Ultrastructural Study on the Specific Binding of Genetically Engineered

Sep 26, 2007 - of epidermal growth factor and collagen binding domains derived from von Willebrand factor or fibronectin were synthesized by means of ...
0 downloads 0 Views 1MB Size
Download PDF
Bioconjugate Chem. 2007, 18, 2137–2143

2137

Ultrastructural Study on the Specific Binding of Genetically Engineered Epidermal Growth Factor to Type I Collagen Fibrils Koichi Kato, Hideki Sato, and Hiroo Iwata* Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Received July 12, 2007; Revised Manuscript Received August 10, 2007

In an attempt to develop collagen-growth factor composites for use in tissue engineering, chimeric proteins consisting of epidermal growth factor and collagen binding domains derived from von Willebrand factor or fibronectin were synthesized by means of recombinant technology. These chimeric proteins were bound to type I collagen fibrils, and the ultrastructures of composites were analyzed by transmission electron microscopy combined with the gold nanoparticle labeling technique. The results of the ultrastructural study revealed that chimeric proteins were densely assembled on collagen fibrils through the specific recognition of binding sites, producing the ordered array of chimeric proteins.

INTRODUCTION Collagen is the most abundant and ubiquitous extracellular matrix in mammals and has been utilized as biomaterials in a variety of medical applications (1, 2). More recently, collagenbased hydrogels and porous materials have been used as scaffolds for tissue regeneration (3). In these tissue engineering approaches, signaling molecules such as growth factors have been frequently incorporated into collagen-based scaffolds for optimizing cellular responses (4). However, growth factors physically entrapped in scaffolds are rapidly released in an uncontrollable manner, reducing the efficacy of growth factors. To overcome this limitation, several attempts have been made to develop collagen binding growth factors by combining growth factors with polypeptide domains or short peptide sequences having an affinity for collagen R chains (5–8). Collagen-binding chimeric proteins have been rationally designed by means of recombinant technology. Using a bacterial expression system, Tuan et al. (5) synthesized biologically active transforming growth factor-β1 fused with a collagen-binding peptide. The research group extended this technology to prepare various growth factors having an affinity for collagen (6). Nishi et al. (7) and Ishikawa et al. (8) developed epidermal growth factor (EGF) that was fused with collagen binding domains (CBDs) derived from Clostridium histolyticum collagenase and human fibronectin, respectively. It was shown that these fusion proteins have potential for use in the controlled delivery of growth factors (7, 8), especially for accelerating wound-healing processes (8). Collagen also provides attractive materials for neural progenitor cell (NPC) transplantation that aims at the structural and functional restoration of the central nervous system suffering from degenerative diseases and traumatic injuries. In an attempt to provide favorable microenvironments for the survival and the controlled differentiation of NPCs, several groups utilized collagen hydrogels as scaffolds (9–12). However, current technologies have limited effects of scaffolding, probably due to the low availability of external signals for adhesion, proliferation, and differentiation. To address this limitation, we are currently involved in the development of collagen binding * To whom correspondence should be addressed. Phone and fax: +81-75-751-4119. E-mail: [email protected].

growth factors that improve their availability for NPCs enclosed in collagen-based materials. Our previous studies (13, 14) revealed that neural stem cells recognized histidine-tagged EGF anchored to the surfaces of culture substrates through coordination of the histidine tag with surface-immobilized metal ions. We found that the density of specifically anchored EGF was one of the most important factors for the attachment of neural stem cells mediated by EGF–EGF receptor interactions. This finding led us to suppose that the density of growth factors on collagen-based materials and their binding specificity play an important role in the successive signal transduction into cells. Therefore, the present study is undertaken to explore the spatial distribution of collagen binding EGF on the surface of type I collagen fibrils. We prepared EGF fused with CBD and labeled the chimeric proteins with gold nanoparticles (GNPs) to study the ultrastructure of the composites consisting of chimeric proteins and collagen fibrils by transmission electron microscopy (TEM).

