detection on the Au NPs@Si Substrate. Sensitive detection of DNA was performed using Au NPs@Si substrates in a two-step manner. The Au NPs@Si substrate (0.5 cm×0.5 cm) was treated with the capture DNA (400 nM) in PBS solution (500 μl, 10 mM, pH 7.5) overnight. The immobilization of the capture DNA on the Au NPs@Si substrate was fortified by a treatment with NaCl solution overnight (gradually to the final concentration of 0.1 M). The treated substrate was washed with the PBS solution three times (100 mM, pH 7.5) and DI water to remove excess DNA before subsequent tests. In parallel, the reaction of probe amplification assisted by Exo III was performed in a microtube, using a standard buffer for this enzyme (66 mM Tris-HCl, 0.66 mM MgCl2, pH 8.0). Typically if no otherwise specified, the probe DNA (500 nM) and the target DNA in the specified concentrations were mixed, and then incubated with the Exo III (60 U) at 37 oC for 2 h. A constant period of time (2 h) was adopted by referring to the user manual of Exo III. After the reaction, the solution was heated up to 75 oC for 10 min in order to inactivate the enzyme. It was incubated with the Au NPs@Si substrate containing the capture DNA at 37 oC for 2 h. The substrate was washed with 2×SSC solution containing 0.1% (w/v) SDS for 5 min and DI water for several times, then dried with a gentle flow of nitrogen before SERS detection. Control Experiments in SERS Measurements. A series of control experiments were performed to validate the design in nucleic acid detection, including (I) blank PBS solution (pH 7.5); (II) probe DNA solution (500 nM); (III) probe DNA (500 nM) and Exo III (60 U); (IV) the product solution of target DNA (1 pM), probe DNA (500 nM) and Exo III (60 U). The control samples were incubated with identical Au NPs@Si substrates containing the capture DNA at 37 oC for 2 h before the SERS measurements. Detection Limit of the Assay. The target DNA solutions were prepared in gradient concentrations. They were incubated with the probe DNA (500 nM) and Exo III (60 U) at 37 oC for 2 h before SERS measurements. The final concentrations of the target DNA were in the range from 10 nM down to 1 aM Specificity in DNA Detection. The specificity of our approach was verified through two sets of control experiments. In the first set, the DNA samples (1 pM) were separately tested under the identical condition, including the fully-matched target DNA for the MnSOD gene, single-base mismatched DNA, and scramble DNA. In the second set, the DNA samples were premixed between the target DNA and scramble DNA (1 pM) in


Page 3 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a series ratio of 1:1, 1:10, 1:100, 1:1000, followed by the same detection procedure.

RESULTS AND DISCUSSION Design of the SERS-based Signal-on DNA Biosensor. This work aims to develop a sensitive signal-on DNA biosensor with a combination of surface-enhanced Raman scattering and the enzyme-assisted probe amplification. The target DNA is a sequence (22 bases) of manganese superoxide dismutase (MnSOD) gene. As shown in Scheme 1, the single-stranded capture DNAs are immobilized on the surface of the Au NPdecorated silicon substrate (Au NPs@Si) via the Au-S bonds. The probe DNA consists of a stem-loop oligonucleotides tagged with cyanine dye Cy5 at the 5’ end. The Cy5 molecules exhibit an absorption peak at 647 nm. Under the irradiation of a laser (633 nm), they present characteristic SERS fingerprints, such as the peak of resonant molecular vibration at 1366 cm-1. In the absence of target DNA, two segments (9 bases) of the probe DNA hybridize to each other, thus forming a stem-loop structure with a protrusion of 3’ end. Due to the selectivity of Exo III, the protrusion of 3’ end shields the stem-loop structured probe DNA from being cleaved. There is no SERS signal because the probe DNA in the stem-loop structure cannot hybridize with the capture DNA on the Au NPs@Si substrate. However, the target DNA can open the stem-loop structure and hybridize with the probe DNA, reforming the double strands with a blunt 3’ terminus. Therefore, Exo III can recognize the blunt 3’ terminus and initiate enzymatic cleavage of the probe DNA to remove mononucleotides in a stepwise manner. A singlestranded residue of the probe DNA with Cy5 at 5’ end is generated after the reaction. The target DNA is released intact, being available to hybridize another probe DNA strand. Therefore, a single copy of the target DNA can initiate many cycles of cleavage reaction with assistance of Exo III, leading to generation of multiple copies of the residual probe DNA. It benefits the subsequent hybridization with the capture DNA on the Au NPs@Si substrate and allows for intensive SERS signals. Therefore, our approach is featured with a unique design to amplify signals by integrating enzymology and nanotechnology. The signal-on strategy in our design is distinct from the methods in the previous reports. It reduces the risks of undesired false-positive signals which may be subjective to the defects of the SERS substrates in signal-off detection. Characterization of the Au NPs@Si Substrate. A commercialized product (Q-SERS)46 of the Au NPs@Si substrate was selected in order to demonstrate the universal adaptability of our design. The morphology of the Au NPs@Si substrate was characterized by using scanning electronic microscopy (SEM). As shown in Figure 1a, the diameter of Au NPs was approximately 70 nm on the average. They were uniformly distributed on the surface of the silicon wafer. The EDX (Figure S1) measurement was employed as a characterization tool, suggesting a composition of the elements of Au and Si (73% : 27%, w:w) on the surface of the substrate. The dramatic change in the contact angle measurements (Figure 1b) indicated successful immobilization of the capture DNA on the substrate surface, attributed to the hydrophilic phosphate groups of the DNA strand. The enhancement factor in SERS measurements was evaluated by comparing the Au NPs@Si substrates and the blank silicon wafers using Cy5 (Figure 1c). Tremendously stronger Raman signals

