Ultraviolet Radiation-Elicited Enhancement of Isoflavonoid

Article pubs.acs.org/JAFC

Ultraviolet Radiation-Elicited Enhancement of Isoflavonoid Accumulation, Biosynthetic Gene Expression, and Antioxidant Activity in Astragalus membranaceus Hairy Root Cultures Jiao Jiao,∥,‡ Qing-Yan Gai,∥,†,§ Wei Wang,†,§ Meng Luo,†,§ Cheng-Bo Gu,†,§ Yu-Jie Fu,*,†,§ and Wei Ma*,‡,# †

Key Laboratory of Forest Plant Ecology, Ministry of Education, and ‡State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, Harbin, Heilongjiang 150040, People’s Republic of China § Collaborative Innovation Center for Development and Utilization of Forest Resources, Harbin, Heilongjiang 150040, People’s Republic of China # School of Pharmaceutical, Heilongjiang University of Chinese Medicine, Harbin, Heilongjiang 150040, People’s Republic of China ABSTRACT: In this work, Astragalus membranaceus hairy root cultures (AMHRCs) were exposed to ultraviolet radiation (UVA, UV-B, and UV-C) for promoting isoflavonoid accumulation. The optimum enhancement for isoflavonoid production was achieved in 34-day-old AMHRCs elicited by 86.4 kJ/m2 of UV-B. The resulting isoflavonoid yield was 533.54 ± 13.61 μg/g dry weight (DW), which was 2.29-fold higher relative to control (232.93 ± 3.08 μg/g DW). UV-B up-regulated the transcriptional expressions of all investigated genes involved in isoflavonoid biosynthetic pathway. PAL and C4H were found to be two potential key genes that controlled isoflavonoid biosynthesis. Moreover, a significant increase was noted in antioxidant activity of extracts from UV-B-elicited AMHRCs (IC50 values = 0.85 and 1.08 mg/mL) in comparison with control (1.38 and 1.71 mg/mL). Overall, this study offered a feasible elicitation strategy to enhance isoflavonoid accumulation in AMHRCs and also provided a basis for metabolic engineering of isoflavonoid biosynthesis in the future. KEYWORDS: Astragalus membranaceus, hairy root cultures, ultraviolet elicitation, gene expression, isoflavonoid biosynthesis, antioxidant activity

■

INTRODUCTION Astragalus membranaceus is an important perennial herb of the Leguminosae family. Its roots have been recognized as wellestablished traditional medicines in East Asian areas, as well as health foods and dietary supplements (e.g., teas, drinks, soups, and capsules) in Western countries.1−3 Calycosin-7-O-β-Dglucoside (CAG), ononin (ON), astraisoflavan-7-O-β-D-glucoside (ASG), calycosin (CA), and formononetin (FO), the principal active isoflavonoids occurring in A. membranaceus roots, are associated with versatile health benefits including antioxidant, cardioprotective, anti-inflammatory, antiviral, immunomodulatory, antifatigue, hematopoietic, hypolipidemic, neuroprotective, antitumorigenic, and estrogenic activities.4 Currently, the growing world demand for bioactive plant secondary metabolites in the food, nutraceutical, pharmaceutic, and cosmetic fields has prompted a search for obtaining large quantities of isoflavonoids from this species.5,6 Nowadays, the commercial supply of A. membranaceus roots is mainly taken from farming sources, and the quality of phytochemicals in this herb is highly affected by climate and environmental conditions.7,8 Besides, field cultivation is a time-consuming and labor-intensive process. These problems, together with the decreasing agriculture lands for medicinal plants in the world, lead to an increased need to develop sustainable production of isoflavonoids through plant in vitro culture technology. Agrobacterium rhizogenes-induced hairy root cultures (HRCs) have received increasing attention as an effective bioproduction platform for diverse phytochemicals, because these cultures © XXXX American Chemical Society

possess biosynthetic capacity comparable to that of the parent plants, high growth rates independent of hormones, genetic/ biochemical stability, and amenability for scale up in bioreactor systems.9−13 Importantly, HRCs can be utilized as an excellent biological experimental system for the elucidation of biosynthetic pathways of secondary metabolites.10−12 In our previous paper, A. membranaceus hairy root cultures (AMHRCs) have been established as a promising and continuous platform that can supersede the field-grown plants for the production of isoflavonoids.4 Nevertheless, a great deal of effort should be made to enhance the accumulation of isoflavonoids in AMHRCs. Among various biotechnological approaches, elicitation, the treatment of plant cells/organs with biotic or abiotic elicitors that can modulate plant defense reactions, has been recognized as the most practical strategy for incrementing production of valuable secondary metabolites in vitro.9,14−16 Generally, isoflavonoids function as phytoalexins/phytoanticipins that can be induced to improve plant survival under various environmental stresses.17,18 Notably, ultraviolet (UV) radiation has long been perceived as an effective elicitor (or stressor) for boosting the biosynthesis of various plant secondary metabolites.19−21 Currently, UV treatment as an Received: June 25, 2015 Revised: September 1, 2015 Accepted: September 7, 2015

A

DOI: 10.1021/acs.jafc.5b03138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Plant RNA Extraction Kit (TaKaRa) in accordance with the manufacturer’s protocols. The quality and quantity of RNA were assessed by agarose gel electrophoresis and determined by a GeneQuant II RNA/DNA calculator (Pharmacia Biotech, Cambridge, UK), respectively. Subsequently, total RNA (500 ng) was reversetranscribed to cDNA using a PrimeScript RT reagent Kit (TaKaRa) following the manufacturer’s instructions. Finally, the synthesized cDNA (20 μL) was diluted to 200 μL with sterile water and used as the template for the subsequent molecular experiments. Quantitative Real-Time PCR Analysis. Quantitative real-time PCR (qRT-PCR) was performed with a Stratagene Mx3000P RealTime PCR system (Agilent Technologies, Santa Clara, CA, USA). Specific primers for genes (Table 1) involved in isoflavonoid

emerging elicitation technology has been applied to generate fruits, vegetables, and herbs enriched with valuable phytochemicals either for fresh consumption or as a source for functional foods and nutraceuticals, causing the increased ingestion of these health-beneficial substances.22−26 Additionally, UV radiation is a promising and clean elicitation approach that does not taint the production system and that, moreover, can be easily manipulated. Therefore, an interesting possibility is to exploit UV radiation for enhancing isoflavonoid accumulation in AMHRCs. This can satisfy consumer demand for these naturally derived health-promoting products. The main objective of this work was to improve isoflavonoid production in AMHRCs through UV (UV-A, UV-B, and UVC) elicitation and to obtain extracts with higher antioxidant activity for possible use in ther food, nutraceutical, pharmaceutic, and cosmetic industries. Moreover, the transcriptional expressions of genes involved in isoflavonoid biosynthetic pathway were examined to shed light on the molecular changes that took place in the elicited AMHRCs and the possible bottlenecks that controlled isoflavonoid biosynthesis. To the best of our knowledge, no information about the effect of UV elicitation on isoflavonoid accumulation, biosynthetic gene expression, and antioxidant activity in AMHRCs is currently available.