EXPERIMENTAL PROCEDURES Construction of Recombinant Plasmids. A bacterial expression system was used to prepare two chimeric proteins consisting of human EGF, CBD derived from either the human von Willebrand factor (vWFCBD; 189 aa, residues 922-1110, A3 domain) (15) or human fibronectin (FNCBD; 340 aa, residues 260-599) (16), and the hexahistidine tag (6 × His). Control protein lacking CBD (EGF having 6 × His) was prepared as before (13). The structures of these proteins are shown in Figure 1. For the preparation of chimeric genes, the overlap extension method was employed (17–19). Primers used in polymerase chain reaction (PCR) are shown in Table 1. Forward primers for EGF (P1 and P3; identical to each other) contained an Nde I restriction site in the 5′ region, while reverse primers for vWFCBD (P6) and FNCBD (P8) contained, respectively, Xho I and Not I sites in the 5′ region. For subsequent overlap extension, reverse primers for EGF (P2 and P4) contained sequences complementary to the 5′-region of vWFCBD and FNCBD (21 bases in P2 and 19 bases in P4), whereas forward primers for vWFCBD (P5) and FNCBD (P7) contained sequences complementary to the 3′-region of EGF (21 bases in P5 and 19 bases in P7). Thus, P2 and P4 were exactly complementary to P5 and P7, respectively. In addition, six bases

10.1021/bc700259g CCC: $37.00  2007 American Chemical Society Published on Web 09/26/2007

2138 Bioconjugate Chem., Vol. 18, No. 6, 2007

Kato et al.

Figure 1. Structure of chimeric and control proteins synthesized in this study. The number of amino acid residues is (EGF) 53, (vWFCBD) 189, (FNCBD) 340, and (6 × His) 6.

were inserted between EGF and CBD to add Gly-Gly as a linker in between (GGTGGT in P5 and P7; ACCACC in P2 and P4). The cDNA of EGF and CBD were separately amplified from human cDNA libraries of the pancreas (for EGF and vWFCBD) and placenta (for FNCBD) (both from Takara Bio, Inc., Otsu, Japan), using P1 and P2 for EGF to be fused with vWFCBD, using P3 and P4 for EGF to be fused with FNCBD, using P5 and P6 for vWFCBD, and using P7 and P8 for FNCBD. An amount of 100 ng of DNA was used as templates in a 100 µL reaction volume that contained 2.5 units of DNA polymerase (Ex Taq, Takara), 0.2 mM dNTP mixture, and 0.4 µM primers. PCR was performed using a thermal cycler (Gene Amp PCR 9700G, Applied Biosystems) under the following cycling conditions: for EGF and vWFCBD, 30 cycles, denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 60 s; for FNCBD, 35 cycles, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 90 s. DNA fragments thus obtained were separated by 2% agarose gel electrophoresis and purified using a gel extraction kit (Qiagen). An amount of 100 ng of each DNA obtained by PCR was mixed (EGF + vWFCBD or EGF + FNCBD) in a solution (100 µL) containing 2.5 units of DNA polymerase (Takara Ex Taq) and 0.2 mM dNTP mixture. These overlapping fragments were denatured, annealed to generate heteroduplexes, and extended to obtain full-length DNA. For the fill-in reaction, the following thermal cycling conditions were employed: seven cycles, denaturation at 94 °C for 1 min, and annealing and extension at 63 °C for 4 min. In the second PCR, 50 µL of reaction products from the above fill-in reaction was used to amplify full-length DNA by priming with P1 and P6 for EGF–vWFCBD and with P3 and P8 for EGF–FNCBD under the following cycling conditions: for EGF–vWFCBD, 30 cycles, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 120 s; for EGF–FNCBD, 30 cycles, denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 90 s. Chimeric genes thus obtained were purified by gel electrophoresis and subjected to digestion with restriction enzymes, Nde I and Xho I for EGF–vWFCBD and Nde I and Not I for