were harvested from the Au NPs@Si substrates, corresponding to an EF value of 1.8×106. The SERS reproducibility of Au NPs@Si was investigated by measuring the SERS signal intensity of Cy5 in both the spot-to-spot and chip-to-chip manners. As shown in Figure 1d, uniform profiles of Raman spectra of Cy5 were obtained from randomly-selected 50 spots on the substrate, with relative standard deviation (RSD) values ranging from 9%-15% for different Raman spectra peaks. In addition, a chip-to-chip comparison was separately performed using 4 identical substrates, indicating that SERS signals were reproducible (Figure S2). Feasibility Validation. The sequences of DNA oligonucleotides in the experiments were analyzed for their conformations and potential hybridization efficiencies using an online software suite (NUPACK). It verified two critical checkpoints for the feasibility of this design. The free energy of secondary structure of the probe DNA was -35.0 KJ/mol at 37 oC, suggesting a relatively stable stem-loop conformation. The hybridization efficiency between the probe DNA and the capture DNA was very low. In contrast, the target DNA can hybridize with the probe DNA and change the conformation with a more favorable free energy of secondary structure (-97.3 KJ/mol). This new conformation was featured with a blunt 3’ terminus, available for the selective cleavage by Exo III (Figure S3). We performed the reaction of enzymatic cleavage, and analyzed the results with a standard PAGE method. It confirmed a high selectivity in the Exo III-assisted digestion of the probe/target DNA duplex with a blunt 3’ end in our design (Figure S4). The feasibility of our approach was further validated using a series of control samples for the SERS measurements. As shown in Figure 2a, there was a distinct difference of the SERS signal intensity between the positive and negative control experiments. The characteristic SERS signals of Cy5 were produced on the Au NPs@Si substrate in the positive control containing the probe/target DNA and Exo III (curve IV in Figure 2a). In contrast, only background noise was observed in the negative control groups. Specifically, in the blank control (curve I), there was no SERS signal. In the negative control (curve II), the capture DNA-immobilized substrate was incubated with the probe DNA only. It did not produce a valid SERS signal for detection because the characteristic Cy5 SERS fingerprints were indistinguishable from the background noise level. A third negative control where the substrate was incubated the probe DNA and Exo III (curve III) presented no SERS signal, either. The slightly elevated background noise level in the control experiments (curve II and III) might be resulted from nonspecific adsorption of probe DNA on the substrates. However, the signal intensity of the positive control (curve IV) was 7-8 folds higher than the background noise (Figure 2b). It suggested a robust detection using our approach by a combination of Exo III assisted probe amplification and SERS technology. The reproducibility in DNA detection was evaluated by profiling the SERS spectra of Cy5 from 50 random spots on the substrate in the experiments for the curve IV. As shown in Figure 2c, the Raman spectra were uniform and consistent to each other. The signal intensities were further quantified by measuring the characteristic Raman peak of Cy5 at 1366 cm-1 (Figure 2d). It confirmed the high reproducibility of our approach with a relatively low signal variation (RSD value of 16.4%). A further improvement might be feasible by optimization of the large-area homogeneity of the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Au NPs@Si substrates or the immobilization efficiency of the capture DNA on the substrate surface. Ultrahigh Sensitivity. The concentrations of the probe DNA and Exo III were pre-optimized in order to improve the performance of our approach. Multiple rounds of experiments were implemented by titrating the concentrations of component reagents individually, while keeping the other conditions constant. Then the signal intensities of the Cy5 at 1366 cm-1 were quantified for comparison, suggesting an optimized concentration with 500 nM for the probe DNA and 60 U for Exo III (Figure S5). A high sensitivity was expectable because Exo III-assisted cleavage would allow for recycling of the target DNA many times, and generation of a large number of residual probe DNA copies for the signal-on detection. The detection limit of this method was determined by titrating the concentrations of the target DNA from 10 nM to 1 aM. The concentration of the probe DNA was kept constant (500 nM), ensuing a saturated number of probes available for the enzymatic reaction. As shown in Figure 3a, a series of SERS spectra of Cy5 were collected with the concentration change of the target DNA. There was a remarkable decrease in SERS signal intensity along with the dilution of target DNA. In a quantitative analysis (Figure 3b), the intensities of characteristic Raman peak of Cy5 at 1366 cm−1 was reduced from 8×103 to 2×103, when the target DNA concentration was diluted from 10 nM to 1 aM. An additional control experiment was performed to investigate the effect of Exo III-assisted probe amplification on the detection limit. A Cy5-tagged residual DNA sequence was synthesized to mimic the cleaved product of the probe DNA by Exo III. It provided an important clue for the SERS signal without Exo III assistance by direct titration of the residual DNA on the Au NPs@Si substrate. As shown in Figure S6, the detection limit of using the residual DNA only was approximately in the pM range. However, integration of Exo III assisted probe amplification within 2 h would promote the detection limit by nearly 6 orders of magnitude (down to 1 aM). There was a relatively good linear relationship (correlation coefficient, R2 = 0.984) between the SERS intensity (ITarget/ IBG) with the logarithm of the concentrations of target DNA. The sensitivity of our method can be reflected by the slope of the titration experiment data after the linear regression analysis, approximately 546 (a.u.) per 10-fold change of the DNA concentration. In comparison with the results in the literature, the detection limit was at least 2 or 3 orders of magnitude better than the previous reports using the traditional signal-off method37,43 or with different amplification strategies,47-49 as summarized in the Table S1. Excellent Specificity. To investigate the specificity of our assays, additional DNA sequences were tested as control samples, including a single-base mismatched target DNA and a scramble DNA sequence. In Figure 4a, strong Raman signal of Cy5 was observed in the presence of fully complementary target DNA (1 pM). Single-base mismatched DNA produced much lower SERS signals, owing to the significantly lower hybridization efficiency to change the conformation of the probe DNA. The scramble DNA exhibited the SERS signals similar to a background noise level, because the scramble DNA and probe DNA cannot hybridize to each other at all, leading to no residual DNA produced in the process. A good reproducibility of signals in