■

Table 1. Primers for Associated Genes Involved in Isoflavonoid Biosynthetic Pathway gene name

primer sequence (5′ to 3′)

product size (bp)

PAL

forward: CATCAAATCTCTCTGGCAGTAGGAA reverse: AGTTCACATCTTGGTTATGCTGCTC

147

C4H

forward: AACAAAGTGAGGGATGAAATTGACA reverse: GGATTGCCATTCTTAGCCTTAGTGT

127

4CL

forward: TGTCCCTCCTATTGTTTTGGCTATT reverse: CTTTGGGGAATTTAGCTCTGACAGT

140

CHS

forward: CCTTCTTTGGATGCTAGACAAGACA reverse: CGAAGACCCAAGAGTTTGGTTAGTT

188

CHR

forward: AAACAAGGTTACAGGCATTTTGACA reverse: GGAAGAACGAGATGAGGATGATTTT

164

CHI

forward: ATCGAGTTTTTCCACCAGGATCTAC reverse: ATCATAGTCTCCAACACAGCCTCAG

154

IFS

forward: CCTTCACCTATTGGACAAACCTCTT reverse: CCTGGTATTAAAGGAAGAAGCCTCA

172

I3′H

forward: GGATGTTAAAGAAGCGAAGCAATTT reverse: ATCAAACAATCTCAACAAAGGCAAA

106

18S

forward: TGCAGAATCCCGTGAACCATC reverse: AGGCATCGGGCAACGATATG

104

MATERIALS AND METHODS

Plant Materials and Reagents. All experiments were conducted with a highly productive A. membranaceus hairy root line II (AMHRL II) established previously by our laboratory.4 Stock cultures of AMHRL II were maintained on Murashige and Skoog (MS)-based solid medium supplemented with 30 g/L sucrose and 1 g/L casein hydrolysate but without NH4NO3, at 25 ± 1 °C in the dark. Standard compounds including CAG, ON, ASG, CA, and FO were purchased from Weikeqi Biological Technology Co. Ltd. (Sichuan province, China). MiniBEST Plant RNA Extraction Kit, PrimeScript RT Reagent Kit, and SYBR Premix Ex TaqII Kit were provided by TaKaRa (Dalian, China). Ascorbic acid (VC), 2,2-diphenyl-1picrylhydrazyl-hydrate (DPPH), linoleic acid, butylated hydroxytoluene (BHT), and β-carotene were obtained from Sigma-Aldrich Co. (Steinheim, Germany). Lamps (40 W) of UV-A, UV-B, and UV-C were bought from Beijing Institute of Electric Light Source (Beijing, China). Other reagents of either analytical or optical grade were purchased from Beijing Chemical Reagents Co. (Beijing, China). UV Elicitation Treatments to AMHRCs. After AMHRCs were cultured under the optimal conditions described previously,4 the spent media were then renewed. The distance of UV lamps from AMHRCs was adjusted to obtain a low intensity (3 W/m2) monitored by a DRC100X photometer (Spectronics, Westbury, NY, USA). The UV elicitation dose (typically in kJ/m2) was calculated as 3 W/m2 multiplied by the irradiation time. During elicitation experiments, cultures were divided into four groups: one being used as control at 28 ± 1 °C in the dark and the others being irradiated by UV-A (λmax = 365 nm), UV-B (λmax = 313 nm), and UV-C (λmax = 254 nm) at 28 ± 1 °C for 4 h, that is, 43.2 kJ/m2, respectively. Moreover, AMHRCs were harvested under a series of UV-B doses (0, 5.4, 10.8, 21.6, 43.2, 64.8, 75.6, 86.4, 97.2, 129.6, and 172.8, kJ/m2) that were calculated as 3 W/m2 multiplied by different exposure durations (0, 0.5, 1, 2, 4, 6, 7, 8, 9, 12, and 16, h). After elicitation treatments, parts of UV-elicited and control root samples were placed into aluminum foil packets, frozen immediately with liquid nitrogen, and stored at −80 °C for further RNA isolation. The remaining root samples were rinsed with tap and distilled water, dry-blotted on filter paper, and dried in a vacuum oven at 50 °C to a constant dry weight (DW) for liquid−solid extraction of isoflavonoids. Meanwhile, the medium samples were also collected for liquid−liquid extraction of isoflavonoids. RNA Isolation and cDNA Preparation. Total RNA was isolated from frozen hairy roots (250 mg, fresh weight) using a MiniBEST

biosynthetic pathway were designed as suggested previously.27 The reaction solution (20 μL) for qRT-PCR assay contained 10 μL of SYBR Premix Ex TaqII (TaKaRa), 0.8 μL of each specific primer (10 μM), 2 μL of the above cDNA template, and 6.4 μL of sterile water. The amplification procedure for all investigated genes was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 20 s. The relative expression level of each gene B