EGF–FNCBD, followed by gel purification to obtain inserts with cohesive ends. These inserts were ligated using T4 ligase (Ligation High, Toyobo, Osaka, Japan) to the upstream of the 6 × His tag in pET-22b(+) plasmid (Novagen) previously linearized by digestion with the same restriction enzymes and transformed to Escherichia coli (E. coli) strain DH5R (Toyobo). Colonies were randomly picked up, and the presence of the plasmid was verified by colony PCR. Plasmid-containing colonies were then amplified in Luria–Bertani (LB) medium containing 100 µg/mL ampicillin, and plasmids were isolated by the QIAprep Spin Miniprep kit (Qiagen) and ethanol precipitation. After sequence verification, the plasmids obtained were transformed into the E. coli host strain BL21(DE3)pLysS (Novagen), and one of the colonies containing plasmids, checked by colony PCR, was amplified in LB medium containing 100 µg/mL ampicillin to obtain glycerol stocks. Protein Expression and Purification. The expression, purification, and refolding of chimeric proteins were carried out as before (13). In brief, the E. coli strain BL21(DE3)pLysS harboring recombinant plasmids were grown in 100 mL of LB medium containing 100 µg/mL ampicillin for 1 h. Then, 1 mM isopropyl β-D-thiogalactoside (IPTG) was added to the culture to induce gene expression. After 4 h of additional culture, cells were collected by centrifugation and chilled at –80 °C for 24 h. The cells were thawed and lysed in BugBuster protein extraction reagent (Novagen) containing 25 unit/mL Benzonase nuclease (Novagen). The inclusion bodies containing expressed proteins were purified according to the manufacture’s instructions and were solubilized in 20 mM PBS (pH 7.4) containing 8 M urea, 20 mM imidazole, and 5 mM 2-mercaptoethanol. After removal of insoluble particles by centrifugation and filtration, affinity purification was performed using His Trap HP column (Amersham). Trapped proteins were eluted with 20 mM PBS (pH 7.4) containing 8 M urea and 500 mM imidazole. Purified proteins were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) using 16% polyacrylamide gel with Tris/tricine/SDS buffer and visualized by staining with Coomassie brilliant blue. The refolding of proteins was performed by the stepwise dialysis method using dialysis membranes with a molecular weight cutoff of 3.5 kDa. Dialysis was performed sequentially against the following buffers: (i) 20 mM Tris-HCl, 0.2 mM dithiothreitol (pH 8.5), (ii) 20 mM Tris-HCl (pH 8.5), (iii) 20 mM Tris-HCl, 0.2 mM oxidized glutathione, 2 mM reduced glutathione (pH 8.0), and (iv) PBS (pH 7.4). Finally, PBS solutions of the refolded proteins were aliquoted and stored at –80 °C until use. Affinity Precipitation Assay. After being washed with pure water, Speharose CL-6B microbeads (Pharmacia) were suspended in 0.6 M epichlorohydrin in a 1:1 mixture of 0.4 M NaOH and bis(2-methoxyethyl) ether and kept at room temperature for 1 h to introduce epoxides to the beads (20). After being washed with water, the beads were transferred to 1 mM 11-mercapto-1-undecanoic acid in a 1:1 mixture of ethanol and PBS and kept overnight at room temperature to allow the reaction of epoxide with nucleophilic thiol (21). The resulting

Table 1. Primers Used in Overlap Extension PCR cDNA

code

a

P1 P2 P3 P4 P5 P6 P7 P8

EGF EGF

b

vWFCBD FNCBD a

DNA sequence of forward (FW) and reverse (RV) primersc FW RV FW RV FW RV FW RV

GGTCGTCATATGAATAGTGACTCTGAATGTCCCCTG GTCCAGGGGCTGGCTGCAGTCACCACCGCGCAGTTCCCACCACTTCAG GGTCGTCATATGAATAGTGACTCTGAATGTCCCCTG GCGGTTGGTAAACAGCTGCACCACCGCGCAGTTCCCACCACTTCAG CTGAAGTGGTGGGAACTGCGCGGTGGTGACTGCAGCCAGCCCCTGGAC TCCTCGAGAGAGCACAGTTTGTGGAGGAAGG CTGAAGTGGTGGGAACTGCGCGGTGGTGCAGCTGTTTACCAACCGC GAGTGCGGCCGCCCACTGGATGGGGTGGGAGTTGGGC

Used for preparing EGF–vWFCBD. b Used for preparing EGF–FNCBD. c Restriction sites are underlined. Bases for Gly-Gly insertion are written in italics.

Specific Binding of Engineered EGF to Collagen Fibrils

Bioconjugate Chem., Vol. 18, No. 6, 2007 2139

Figure 4. Enzyme-linked immunosorbent assays for the binding of (open circle) EGF–vWFCBD and (closed circle) wild-type EGF onto collagen-coated surfaces. Data are expressed as the mean ( standard deviation for n ) 4. Figure 2. SDS–PAGE analysis results of chimeric and control proteins: (lanes 1 and 5) molecular weight standard; (lane 2) EGF–vWFCBD; (lane 3) EGF–FNCBD; (lane 4) EGF.