Page 4 of 13

these test experiments were also confirmed by a random collection of SERS spectra of 50 spots for target DNA, single-base mismatched DNA, and scramble DNA respectively (Figure 4b). In a separate set of experiments, the different DNA samples were pre-mixed in a series of ratios, and tested to check the specificity of our assays. The concentration of target DNA was diluted, while the concentration of scramble DNA was fixed at 1 pM as an artificial noise. As shown in Figure 4c and 4d, with the dilution of the target DNA, the intensities of characteristic Raman peak of Cy5 at 1366 cm−1 gradually were reduced. Even at a dilution ratio of 1:1000 (a scramble DNA overwhelming mixture), it was still very clear to identify the SERS signals with our approach. These results clearly demonstrated a good specificity of the Exo III-assisted signal-on SERS sensor for DNA detection in our design.

CONCLUSIONS In summary, a robust DNA biosensor using the Exo III-assisted signal-on strategy was developed for ultrasensitive detection of MnSOD gene. A powerful integration of SERS technology and the highly efficient probe amplification by Exo III made it possible to detect nucleic acids as low as 1 aM. The detection limit was improved than the previous reports in the literature by several orders of magnitude. Simultaneously this biosensor exhibited an excellent specificity of detection by differentiating the single-based mismatched DNA sequences. Our approach was featured with a signal-on mechanism and offered the robustness and flexibility to detect various DNA sequences. It may find important applications for nucleic acids research in the area of bioanalysis, disease diagnostics, and clinical biomedicine.

ASSOCIATED CONTENT Supporting Information

Supporting Information Available : EDX of the substrate, repro-

ducibility of EF experiments, NUPACK analysis of DNA sequences, image of polyacrylamide gel electrophoresis, titration experiments of the probe DNA and Exo III, comparison of detection limits with / without probe amplification, and a table of performance comparsion of different SERS-based sensors. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Authors

*E-mail: [email protected] [email protected] Author Contributions

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.§ These authors contributed equally.

ACKNOWLEDGMENT This work is supported by the Major State Basic Research Development Program (2013CB932702), and by the National Natural