Article

Journal of Agricultural and Food Chemistry was calculated using the 18S gene as the internal reference. Results were analyzed by Mxpro-Mx3000P software according to the delta CT method.28 Isoflavonoid Extraction and LC-MS/MS Analysis. The complete extraction of isoflavonoids from root samples was performed as described previously.4 To extract isoflavonoids from liquid media, samples were partitioned twice with ethyl acetate in a separatory funnel. The organic phases were combined and then evaporated to dryness at 45 °C using a rotary evaporator. All extracts obtained from both root and medium samples were redissolved in 25 mL of methanol (HPLC grade) and then filtered through a 0.45 μm membrane for LCMS/MS analysis. An Agilent 1100 series HPLC (Agilent Technologies, San Jose, CA, USA) coupled to an API 3000 triple tandem quadrupole MS (Applied Biosystems, Concord, ON, Canada) with a Phenomenex Gemini C18 110A reversed-phase column (250 mm × 4.6 mm i.d., 5 μm) was used for the determination of five target isoflavonoids. According to our previous research,4 the mass spectra of selected reaction monitoring at m/z 445.2 → 283.0, 428.8 → 266.9, 463.2 → 301.1, 283.0 → 268.0, and 267.0 → 252.0 were chosen for the identification and quantification of CAG, ON, ASG, CA, and FO, respectively. The content of each target compound was calculated by the calibration curve and reported as micrograms per gram based on the DW of roots. Determination of Antioxidant Activities. Antiradical activities and antilipid peroxidation capacities of extracts from AMHRCs were respectively determined by DPPH radical-scavenging assay and βcarotene/linoleic acid bleaching test.4 Antioxidant properties of samples were expressed as IC50 values, which were calculated through the logarithmic regression curves for DPPH radical scavenging ratio (%) or β-carotene bleaching inhibition percentages (%) versus sample concentration (mg/mL). The higher antioxidant activity was corresponding to the lower IC50 value. Activities of antioxidant enzymes including superoxide dismutases (SOD, EC 1.15.1.1), catalase (CAT, EC 1.11.1.6), ascorbate peroxidase (APX, EC 1.11.1.11), and glutathione reductase (GR, EC 1.6.4.2) were determined according to the previously reported methods.29 Statistical Analysis. All experiments were conducted three times. Results were expressed as means ± standard deviations. The data were statistically analyzed using the SPSS statistical software (version 17.0, SPSS Inc., Chicago, IL, USA). Differences between means were determined by analysis of variance with Tukey’s test on the level of significance declared at P < 0.05.

Figure 1. Effects of UV-A, UV-B, and UV-C treatments (43.2 kJ/m2, i.e., 4 h) on the yield of total target isoflavonoids in 34-day-old AMHRCs. Control: nontreated AMHRCs. Mean ± SD values not sharing the same lower case letters are significantly different (P < 0.05).

(362.15 ± 19.42 μg/g DW). Overall, UV-B was screened as the best elicitor that was adopted for the subsequent experiments. Effect of Elicitation Dose of UV-B on Isoflavonoid Accumulation. The effect of an elicitor on the yield of secondary metabolites for a specific plant in vitro culture primarily depends on the elicitation dose.9,14−16 Thus, it is of great necessity to investigate the effects of different UV-B radiation doses on the yield of total target isoflavonoids in 34day-old AMHRCs. As exhibited in Figure 2A, it is obviously demonstrated that the mild-dose UV-B radiation (86.4 kJ/m2) was the most favorable for isoflavonoid accumulation. The decrease of isoflavonoid amount under high-dose UV-B treatments (97.2−129.8 kJ/m2) might be associated with the irreversible damage of cellular macromolecules such as proteins, nucleic acids, and lipids due to the absorption of the energyrich radiation.20,30 Additionally, it is worth mentioning that UVB-elicited AMHRCs (Figure 2C) showed a significant indication of stress (browning color in root tissues) in comparison with the corresponding control cultures (Figure 2B). Isoflavonoid Profiles in Response to UV-B Elicitation. Isoflavonoid profiles in AMHRCs treated by different UV-B radiation doses are presented in Table 2. Under the optimal elicitation dose (86.4 kJ/m2), UV-B-treated AMHRCs were capable of yielding 533.54 ± 13.61 μg/g DW of total isoflavonoids, which was 2.29-fold higher as against that of control (232.93 ± 3.08 μg/g DW). In detail, the contents of CAG, ON, ASG, CA, and FO in the elicited AMHRCs were 14.57 ± 0.87, 5.83 ± 0.46, 119.59 ± 6.72, 225.01 ± 8.28, and 168.54 ± 5.36 μg/g DW, respectively, which were correspondingly 1.61-, 1.42-, 1.87-, 2.35-, and 2.90-fold higher as compared to those in the control (9.06 ± 0.13 μg/g DW CAG, 4.12 ± 0.19 μg/g DW ON, 64.95 ± 3.77 μg/g ASG, 95.64 ± 2.80 μg/g CA, and 59.16 ± 1.65 μg/g DW FO). These differences could be appreciated by comparing the LC-MS/MS chromatograms of extracts from different treated AMHRCs (Figure 3). Putative Isoflavonoid Biosynthetic Pathway. To elucidate the transcriptional regulation of isoflavonoid biosynthesis upon UV-B elicitation, a better understanding of the isoflavonoid biosynthetic pathway is essential. On the basis of current ideas,17,27,31,32 a putative biosynthetic scheme of target

■

RESULTS Effect of Different Types of UV radiation on Isoflavonoid Accumulation. Under the optimal culture conditions described previously,4 34-day-old AMHRCs are capable of achieving the maximum isoflavonoid accumulation and biomass production. Therefore, 34-day-old AMHRCs adopted in this work were elicited by UV radiation for further enhancing isoflavonoid biosynthesis without affecting biomass productivity. Nevertheless, whether UV elicitation can promote isoflavonoid biosynthesis in AMHRCs was still unknown. Accordingly, 34-day-old AMHRCs were individually exposed to UV-A, UV-B, and UV-C at a fixed radiation dose (43.2 kJ/m2) to assess their effects on the yield of total target isoflavonoids (sum amount of CAG, ON, ASG, CA, and FO). As shown in Figure 1, the elicitation treatment regardless of UV type increased isoflavonoid yields in the range of 362.15−443.04 μg/ g DW relative to the control (231.88 μg/g DW). The results demonstrated that UV elicitation was indeed beneficial for promoting isoflavonoid (usually acting as phytoalexins/ phytoanticipins) accumulation in AMHRCs as a consequence of countering unfavorable environmental stresses. Moreover, the isoflavonoid yield decreased in the order UV-B (443.04 ± 15.38 μg/g DW) > UV-C (417.66 ± 8.16 μg/g DW) > UV-A C


Article


Figure 3. Representative LC-MS/MS with SRM total ion chromatograms of extracts form control and UV-B-treated AMHRCs. Control, nontreated AMHRCs.