Figure 3. SDS–PAGE analysis results of chimeric and control proteins before (-) and after (+) contact with collagen-adsorbed gel beads.

beads presenting carboxylic acid were washed with water and suspended in 1 mg/mL type I collagen solution (Collagen I-PC, Koken, Tokyo, Japan) in 1 × 10-2 M HCl and kept at room temperature for 3 h to physically adsorb collagen to the beads. Then the beads were washed extensively with 1 × 10-2 M HCl to remove weakly adsorbed collagen. The adsorption of collagen was confirmed by micro-BCA protein assays (Pierce). The suspension of collagen-adsorbed beads (total volume of 100 µL with a bed volume of ∼70 µL) was mixed with an equal volume of PBS containing 0.2 mg/mL chimeric proteins or native EGF and kept at 37 °C for 20 min. Then the microbeads were separated from protein solutions by centrifugation. Supernatants and original protein solutions were analyzed by SDS–PAGE to assess concentration depletion due to adsorption to collagenmodified beads. Enzyme-Linked Immunosorbent Assay (ELISA). An amount of 100 µL microliter of 0.1 mg/mL type I collagen solution (I-PC, Koken) was added to each well of a 96-well polystyrene plate and incubated for 1 h at room temperature to allow the adsorption of collagen. Then the solution was aspirated, and the plate was washed with PBS. After blocking with Blocking One (Nacalai Tesque, Kyoto, Japan), 50 µL of PBS containing chimeric protein or CBD-deficient EGF at 0–50 µg/mL was

added to each well in quadruplicate and incubated at room temperature for 30 min to allow the binding of these proteins to preadsorbed collagen. The solution was aspirated, and the plate was extensively washed with PBS containing 0.05% Tween-20 (PBS-Tween20) followed by binding of goat antiEGF antibody [1:100, EGF (C20) sc-1341, Santa Cruz] and subsequently rabbit antigoat IgG (1:500, Molecular Probes). The plate was washed with PBS-Tween20. Then a solution of alkaline phosphatase-conjugated antirabbit IgG (Sigma) was added to the plate to allow binding of the antibody at room temperature for 30 min. After the plate was washed with PBSTween20, 100 µL of p-nitrophenyl phosphate solution (pNPP, Sigma) was added to the wells. The coloring reaction was allowed to proceed at 37 °C for 15 min and was stopped by adding NaOH solution. Finally, the optical density of the solution was recorded at 405 nm with a plate reader. GNP Labeling. GNPs were prepared according to the reported methods in which HAuCl4 was reduced by sodium citrate (22) or sodium borohydride (23). The average diameter of GNPs was 15 nm by citrate reduction and 5 nm by NaBH4 reduction when determined by TEM. The suspension of GNPs was centrifuged at 17000g for 1 h, and the pellet obtained was washed with water. This procedure was repeated two times, and then GNPs were suspended in H2O of 1/5 volume relative to the volume of the original suspension. To the suspension, a solution of EGF–vWFCBD, EGF–FNCBD, or EGF was added to a final concentration of 20 µg/mL, and the mixture was incubated at room temperature to physically adsorb these proteins to GNPs. After 2 h of incubation, the suspension was centrifuged at 17000g for 15 min and the pellet obtained was suspended in H2O. EGF–vWFCBD, EGF–FNCBD, and EGF possess intramolecular disulfide bonds and no free cysteine in their folded state. We consider that these proteins are adsorbed to GNPs primarily through nonspecific interactions, as in the case of bovine serum albumin (24). Although we have no experimental data that show the efficiency of the interactions for each protein, most of the GNPs are expected to adsorb nonspecifically these proteins from solutions at relatively high concentration. Binding to Collagen Fibrils. The tail tendon obtained from Fisher344 rats of 12 weeks old was cut into pieces with a length of approximately 1 mm, unraveled using fine forceps, and deposited onto a Cu grid that had been laminated with a polyvinylformal membrane, reinforced with a thin carbon layer, and treated with oxygen plasma. It is reported that the rat tail tendon mostly consists of type I collagen (25). To the grid, a drop of 2% Pluronic F-127 (Sigma) solution in water was pipetted and kept at room temperature for 6 h to block the

2140 Bioconjugate Chem., Vol. 18, No. 6, 2007

Kato et al.

Figure 5. TEM images of (A) a negatively stained collagen fibril and (B–I) a collagen fibril bound with GNP-labeled chimeric proteins. A single chimeric protein was used in parts B–G, whereas two different chimeras were (H) simultaneously or (I) sequentially bound to the fibrils. Parts B and C show the result of control experiments in which (B) nontreated GNPs and (C) GNPs with CBD-deficient EGF (control EGF) were adsorbed. Protein and diameter of GNPs in nm are as follows: (B) no protein, 5; (C) EGF (control), 15; (D) EGF–vWFCBD, 5; (E) EGF–vWFCBD, 15; (F) EGF–FNCBD, 5; (G) EGF–FNCBD, 15; (H, I) EGF–FNCBD, 5, and EGF–vWFCBD, 15. Scale bar is 200 nm.