Page 5 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Science Foundation of China (21275106, 21575095); a project supported by Collaborative Innovation Center of Suzhou Nano Science and Technology, the Priority Academic Program Development of Jiangsu Higher Education Institutions. J.L. is supported by the “1000 Youth Talents” plan of the Global Expert Recruitment Program. (1) Hosack, D. A.; Dennis, G.; Sherman, B. T.; Lane, H. C.; Lempicki, R. A. Genome Biol. 2003, 4, 1-8. (2) Robinson, P. N.; Webber, C. PLoS Genet. 2014, 10, e1004268. (3) Gillingham, D.; Geigle, S.; Anatole von Lilienfeld, O. Chem. Soc. Rev. 2016, 45, 2637-2655. (4) Sahin, M.; Sur, M. Science 2015, 350, aab3897-aab3897. (5) Breaker, R. R. Nature 2004, 432, 838-845. (6) Schwarzenbach, H.; Hoon, D. S.; Pantel, K. Nat. Rev. Cancer 2011, 11, 426-437. (7) Kang, H.; Kiess, A.; Chung, C. H. Nat. Rev. Clin. Oncol. 2015, 12, 11-26. (8) Liu, Y.; Meng, F.; He, L.; Yu, X.; Lin, W. Chem. Commun. 2016, 52, 8838-8841. (9) Das, J.; Ivanov, I.; Montermini, L.; Rak, J.; Sargent, E. H.; Kelley, S. O. Nat Chem. 2015, 7, 569-575. (10) Furukawa, K.; Abe, H.; Tamura, Y.; Yoshimoto, R.; Yoshida, M.; Tsuneda, S.; Ito, Y. Angew. Chem. Int. Ed. 2011, 50, 1202012023. (11) Liu, J.; Williams, B. A.; Gwirtz, R. M.; Wold, B. J.; Quake, S. Angew. Chem. Int. Ed. 2006, 45, 3618-3623. (12) Zhao, Y.; Chen, F.; Li, Q.; Wang, L.; Fan, C. Chem. Rev. 2015, 115, 12491-12545. (13) Ji, H.; Yan, F.; Lei, J.; Ju, H. Anal. Chem. 2012, 84, 71667171. (14) Liu, X.; Wang, F.; Aizen, R.; Yehezkeli, O.; Willner, I. J. Am. Chem. Soc. 2013, 135, 11832-11839. (15) Henikoff, S. Gene 1984, 28, 351-359. (16) Gerasimova, Y. V.; Kolpashchikov, D. M. Chem. Soc. Rev. 2014, 43, 6405-6438. (17) Zuo, X.; Xia, F.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2010, 132, 1816-1818. (18) Xiong, E.; Zhang, X.; Liu, Y.; Zhou, J.; Yu, P.; Li, X.; Chen, J. Anal. Chem. 2015, 87, 7291-7296. (19) Lee, H. J.; Li, Y.; Wark, A. W.; Corn, R. M. Anal. Chem. 2005, 77, 5096-5100 (20) Liu, X.; Aizen, R.; Freeman, R.; Yehezkeli, O.; Willner, I. ACS Nano. 2012, 6, 3553-3563. (21) Liu, S.; Wang, C.; Zhang, C.; Wang, Y.; Tang, B. Anal. Chem. 2013, 85, 2282-2288. (22) Duan, R.; Lou, X.; Xia, F. Chem. Soc. Rev. 2016, 45, 17381749. (23) Nie, S.; Emory, S. R. Science 1997, 275, 1102-1106. (24) Campion, A.; Kambhampati, P. Chem. Soc. Rev. 1998, 27, 241-250. (25) Laing, S.; Gracie, K.; Faulds, K. Chem. Soc. Rev. 2016, 45, 1901-1918. (26) Shi, Y.; Wang, H.; Jiang, X.; Sun, B.; Song, B.; Su, Y.; He, Y. Anal. Chem. 2016, 88, 3723-3729. (27) Ye, M.; Wei, Z.; Hu, F.; Wang, J.; Ge, G.; Hu, Z.; Shao, M.; Lee, S. T.; Liu, J. Nanoscale 2015, 7, 13427-13437. (28) Chen, Y.; Ding, L.; Xu, J.; Song, W.; Yang, M.; Hu, J.; Ju, H. Chem. Sci. 2015, 6, 3769-3774.