Figure 2. (A) Effects of different UV-B elicitation doses (0, 5.4, 10.8, 21.6, 43.2, 64.8, 75.6, 86.4, 97.2, 129.6, and 172.8 kJ/m2, i.e., 0, 0.5, 1, 2, 4, 6, 7, 8, 9, 12, and 16, h) on the yield of total target isoflavonoids in 34-day-old AMHRCs. Phenotypes of (B) control and (C) UV-Btreated AMHRCs. Control, nontreated AMHRCs. Mean ± SD values not sharing the same lower case letters are significantly different (P < 0.05).

isoflavonoids is proposed in this study (Figure 4). Overall, the pathway consists of 10 metabolic steps, beginning with phenylalanine ammonia-lyase (PAL) that catalyzes the deamination of phenylalanine into cinnamic acid. Consecutively, cinnamate-4-hydroxylase (C4H) catalyzes the hydroxylation of cinnamic acid into p-coumaric acid. Afterward, 4coumarate coenzyme A ligase (4CL) catalyzes the conversion of p-coumarate into its CoA ester. Subsequently, chalcone synthase (CHS) and chalcone reductase (CHR) co-catalyze the condensation of p-coumaryl CoA with three malonyl-CoA molecules toward the formation of an isoflavonoid skeleton, isoliquritigenin, which can be further converted into liquiritigenin with the catalysis of chalcone isomerase (CHI). After

Figure 4. Putative isoflavonoid biosynthetic pathway in A. membranaceus.

Table 2. Isoflavonoid Profiles in AMHRCs Treated by Different UV-B Radiation Doses contents of five target isoflavonoids in UV-B-treated AMHRCs (μg/g DW) dose (kJ/m2) 0 5.4 10.8 21.6 43.2 64.8 75.6 86.4 97.2 129.6 172.8

CAG 9.06 9.38 9.55 10.82 12.54 13.39 14.11 14.57 14.61 10.33 9.65

± ± ± ± ± ± ± ± ± ± ±

0.13 0.22 0.08 0.18 0.59 0.62 0.75 0.87 0.49 0.69 0.43

ON 4.12 4.07 4.16 4.86 5.20 5.14 5.55 5.83 5.64 4.90 4.25

± ± ± ± ± ± ± ± ± ± ±

ASG

0.19 0.09 0.11 0.15 0.37 0.12 0.39 0.46 0.28 0.35 0.12

64.95 70.99 74.03 85.25 97.91 105.77 112.75 119.59 109.51 88.63 84.45 D

± ± ± ± ± ± ± ± ± ± ±

CA 3.77 4.15 6.81 3.47 5.55 7.40 8.18 6.72 9.33 6.54 8.45

95.64 107.28 134.90 168.39 194.42 201.70 214.27 225.01 207.36 178.79 186.53

± ± ± ± ± ± ± ± ± ± ±

FO 2.80 6.96 12.31 5.76 15.08 6.49 6.05 8.28 14.56 8.73 17.62

59.16 68.16 79.57 103.57 132.97 157.28 166.39 168.54 154.73 125.61 139.24

± ± ± ± ± ± ± ± ± ± ±

1.65 3.74 9.05 4.82 8.69 3.46 6.25 5.36 8.28 6.33 15.70


Article


biosynthetic genes. Interestingly, not all genes displayed the highest expression levels at the optimal elicitation dose (86.4 kJ/m2) where isoflavonoid amount was the maximum. The transcriptional levels of PAL, C4H, CHI, and I3′H genes were observed to be gradually stimulated and reached their individual peak values at 86.4 kJ/m2, with expression levels of 9.90-, 12.83-, 4.92-, and 3.54-fold higher as against control, respectively. However, the maximum transcriptional levels of 4CL, CHS, CHR, and IFS genes were not observed at the optimal elicitation dose necessary for the highest isoflavonoid yield. The expression levels of CHS and IFS genes were highest at 43.2 kJ/m2, where they were 7.20- and 4.25-fold higher as compared to control, respectively, but decreased gradually afterward. Moreover, the transcriptional profiles of 4CL and CHR genes had no significant changes during the elicitation period and remained approximately 3- and 6-fold higher relative to control, respectively. Antioxidant Activities in Response to UV-B Elicitation. As shown in Figure 6, activities of antioxidant enzymes

that, liquiritigenin is catalyzed by isoflavone synthase (IFS) to form daidzein, which is then converted into FO under the catalytic action of isoflavone O-methyltransferase (IOMT). The subsequent hydroxylation at the 3′-position of the B-ring in FO leads to the formation of CA through the catalysis of isoflavone 3′-hydroxylase (I3′H). Eventually, FO and CA are transformed into their glycosides (ON and CAG) via the catalysis of uridine diphosphate-dependent glycosyltransferases (UGTs). Due to the large enzyme families with significant functional diversity, the last glycosylation steps remain to be identified. Biosynthetic Gene Expressions in Response to UV-B Elicitation. With the aim of clarifying the molecular mechanism underlying isoflavonoid enhancement in the presence of UV-B elicitation, the transcriptional profiles of isoflavonoid biosynthetic genes (PAL, C4H, 4CL, CHS, CHR, CHI, IFS, and I3′H; Figure 4) were determined by qRT-PCR. In this study, samples from UV-B-treated AMHRCs were taken for analysis at three different elicitation doses (43.2, 86.4, and 129.6, kJ/m2). Gene expression levels were normalized using the reference 18S gene as internal standard, and the transcripts of all related genes in control were set as 1. As presented in Figure 5, the expression levels of all investigated genes were significantly promoted following UV-B elicitation, which suggested that the enhanced isoflavonoid accumulation was a result of the improved expressions of these

Figure 6. Activities of antioxidant enzymes including (A) SOD, (B) CAT, (C) APX, and (D) GR in control and UV-B-treated AMHRCs. Control, nontreated AMHRCs.

including SOD, CAT, APX, and GR in UV-B-treated AMHRCs were significantly higher than those in control, indicating that antioxidant enzymes were indeed activated to protect AMHRCs from UV-B damage. With the purpose of studying the antioxidant response of AMHRCs to UV-B elicitation and investigating if a correlation exists with the levels of isoflavonoids in extracts, DPPH radical-scavenging assay and β-carotene/linoleic acid bleaching test were respectively applied to determine antiradical activities and antilipid peroxidation capacities of extracts from differently treated AMHRCs. Obviously, the observations with extracts from both control and UV-B-elicited AMHRCs exhibited dose-dependent relationships in antioxidant properties (Figure 7). As expected from the quantified levels of isoflavonoids, the UV-B-treated samples