nonspecific adsorption of GNPs. Then Pluronic solution was removed by absorbing with lint-free paper, and an aliquot of GNP-labeled protein solutions was pipetted to the grid to allow the binding of chimeric proteins to collagen fibrils at 4 °C overnight. When the assembly of two different proteins was studied, chimeric proteins (EGF–vWFCBD or EGF–FNCBD) labeled with different diameters of GNPs (5 or 15 nm) were applied in a mixture or in a sequential manner. The grid was washed with PBS–Tween20 and then fixed with 4% glutaraldehyde solution in PBS. Finally the grid was washed with water and air-dried. TEM. The grid with collagen fibrils and GNP-labeled chimeric protein was immersed in a 1:1 mixture of ethanol and water, saturated with uranyl acetate, and kept at room temperature for 30 min for negatively staining collagen fibrils. Then the grid was extensively washed with water and finally air-dried. TEM observation was carried out using Hitachi H-7000 operating at an accelerate energy of 75 kV and a typical magnification of 30000× to 60000×. Two-Dimensional Fast Fourier Transform. Digitized TEM images were rotated using Adobe Photoshop 5.0 to align a fibril of interest with the y-axis for the simplicity of later analyses and further transformed to binary images for avoiding interference by the banding patterns of negatively stained collagen fibrils. In addition, surrounding areas around fibrils were masked to eliminate noise originating from nonspecific GNPs. The images were trimmed into 1 µm × 1 µm and adjusted to 512 pixels × 512 pixels. The modified images thus obtained were

analyzed by two-dimensional fast Fourier transform (2D-FFT) using the Scion Image software (Scion Corp., MD).

RESULTS Chimeric Proteins. Figure 2 shows the result of SDS–PAGE analysis for proteins synthesized in this study. As can been seen, three proteins were separated as single bands. Estimated molecular weights are 7 kDa for EGF–His, 28 kDa for EGF–vWFCBD, and 44 kDa for EGF–FNCBD, and they are in accordance with those expected from the number of amino acids contained. Affinity for Collagen. The results of precipitation assays are shown in Figure 3. The bands of EGF–vWFCBD and EGF–FNCBD were significantly weakened after the compounds made contact with collagen-adsorbed gel beads, while the band of CBD-deficient control EGF remained almost unchanged. These results suggest that CBD-containing chimeric proteins have an affinity for type I collagen. The slight reduction in band intensity observed with control EGF is probably due to its nonspecific adsorption to the beads. To verify further an affinity for collagen, chimeric proteins were subjected to ELISA. As shown in Figure 4, EGF–vWFCBD was bound to the collagencoated surface. This is in marked contrast to CBD-deficient EGF that exhibited no sign of collagen binding. The results of precipitation assays and ELISA demonstrate that the chimeric proteins, EGF–vWFCBD and EGF–FNCBD, bind to collagen through collagen–CBD interactions. TEM Observation. The TEM image of negatively stained collagen fibrils (Figure 5A) exhibited a clear banding pattern along the fibril axis with a period of 67 nm, representing the

Specific Binding of Engineered EGF to Collagen Fibrils

Bioconjugate Chem., Vol. 18, No. 6, 2007 2141

Figure 6. Power spectra obtained by 2D-FFT of TEM images: (A) a negatively stained collagen fibril; (B–F) collagen fibrils with GNPlabeled chimeric or control proteins. Protein and diameter of GNP (nm) are as follows: (B) EGF, 15; (C) EGF–vWFCBD, 5; (D) EGF–vWFCBD, 15; (E) EGF–FNCBD, 5; (f) EGF–FNCBD, 15.

ordered assembly of collagen molecules according to the D-staggered model (26). As shown in Figure 5D–G, GNPs with CBD-containing chimeric proteins are observed selectively and tightly on collagen fibrils. In both cases with EGF–vWFCBD and EGF–FNCBD, it is frequently seen that the strings of GNPs are aligned perpendicular to the fibril axis. We could not observe clear difference between vWFCBD- and FNCBD-chimeras regarding the alignment of GNPs. The difference in the diameter of GNPs had small effects on the formation of strings, exhibiting a similar center-to-center distance between neighboring strings. In contrast, nontreated GNPs (Figure 5B) and GNPs with control EGF (Figure 5C) are seen sparsely on the fibril surface without noticeable ordered structure, suggesting no specific interactions operated between GNPs and collagen. Adsorption of GNPs occasionally took place at the surrounding regions around fibrils. The aggregation of GNPs was also observed especially for GNPs with EGF–FNCBD. These results are likely due to the strong propensity of GNPs for aggregation and adsorption. Attempts were further made to assemble two types of chimeric proteins carrying different CBDs on the same collagen fibril. vWFCBD and FNCBD are expected to recognize different binding sites on the collagen fibrils (27). It is seen that the ordered assembly is clear for smaller GNPs. On the other hand, a smaller number of larger GNPs is seen on the collagen fibrils, with much disordered arrangements compared to the case with smaller GNPs (Figure 5H). This is probably due to steric hindrance because similar results were obtained when EGF–FNCBD and EGF–vWFCBD were labeled with smaller and larger GNPs, respectively. Sequential binding of larger GNPs with EGF–vWFCBD and smaller GNPs with EGF–FNCBD resulted in the improved order of GNP arrangements (Figure 5I). 2D-FFT. To assess the periodical appearance of the strings, 2D-FFT was performed on the TEM images modified as described in the Experimental Procedures. The power spectra are shown in Figure 6. The meridional profiles (corresponding to the fibril axis) were obtained from the power spectra to extract