REFERENCES .

(29) Han, X. X.; Huang, G. G.; Zhao, B.; Ozaki, Y. Anal. Chem. 2009, 81, 3329-3333. (30) Li, J.-M.; Ma, W.-F.; You, L.-J.; Guo, J.; Hu, J.; Wang, C.-C. Langmuir 2013, 29, 6147-6155. (31) Gao, F.; Lei, J.; Ju, H. Anal. Chem. 2013, 85, 11788-11793. (32) Gao, F.; Zhu, Z.; Lei, J.; Ju, H. Chem. Commun. 2012, 48, 10603-10605. (33) Xu, L.-J.; Lei, Z.-C.; Li, J.; Zong, C.; Yang, C. J.; Ren, B. J. Am. Chem. Soc. 2015, 137, 5149-5154. (34) Kang, T.; Yoo, S. M.; Yoon, I.; Lee, S. Y.; Kim, B. Nano Lett. 2010, 10, 1189-1193. (35) Zhang, J.; Joshi, P.; Zhou, Y.; Ding, R.; Zhang, P. Chem. Commun. 2015, 51, 15284-15286. (36) Cao, Y. C.; Jin, R.; Mirkin, C. A. Science 2002, 297, 15361540. (37) Wei, X.; Su, S.; Guo, Y.; Jiang, X.; Zhong, Y.; Su, Y.; Fan, C.; Lee, S.-T.; He, Y. Small 2013, 9, 2493-2499. (38) Oberley, L. W.; Buettner, G. R. Cancer Res. 1979, 39, 11411149. (39) Sarsour, E. H.; Kalen, A. L.; Goswami, P. C. Antioxid. Redox Signal. 2014, 20, 1618-1627. (40) Cullen, J. J.; Weydert, C.; Hinkhouse, M. M.; Ritchie, J.; Domann, F. E.; Spitz, D.; Oberley, L. W. Cancer Res. 2003, 63, 1297-1303. (41) Josson, S.; Xu, Y.; Fang, F.; Dhar, S. K.; St Clair, D. K.; St Clair, W. H. Oncogene 2006, 25, 1554-1559. (42) Dhar, S. K.; St Clair, D. K. Free Radical Biol. Med. 2012, 52, 2209-2222. (43) Ngo, H. T.; Wang, H.-N.; Burke, T.; Ginsburg, G. S.; VoDinh, T. Anal. Bioanal. Chem. 2014, 406, 3335-3344. (44) Huang, Z.; Meng, G.; Huang, Q.; Yang, Y.; Zhu, C.; Tang, C. Adv. Mater. 2010, 22, 4136-4139. (45) Meyer, M.; Masquida, B. Methods Mol. Biol. 2016, 1320, 5965. (46) Liu, B.; Zhou, P.; Liu, X.; Sun, X.; Li, H.; Lin, M. Food Bioprocess. Tech. 2013, 6, 710-718. (47) Pang, Y.; Wang, C.; Wang, J.; Sun, Z.; Xiao, R.; Wang, S. Biosens. Bioelectron. 2016, 79, 574-580. (48) Li, X.; Ye, S.; Luo, X. Chem. Commun. 2016, 52, 1026910272. (49) Ye, S.; Wu, Y.; Zhai, X.; Tang, B. Anal. Chem. 2015, 87, 8242-8249.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 13

Scheme 1. Schematic illustration of a DNA biosensor integrating SERS technology and Exo III-assisted probe amplification.