Figure 5. (A) Total isoflavonoid yields and transcriptional levels of isoflavonoid biosynthetic genes in 34-day-old AMHRCs exposed to three different UV-B elicitation doses (43.2, 86.4, and 129.6, kJ/m2, i.e., 4, 8, and 12 h). (B) Hierarchical analyses of gene expressions in samples. Control, nontreated AMHRCs. Mean ± SD values not sharing the same lower case letters are significantly different (P < 0.05). E


Article


Generally, plant tissues exposed to an elicitor (or stressor) can cause reversible and elastic “eustress” (an activating, temporal, and constructive elicitation/stress through predisposing plant cells/organs to a state of low alert via stimulispecific signaling pathways that leads to the activation of defense secondary metabolisms), and once the exposure exceeds a tolerance-limit dose, an irreversible and plastic “distress” (a strong elicitation/stress event under severely unfavorable environment conditions that results in metabolic damage or, in extreme cases, the death of plant cells/organs) takes place.30,37 In this work, the appropriate UV-B exposure dose (86.4 kJ/m2) could realize the balance between “eustress” and “distress” for maximally inducing isoflavonoid accumulation in AMHRCs (Figure 2A). UV-B radiation has been extensively demonstrated to cause multiple cellular injuries in plants than can activate various signaling pathways involving nonspecific DNA damage, reactive oxygen species (ROS), wound/defense signaling, and specific photomorphogenic signaling.20,38 It is evident that the existence of these signaling pathways can contribute to stimulating the expression of genes involved in the biosynthesis of various secondary metabolites.19−24,26 Molecular studies were able to clarify the transcriptional expressions of genes involved in isoflavonoid biosynthetic pathway in response to UV-B elicitation. This could be helpful in discovering and exploring those genes which were the possible bottlenecks that controlled isoflavonoid biosynthesis and provide useful information for isoflavonoid production via engineering manipulation in the future. It is reported that the promoters of a series of genes involved in flavonoid biosynthetic pathway contain a specially recognized domain that can interact with MYB family transcriptional factors with light-responsive elements.23,24,39,40 As inferred, these transcriptional factors could be activated by UV-B radiation, thus leading to the transcriptional activation of all investigated isoflavonoid biosynthetic genes in this work (Figure 5). Additionally, a positive correlation was observed between the expression profiles of PAL, C4H, CHI, and I3′H genes and the accumulation patterns of isoflavonoids (Figure 5A), which indicated that the boosted isoflavonoid biosynthesis in AMHRCs might be activated by the simultaneous upregulation of these genes following UV-B elicitation. Moreover, PAL and C4H genes exhibited significantly higher expression levels than those of other genes (Figure 5B). These results suggested that PAL and C4H genes might be more sensitive and critical than other genes for isoflavonoid biosynthesis in UV-B-elicited AMHRCs. Factually, the promoter of PAL gene contains similar light-responsive elements with G-box sequence, which can significantly up-regulate the expression of PAL gene in response to UV induction.23,24 Generally, PAL and C4H genes have been proposed as two dominant control points of phenylpropanoid, flavonoid, and isoflavonoid biosynthesis in response to various biotic and abiotic stresses, inclusive of pathogen attack, UV radiation, and mechanical wounding.22,31,41−44 Moreover, PAL and C4H encoding enzymes are thought to be physically associated with each other in organized multienzyme complexes exhibiting coordinated expression.41 Similarly, PAL (a smart gene switch) and C4H genes play a key role in controlling the accumulation of CAG and CA in A. membranaceus plants during low-temperature treatment.32 Cumulatively, the results of this study confirmed that PAL and C4H genes were crucial regulatory points controlling

Figure 7. Antioxidant activities of extracts from control and UV-Btreated AMHRCs as assessed by (A) DPPH radical scavenging assay and (B) β-carotene/linoleic acid bleaching test. Control, nontreated AMHRCs. X axis, concentration of extracts from AMHRCs (mg/mL); Y axis, antioxidant activities (inhibition percentage/ratio, %) in DPPH radical scavenging assay and β-carotene/linoleic acid bleaching test.

showed much higher antioxidant efficacies in terms of antiradical (IC50 value of 0.85 mg/mL) and lipid peroxidation inhibition (IC50 value of 1.08 mg/mL), as compared to the corresponding values of control samples (1.38 and 1.71 mg/ mL).

■

DISCUSSION It is well documented that three classes of UV radiation (UV-A, UV-B, and UV-C) are important regulators of plant’s secondary metabolism, triggering the biosynthesis of various phytochemicals (e.g., phenolic compounds, alkaloids, terpenes, carotenoids, and glucosinolates) that can play an important role in a plant’s defense systems.19−21 Obviously, the three types of UV radiation exhibited distinct influences on isoflavonoid yield in AMHRCs (Figure 1). Due to the various wavelengths of UV-A, UV-B, and UV-C, the perceptions of diverse UV photons and the subsequent signal transductions in plant cells are different.33,34 The consequence of a given radiation dose of UV-A, UV-B, and UV-C can result in different damaging effects on DNA, proteins, lipids, and membranes and/or physiological processes of plant cells, which can induce diverse influences on a plant’s secondary metabolism,23,24,35,36 thus promoting the synthesis of distinct levels of isofavonoids to protect AMHRCs from UV damage. In this work, UV-B offering the highest isoflavonoid yield was adopted as the appropriate elicitor. F


Article


points (PAL and C4H genes) in the isoflavonoid biosynthetic pathway of A. membranaceus.