Figure 7. Meridional and equatorial profiles of the power spectra obtained by 2D-FFT of TEM images: (A) a negatively stained collagen fibril; (B–F) collagen fibrils with GNP-labeled chimeric or control proteins. The dashed lines in the meridional profiles indicate the position of lower-order diffraction peaks. Protein and diameter of GNP (nm) are as follows: (B) EGF, 15; (C) EGF–vWFCBD, 5; (D) EGF–vWFCBD, 15; (E) EGF–FNCBD, 5; (F) EGF–FNCBD, 15.

information about periodicity of the strings (Figure 7). Sharp peaks appearing in the meridional profile for a collagen fibril represent the periodic appearance of banding patterns with a frequency of 0.015 nm–1 [period ) 67 nm, identical to the D-period (26)], while no peaks were observed in the equatorial profile (corresponding to the transversal direction of collagen fibrils). In the case of collagen with EGF–vWFCBD, line profiles exhibited characteristic peaks representing the periodic appearance of strings along the longitudinal fibril axis with a frequency of 0.015 nm–1 (period ) 67 nm). Similar results were obtained for the case with EGF–FNCBD. In contrast, the profile for CBDdeficient EGF had no evident peaks. Alternatively, equatorial profiles exhibited no noticeable peaks in all the GNP–chimeric protein combinations.

DISCUSSION Collagen-based materials loaded with growth factors are expected to provide artificial microenvironments that mimic a natural extracellular matrix. In the present study, we utilized

2142 Bioconjugate Chem., Vol. 18, No. 6, 2007

Kato et al.

optimize proliferation and differentiation of neural stem/ progenitor cells.

ACKNOWLEDGMENT We thank Makio Fujioka, Central Laboratory for Electron Microscopy, Faculty of Medicine, Kyoto University, for his assistance with TEM. This study was supported by Kobe Cluster, the Knowledge-Based Cluster Creation Project, and Grants-inAid for Scientific Research (Grant 19659364), the Ministry of Education, Culture, Sports, Science and Technology (MEXT).

LITERATURE CITED

Figure 8. Illustration of the expected distribution of binding sites on the surface of a collagen fibril. When a binding site for CBD (marked in black) is located at a certain region in a collagen triple helix, the D-staggered assembly of collagen monomers produces an array of binding sites on the fibril surface. CBD contained in the EGF chimera recognizes these binding sites to present densely EGF on the fibril surface with nanometer-scale periodicity.

CBDs for the efficient loading of EGF to fibrillar collagen. Because the nanometer scale spatial distribution of surfaceimmobilized EGF is anticipated to have an influence on its recognition by cell surface receptors (13, 14), we studied here the ultrastructure of composites consisting of collagen fibrils and CBD-containing EGF. It is known that a collagen fibril is formed by the D-staggered arrangement of collagen molecules (26). According to the previous studies on 3D molecular packing by computational modeling (28, 29) and on surface microstructure by scanning electron microscopy (25) and atomic force microscopy (30), it seems that the D-staggered arrangement also explains in essence the assembled structure at the fibril surface. Because the extended form of a collagen triple helices laterally aligns with D-staggered arrangements, generating a fibril in which individual helices are aligned in the same or slightly declined (25) direction as the longitudinal fibril axis, any peptide segments in the collagen R chains are expected to appear periodically with an interval of 67 nm along the longitudinal fibril axis (26). This interval is identical to the observed periods of GNP strings, suggesting that the chimeric proteins recognized specific binding sites for CBD involved in the collagen R chains (Figure 8). However, it is further observed in the TEM images (Figure 5D–G) that the apparent interval of strings is smaller than 67 nm, with at least one more intermitting string. We speculate that this finding accounts for the existence of multiple binding sites on a single R chain for both vWFCBD (31, 32) and FNCBD (33) (Figure 8). It is also predicted that the binding sites are periodically distributed in the transversal direction on the fibril surface. However, there is not enough evidence to show the periodical distribution of chimeric proteins along the transversal axis. This is probably because of the small interhelix distance (1.5 nm) (26) compared to the size of GNPs (5 or 15 nm in diameter), which might hamper the binding of the GNPlabeled proteins to the neighboring sites by steric hindrance. In summary, EGF genetically engineered to carry CBDs recognizes their specific binding sites distributed on collagen fibrils. This produces a nanometer-scale molecular assembly, although the minor disorder of assembly was observed occasionally even in single-component systems. The utilization of different CBD-binding sites has potential for loading multiple growth factors in a single matrix. Further study is currently underway to design collagen-growth factor composites that