6

Page 7 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. (a) The SEM image of the Au NPs@Si substrate. (b) The contact angle measurements of the Au NPs@Si substrate before (top) and after (bottom) immobilization of the capture DNA. (c) Raman spectra of Cy5 on the Au NPs@Si substrate (red, 1 µM) or the silicon wafer (blue, 10 mM). (d) Raman spectra of Cy5 collected from 50 random spots on the Au NPs@Si substrate.


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 13

Figure 2. (a) SERS spectra of a series control samples on the capture DNA-Au NPs@Si substrate. (b) Intensity quantification of the SERS signals at 1366 cm−1 peak. Sample I: PBS buffer, II: probe DNA, III: probe DNA and Exo III, IV: probe DNA, target DNA and Exo III. Error bars: standard deviation from three independent assays (n=3). (c) SERS spectra of testing 1 pM target DNA collected from 50 random spots on the Au NPs@Si substrate. (d) SERS intensity profile at 1366 cm−1 peak from the 50 random spots.

Figure 3. (a) SERS spectra of titrating the target DNA concentration from 10 nM to 1 aM, including a blank control without the target DNA. (b) Intensity quantification of the SERS signals at 1366 cm−1 peak during the titration experiments. error bar: standard deviation from two different batches (n = 2).


8

Page 9 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (a) SERS spectra of testing the target DNA, single-base mismatched DNA and scramble DNA. Concentration: 1 pM. (b) SERS intensities at 1366 cm−1 peak of testing these three different DNA samples from 50 random spots. (c) SERS spectra of testing the mixtures of the target DNA and scramble DNA in a series ratios. (d) Intensity quantification of the SERS signals at 1366 cm−1 peak in testing the mixed DNA samples. Error bar: standard deviation of different spots (n =3).


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 1. Schematic illustration of a DNA biosensor integrating SERS technology and Exo III-assisted probe amplification.


Page 10 of 13

Page 11 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. (a) The SEM image of the Au NPs@Si substrate. (b) The contact angle measurements of the Au NPs@Si substrate before (top) and after (bottom) immobilization of the capture DNA. (c) Raman spectra of Cy5 on the Au NPs@Si substrate (red, 1 µM) or the silicon wafer (blue, 10 mM). (d) Raman spectra of Cy5 collected from 50 random spots on the Au NPs@Si substrate.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. (a) SERS spectra of a series control samples on the capture DNA-Au NPs@Si substrate. (b) Intensity quantification of the SERS signals at 1366 cm−1 peak. Sample I: PBS buffer, II: probe DNA, III: probe DNA and Exo III, IV: probe DNA, target DNA and Exo III. Error bars: standard deviation from three independent assays (n=3). (c) SERS spectra of testing 1 pM target DNA collected from 50 random spots on the Au NPs@Si substrate. (d)

SERS intensity profile at 1366 cm−1 peak from the 50 random spots.

Figure 3. (a) SERS spectra of titrating the target DNA concentration from 10 nM to 1 aM, including a blank control without the target DNA. (b) Intensity quantification of the SERS signals at 1366 cm−1 peak during the titration experiments. error bar: standard deviation from two different batches (n = 2).


Page 12 of 13

Page 13 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (a) SERS spectra of testing the target DNA, single-base mismatched DNA and scramble DNA. Concentration: 1 pM. (b) SERS intensities at 1366 cm−1 peak of testing these three different DNA samples from 50 random spots. (c) SERS spectra of testing the mixtures of the target DNA and scramble DNA in a series ratios. (d) Intensity quantification of the SERS signals at 1366 cm−1 peak in testing the mixed DNA samples. Error bar


Ultrasensitive Signal-On Detection of Nucleic Acids with Surface

Recommend Documents