isoflavonoid biosynthesis in AMHRCs responsive to UV-B elicitation. Factually, plants exposed to UV-B stress can greatly enhance the generation of ROS, resulting in an oxidative disturbance (i.e., imbalances between ROS production and antioxidant scavenging capacity).20,30 Generally, plants utilize antioxidant enzymes as representing the first line of defense against ROS overproduction, preventing oxidative damage of cell membrane systems, nucleic acids, lipids, and proteins, and maintaining the stability of their functions.45,46 In the present study, the activities of antioxidant enzymes (SOD, CAT, APX, and GR) in AMHRCs were significantly stimulated by UV-B radiation (Figure 6). However, the action of antioxidant enzymes needs to be complemented by that of nonenzymatic ROS scavenging systems in plants suffering from stress conditions.45 Flavonoids have been proposed as constituting a secondary antioxidant system that is activated as a consequence of the depletion of antioxidant enzyme activity.45−47 Moreover, there is a growing body of evidence that flavonoids can screen harmful UV-B radiation and especially scavenge ROS formed under stressful conditions, thus protecting plant cells from oxidative damages.48,49 In this study, the significantly induced isoflavonoids (2.29fold higher than control) might actively balance the cell redox status of AMHRCs under UV-B-mediated oxidative stress through their antioxidant and free radical scavenging abilities. In addition, the intake of isoflavonoids is vitally important for human health (e.g., prevention of cancer, inflammation, and cardiovascular and age-related diseases), which is believed to be related to their antioxidant activities.2,4,50 Currently, natural products containing isoflavonoids are of great interest in the food, cosmetic, and pharmaceutical fields for their possible use as antioxidant additives to replace toxic synthetic ones.51,52 From this point of view, the isoflavonoid enhancement driven by UV-B possesses benefits for both ends of the biobased food chain, that is, for plants themselves as well as for human health. Previously, several in vitro antioxidant assays have shown that CAG, ASG, CA, and FO were the primary antioxidant contributors acting as hydrogen/electron donors to neutralize peroxyl free radicals.4−6,53 The better antioxidant activities of the UV-B-treated samples as against control (Figure 7) might be partly ascribed to the higher levels of these antioxidant compounds. However, antioxidant capacities of plant extracts are not dependent on some single molecules, due to the synergistic and redox interactions among multiple components that are present. Factually, UV-B radiation can induce the accumulation of many cellular antioxidants, such as ascorbic acid, glutathione, proline, tocopherol, flavonols, phenolics, and carotenoids.19−21,45 Herein, it was inferred that the possible synergistic effects of these antioxidant constituents contributed to the tremendous increase in antioxidant activity of UV-Btreated samples. Anyway, the results of this study confirmed that UV-B-elicited AMHRCs could offer health-promoting extracts with higher antioxidant activity as natural additives in functional foods and nutraceuticals. Overall, the present study established an effective, convenient, and feasible UV-B elicitation approach to enhance isoflavonoid biosynthesis in AMHRCs. We found that UV-B radiation as elicitor possessed the potential to induce the transcriptional activation of biosynthetic genes that ultimately boosted isoflavonoid accumulation in AMHRCs. This investigation also opened a gate to clarify the crucial regulatory

■

AUTHOR INFORMATION

Corresponding Authors

*(Y.-J.F.) Phone/fax: +86-451-82190535. E-mail: yujie_ [email protected]. *(W.M.) Phone/fax: +86-451-82193430. E-mail: mawei@ hljucm.net Author Contributions ∥

J.J. and Q.-Y.G. contributed equally to this work.

Funding

We gratefully acknowledge financial support from the Special Fund of Forestry Industrial Research for Public Welfare of China (201004079), the Application Technology Research and Development Program of Harbin (2013AA3BS014), the Fundamental Research Funds for the Central Universities (2572014AA06, and 2572015AA14), the Special Fund of the National Natural Science Foundation of China (31270618), the Key Program of the National Natural Science Foundation of China (81274010), and the Heilongjiang Province Outstanding Youth Fund (JC201101). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED AMHRCs, A. membranaceus hairy root cultures; AMHRL II, A. membranaceus hairy root line II; ASG, astraisoflavan-7-O-β-Dglucoside; BHT, butylated hydroxytoluene; CA, calycosin; CAG, calycosin-7-O-β-D-glucoside; C4H, cinnamate-4-hydroxylase; CHI, chalcone isomerase; CHR, chalcone reductase; CHS, chalcone synthase; 4CL, 4-coumarate coenzyme A ligase; DPPH, 2,2-diphenyl-1-picrylhydrazyl-hydrate; DW, dry weight; FO, formononetin; HRCs, hairy root cultures; IFS, isoflavone synthase; I3′H, isoflavone 3′-hydroxylase; IOMT, isoflavone Omethyltransferase; ON, ononin; PAL, phenylalanine ammonialyase; qRT-PCR, quantitative real-time PCR; ROS, reactive oxygen species; UGTs, uridine diphosphate-dependent glycosyltransferases; UV, ultraviolet; VC, ascorbic acid

■

REFERENCES

(1) Napolitano, A.; Akay, S.; Mari, A.; Bedir, E.; Pizza, C.; Piacente, S. An analytical approach based on ESI-MS, LC-MS and PCA for the quail-quantitative analysis of cycloartane derivatives in Astragalus spp. J. Pharm. Biomed. Anal. 2013, 85, 46−54. (2) Zhang, L. J.; Liu, H. K.; Hsiao, P. C.; Kuo, L. M. Y.; Lee, I. J.; Wu, T. S.; Chiou, W. F.; Kuo, Y. H. New isoflavonoid glycosides and related constituents from astragali radix (Astragalus membranaceus) and their inhibitory activity on nitric oxide production. J. Agric. Food Chem. 2011, 59, 1131−1137. (3) Zheng, K. Y. Z.; Choi, R. C. Y.; Cheung, A. W. H.; Guo, A. J. Y.; Bi, C. W. C.; Zhu, K. Y.; Fu, Q.; Du, Y.; Zhang, W. L.; Zhan, J. Y. X.; Duan, R.; Lau, D. T. W.; Dong, T. T. X.; Tsim, K. W. K. Flavonoids from Radix Astragali induce the expression of erythropoietin in cultured cells: a signaling mediated via the accumulation of hypoxiainducible factor-1α. J. Agric. Food Chem. 2011, 59, 1697−1704. (4) Jiao, J.; Gai, Q. Y.; Fu, Y. J.; Ma, W.; Peng, X.; Tan, S. N.; Efferth, T. Efficient production of isoflavonoids by Astragalus membranaceus hairy root cultures and evaluation of antioxidant activities of extracts. J. Agric. Food Chem. 2014, 62, 12649−12658. (5) Chen, C. Y.; Zu, Y. G.; Fu, Y. J.; Luo, M.; Zhao, C. J.; Wang, W.; Zhao, B. S.; Li, J.; Efferth, T. Preparation and antioxidant activity of Radix Astragali residues extracts rich in calycosin and formononetin. Biochem. Eng. J. 2011, 56, 84−93.