(1) Patino, M. G., Neiders, M. E., Andreana, S., Noble, B., and Cohen, R. E. (2002) Collagen as an implantable material in medicine and dentistry. J. Oral Implantol. 28, 220–225. (2) Lee, C. H., Singla, A., and Lee, Y. (2001) Biomedical applications of collagen. Int. J. Pharm. 221, 1–22. (3) Ikada, Y. (2006) Scope of tissue engineering. Tissue Engineering: Fundamentals and Applications Chapter 1, pp 1–89, Elsevier, Oxford, U.K. (4) Boontheekul, T., and Mooney, D. J. (2003) Protein-based signaling systems in tissue engineering. Curr. Opin. Biotechnol. 14, 559–565. (5) Tuan, T. L., Cheung, D. T., Wu, L. T., Yee, A., Gabriel, S., Han, B., Morton, L., Nimni, M. E., and Hall, F. L. (1996) Engineering, expression and renaturation of targeted TGF-beta fusion proteins. Connect. Tissue Res. 34, 1–9. (6) Hall, F. L., Kaiser, A., Liu, L., Chen, Z. H., Hu, J., Nimni, M. E., Beart, R. W., Jr., and Gordon, E. M. (2000) Design, expression, and renaturation of a lesion-targeted recombinant epidermal growth factor–von Willebrand factor fusion protein: efficacy in an animal model of experimental colitis. Int. J. Mol. Med. 6, 635–643. (7) Nishi, N., Matsushita, O., Yuube, K., Miyanaka, H., Okabe, A., and Wada, F. (1998) Collagen-binding growth factors: production and characterization of functional fusion proteins having a collagen-binding domain. Proc. Natl. Acad. Sci. U.S.A. 95, 7018–7023. (8) Ishikawa, T., Terai, H., and Kitajima, T. (2001) Production of a biologically active epidermal growth factor fusion protein with high collagen affinity. J. Biochem. (Tokyo) 129, 627–633. (9) O’Connor, S. M., Stenger, D. A., Shaffer, K. M., Maric, D., Barker, J. L., and Ma, W. (2000) Primary neural precursor cell expansion, differentiation and cytosolic Ca(2+) response in threedimensional collagen gel. J. Neurosci. Methods 102, 187–195. (10) Chen, S. S., Revoltella, R. P., Papini, S., Michelini, M., Fitzgerald, W., Zimmerberg, J., and Margolis, L. (2003) Multilineage differentiation of rhesus monkey embryonic stem cells in three-dimensional culture systems. Stem Cells 21, 281–295. (11) Itoh, T., Satou, T., Dote, K., Hashimoto, S., and Ito, H. (2005) Effect of basic fibroblast growth factor on cultured rat neural stem cell in three-dimensional collagen gel. Neurol. Res. 27, 429– 432. (12) Brannvall, K., Bergman, K., Wallenquist, U., Svahn, S., Bowden, T., Hilborn, J., and Forsberg-Nilsson, K. (2007) Enhanced neuronal differentiation in a three-dimensional collagen-hyaluronan matrix. J. Neurosci. Res. 85, 2138–2146. (13) Kato, K., Sato, H., and Iwata, H. (2005) Immobilization of histidine-tagged recombinant proteins onto micropatterned surfaces for cell-based functional assays. Langmuir 21, 7071–7075. (14) Nakaji-Hirabayashi, T., Kato, K., Arima, Y., and Iwata, H. (2007) Oriented immobilization of epidermal growth factor onto culture substrates for the selective expansion of neural stem cells. Biomaterials 28, 3517–3529. (15) Huizinga, E. G., Martijn van der Plas, R., Kroon, J., Sixma, J. J., and Gros, P. (1997) Crystal structure of the A3 domain of human von Willebrand factor: implications for collagen binding. Structure 5, 1147–1156.