G


Article


by UV irradiation depending on developmental stage. Plant Sci. 2013, 208, 64−74. (25) Nguyen, C. T.; Kim, J.; Yoo, K. S.; Lim, S.; Lee, E. J. Effect of prestorage UV-A, -B, and-C radiation on fruit quality and qnthocyanin of ‘Duke’ blueberries during cold storage. J. Agric. Food Chem. 2014, 62, 12144−12151. (26) Pandey, N.; Pandey-Rai, S. Short term UV-B radiation-mediated transcriptional responses and altered secondary metabolism of in vitro propagated plantlets of Artemisia annua L. Plant Cell, Tissue Organ Cult. 2014, 116, 371−385. (27) Kim, Y. B.; Thwe, A. A.; Li, X.; Tuan, P. A.; Zhao, S.; Park, C. G.; Lee, L. W.; Park, S. U. Accumulation of flavonoids and related gene expressions in different organs of Astragalus membranaceus Bge. Appl. Biochem. Biotechnol. 2014, 173, 2076−2085. (28) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402−408. (29) Arbona, V.; Flors, V.; Jacas, J.; García-Agustín, P.; GómezCadenas, A. Enzymatic and non-enzymatic antioxidant responses of Carrizo citrange, a salt-sensitive citrus rootstock, to different levels of salinity. Plant Cell Physiol. 2003, 44, 388−394. (30) Hideg, É.; Jansen, M. A.; Strid, Å. UV-B exposure, ROS, and stress: inseparable companions or loosely linked associates? Trends Plant Sci. 2013, 18, 107−115. (31) Xu, R. Y.; Nan, P.; Yang, Y.; Pan, H.; Zhou, T.; Chen, J. Ultraviolet irradiation induces accumulation of isoflavonoids and transcription of genes of enzymes involved in the calycosin-7-O-β-Dglucoside pathway in Astragalus membranaceus Bge. var. mongholicus (Bge.) Hsiao. Physiol. Plant. 2011, 142, 265−273. (32) Pan, H.; Fang, C.; Zhou, T.; Wang, Q.; Chen, J. Accumulation of calycosin and its 7-O-β-D-glucoside and related gene expression in seedlings of Astragalus membranaceus Bge. var. mongholicus (Bge.) Hsiao induced by low temperature stress. Plant Cell Rep. 2007, 26, 1111−1120. (33) Kovacs, E.; Keresztes, A. Effect of gamma and UV-B/C radiation on plant cells. Micron 2002, 33, 199−210. (34) Hollósy, F. Effects of ultraviolet radiation on plant cells. Micron 2002, 33, 179−197. (35) Barta, C.; Kálai, T.; Hideg, K.; Vass, I.; Hideg, É. Differences in the ROS-generating efficacy of various ultraviolet wavelengths in detached spinach leaves. Funct. Plant Biol. 2004, 31, 23−28. (36) Mahdavian, K.; Ghorbanli, M.; Kalantari, K. M. The effects of ultraviolet radiation on the contents of chlorophyll, flavonoid, anthocyanin and proline in Capsicum annuum L. Turk. J. Bot. 2008, 32, 25−33. (37) Kranner, I.; Minibayeva, F. V.; Beckett, R. P.; Seal, C. E. What is stress? Concepts, definitions and applications in seed science. New Phytol. 2010, 188, 655−673. (38) Jenkins, G. I. Signal transduction in responses to UV-B radiation. Annu. Rev. Plant Biol. 2009, 60, 407−431. (39) Takos, A. M.; Jaffé, F. W.; Jacob, S. R.; Bogs, J.; Robinson, S. P.; Walker, A. R. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol. 2006, 142, 1216−1232. (40) Cominelli, E.; Gusmaroli, G.; Allegra, D.; Galbiati, M.; Wade, H. K.; Jenkins, G. I.; Tonelli, C. Expression analysis of anthocyanin regulatory genes in response to different light qualities in Arabidopsis thaliana. J. Plant Physiol. 2008, 165, 886−894. (41) Singh, K.; Kumar, S.; Rani, A.; Gulati, A.; Ahuja, P. S. Phenylalanine ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea. Funct. Integr. Genomics 2009, 9, 125−134. (42) Xu, H.; Park, N. I.; Li, X.; Kim, Y. K.; Lee, S. Y.; Park, S. U. Molecular cloning and characterization of phenylalanine ammonialyase, cinnamate 4-hydroxylase and genes involved in flavone biosynthesis in Scutellaria baicalensis. Bioresour. Technol. 2010, 101, 9715−9722. (43) Tuan, P. A.; Park, N. I.; Li, X.; Xu, H.; Kim, H. H.; Park, S. U. Molecular cloning and characterization of phenylalanine ammonia-

(6) Zhao, B. S.; Fu, Y. J.; Wang, W.; Zu, Y. G.; Gu, C. B.; Luo, M.; Efferth, T. Enhanced extraction of isoflavonoids from Radix Astragali by incubation pretreatment combined with negative pressure cavitation and its antioxidant activity. Innovative Food Sci. Emerging Technol. 2011, 12, 577−585. (7) Ma, X. Q.; Shi, Q.; Duan, J. A.; Dong, T. T.; Tsim, K. W. Chemical analysis of Radix Astragali (Huangqi) in China: a comparison with its adulterants and seasonal variations. J. Agric. Food Chem. 2002, 50, 4861−4866. (8) Fu, J.; Wang, Z.; Huang, L.; Zheng, S.; Wang, D.; Chen, S.; Zhang, H.; Yang, S. Review of the botanical characteristics, phytochemistry, and pharmacology of Astragalus membranaceus (Huangqi). Phytother. Res. 2014, 28, 1275−1283. (9) Wang, J. W.; Wu, J. Y. Effective elicitors and process strategies for enhancement of secondary metabolite production in hairy root cultures. In Biotechnology of Hairy Root Systems; Doran, P. M., Ed.; Springer-Verlag: Berlin, Germany, 2013; pp 55−89. (10) Sharma, P.; Padh, H.; Shrivastava, N. Hairy root cultures: a suitable biological system for studying secondary metabolic pathways in plants. Eng. Life Sci. 2013, 13, 62−75. (11) Ludwig-Müller, J.; Jahn, L.; Lippert, A.; Püschel, J.; Walter, A. Improvement of hairy root cultures and plants by changing biosynthetic pathways leading to pharmaceutical metabolites: strategies and applications. Biotechnol. Adv. 2014, 32, 1168−1179. (12) Mehrotra, S.; Srivastava, V.; Rahman, L. U.; Kukreja, A. K. Hairy root biotechnologyindicative timeline to understand missing links and future outlook. Protoplasma 2015, 252, 1189. (13) Tian, L. Using hairy roots for production of valuable plant secondary metabolites. Adv. Biochem. Eng./Biotechnol. 2015, 149, 275. (14) Namdeo, A. G. Plant cell elicitation for production of secondary metabolites: a review. Pharmacogn. Rev. 2007, 1, 69−79. (15) Gorelick, J.; Bernstein, N. Elicitation: an underutilized tool for the development of medicinal plants as a source for therapeutic secondary metabolites. Adv. Agron. 2014, 124, 201−230. (16) Murthy, H. N.; Lee, E. J.; Paek, K. Y. Production of secondary metabolites from cell and organ cultures: strategies and approaches for biomass improvement and metabolite accumulation. Plant Cell, Tissue Organ Cult. 2014, 118, 1−16. (17) Yi, J.; Derynck, M. R.; Li, X.; Telmer, P.; Marsolais, F.; Dhaubhadel, S. A single-repeat MYB transcription factor, GmMYB176, regulates CHS8 gene expression and affects isoflavonoid biosynthesis in soybean. Plant J. 2010, 62, 1019−1034. (18) Dixon, R. A. Natural products and plant disease resistance. Nature 2001, 411, 843−847. (19) Schreiner, M.; Mewis, I.; Huyskens-Keil, S.; Jansen, M. A. K.; Zrenner, R.; Winkler, J. B.; O’Brien, N.; Krumbein, A. UV-B-induced secondary plant metabolites-potential benefits for plant and human health. Crit. Rev. Plant Sci. 2012, 31, 229−240. (20) Matsuura, H. N.; de Costa, F.; Yendo, A. C. A.; Fett-Neto, A. G. Photoelicitation of bioactive secondary metabolites by ultraviolet radiation: Mechanisms, strategies, and applications. In Biotechnology for Medicinal Plants; Chandra, S., Lata, H., Varma, A., Eds.; SpringerVerlag: Berlin, Germany, 2013; pp 171−190. (21) Kumari, R.; Prasad, M. N. V. Medicinal plant active compounds produced by UV-B exposure. In Sustainable Agriculture Reviews; Lichtfouse, E., Ed.; Springer: Dordrecht, The Netherlands, 2013; pp 225−254. (22) Kanazawa, K.; Hashimoto, T.; Yoshida, S.; Sungwon, P.; Fukuda, S. Short photoirradiation induces flavonoid synthesis and increases its production in postharvest vegetables. J. Agric. Food Chem. 2012, 60, 4359−4368. (23) Zhang, Z. Z.; Li, X. X.; Chu, Y. N.; Zhang, M. X.; Wen, Y. Q.; Duan, C. Q.; Pan, Q. H. Three types of ultraviolet irradiation differentially promote expression of shikimate pathway genes and production of anthocyanins in grape berries. Plant Physiol. Biochem. 2012, 57, 74−83. (24) Zhang, Z. Z.; Che, X. N.; Pan, Q. H.; Li, X. X.; Duan, C. Q. Transcriptional activation of flavan-3-ols biosynthesis in grape berries H


Article

Journal of Agricultural and Food Chemistry lyase and cinnamate 4-hydroxylase in the phenylpropanoid biosynthesis pathway in garlic (Allium sativum). J. Agric. Food Chem. 2010, 58, 10911−10917. (44) Park, J. H.; Park, N. I.; Xu, H.; Park, S. U. Cloning and characterization of phenylalanine ammonia-lyase and cinnamate 4hydroxylase and pyranocoumarin biosynthesis in Angelica gigas. J. Nat. Prod. 2010, 73, 1394−1397. (45) Gill, S. S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909−930. (46) Fini, A.; Brunetti, C.; Di Ferdinando, M.; Ferrini, F.; Tattini, M. Stress-induced flavonoid biosynthesis and the antioxidant machinery of plants. Plant Signaling Behav. 2011, 6, 709−711. (47) Agati, G.; Azzarello, E.; Pollastri, S.; Tattini, M. Flavonoids as antioxidants in plants: location and functional significance. Plant Sci. 2012, 196, 67−76. (48) Agati, G.; Tattini, M. Multiple functional roles of flavonoids in photoprotection. New Phytol. 2010, 186, 786−793. (49) Agati, G.; Biricolti, S.; Guidi, L.; Ferrini, F.; Fini, A.; Tattini, M. The biosynthesis of flavonoids is enhanced similarly by UV radiation and root zone salinity in L. vulgare leaves. J. Plant Physiol. 2011, 168, 204−212. (50) Rüfer, C. E.; Kulling, S. E. Antioxidant activity of isoflavones and their major metabolites using different in vitro assays. J. Agric. Food Chem. 2006, 54, 2926−2931. (51) Wuttke, W.; Jarry, H.; Seidlová-Wuttke, D. Isoflavones  safe food additives or dangerous drugs? Ageing Res. Rev. 2007, 6, 150−188. (52) Carocho, M.; Ferreira, I. C. A review on antioxidants, prooxidants and related controversy: natural and synthetic compounds, screening and analysis methodologies and future perspectives. Food Chem. Toxicol. 2013, 51, 15−25. (53) Huang, X.; Liu, Y.; Song, F.; Liu, Z.; Liu, S. Studies on principal components and antioxidant activity of different Radix Astragali samples using high-performance liquid chromatography/electrospray ionization multiple-stage tandem mass spectrometry. Talanta 2009, 78, 1090−1101.

I


Ultraviolet Radiation-Elicited Enhancement of Isoflavonoid

Recommend Documents