Specific Binding of Engineered EGF to Collagen Fibrils (16) Skorstengaard, K., Thogersen, H. C., and Petersen, T. E. (1984) Complete primary structure of the collagen-binding domain of bovine fibronectin. Eur. J. Biochem. 140, 235–243. (17) Higuchi, R., Krummel, B., and Saiki, R. K. (1981) A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16, 7351–7367. (18) Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. (19) Sambrook, J., and Russell, D. W. (2001) Mutagenesis. Molecular Cloning. A Laboratory Manual 3rd ed., Chapter 13, Vol. 2, pp 1–105, Cold Spring Harbor Laboratory Press, New York. (20) Löfås, S., and Johnsson, B. (1990) A novel hydrogel matrix on gold surfaces in surface plasmon resonance sensors for fast and efficient covalent immobilization of ligands. J. Chem. Soc., Chem. Commun. 1526–1528. (21) Hermanson, G. T., Mallia, A. K., and Smith, P. K. (1992) Activation methods. Immobilized Affinity Ligand Techniques Chapter 2, pp 51–136, Academic Press, San Diego, CA. (22) Turkevich, J., Stevenson, P. G., and Hillier, J. (1951) A study of the nucleation and growth processes in the synthesis of colloidal gold. Discuss. Faraday Soc. 11, 55–75. (23) Grabar, K. C., Allison, K. J., Baker, B. E., Bright, R. M., Brown, K. R., Freeman, R. G., Fox, A. P., Keating, C. D., Musick, M. D., and Natan, M. J. (1996) Two-dimensional arrays of colloidal gold particles: a flexible approach to macroscopic metal surfaces. Langmuir 12, 2353–2361. (24) Brewer, S. H., Glomm, W. R., Johnson, M. C., Knag, M. K., and Franzen, S. (2005) Probing BSA binding to citrate-coated gold nanoparticles and surfaces. Langmuir 21, 9303–9307. (25) Raspanti, M., Ottani, V., and Ruggeri, A. (1989) Different architectures of the collagen fibril: morphological aspects and functional implications. Int. J. Biol. Macromol. 11367–371.

Bioconjugate Chem., Vol. 18, No. 6, 2007 2143 (26) Ottani, V., Martini, D., Franchi, M., Ruggeri, A., and Raspanti, M. (2002) Hierarchical structures in fibrillar collagens. Micron 33, 587–596. (27) Di Lullo, G. A., Sweeney, S. M., Korkko, J., Ala-Kokko, L., and San Antonio, J. D. (2002) Mapping the ligand-binding sites and disease-associated mutations on the most abundant protein in the human, type I collagen. J. Biol. Chem. 277, 4223–4231. (28) Silver, D., Miller, J., Harrison, R., and Prockop, D. J. (1992) Helical model of nucleation and propagation to account for the growth of type I collagen fibrils from symmetrical pointed tips: a special example of self-assembly of rod-like monomers. Proc. Natl. Acad. Sci. U.S.A. 89, 9860–9864. (29) Hulmes, D. J., Wess, T. J., Prockop, D. J., and Fratzl, P. (1995) Radial packing, order, and disorder in collagen fibrils. Biophys. J. 68, 1661–1670. (30) Kato, K., Bar, G., and Cantow, H.-J. (2001) The interplay between surface micro-topography and -mechanics of type I collagen fibrils in air and aqueous media: an atomic force microscopy study. Eur. Phys. J. E 6, 7–14. (31) Fitzsimmons, C. M., Cockburn, C. G., Hornsey, V., Prowse, C. V., and Barnes, M. (1988) The interaction of von Willebrand factor (vWf) with collagen: investigation of vWf-binding sites in the collagen molecule. J. Thromb. Haemostasis 59, 186–192. (32) Nishida, N., Sumikawa, H., Sakakura, M., Shimba, N., Takahashi, H., Terasawa, H., Suzuki, E., and Shimada, I. (2003) Collagen-binding mode of vWF-A3 domain determined by a transferred cross-saturation experiment. Nat. Struct. Biol. 10, 53– 58. (33) Ingham, K. C., Brew, S. A., and Migliorini, M. (2002) Type I collagen contains at least 14 cryptic fibronectin binding sites of similar affinity. Arch. Biochem. Biophys. 407, 217–223. BC700259G