Anal. Chem. 2010, 82, 6303–6307
Universal Method Facilitating the Amplification of Extremely GC-Rich DNA Fragments from Genomic DNA Maochen Wei,†,‡ Jing Deng,†,‡ Kun Feng,†,‡ Boyang Yu,† and Yijun Chen*,†,‡,§ Laboratory of Chemical Biology and Jiangsu Provincial Key Laboratory of Molecular Targeted Antitumor Drug Research, China Pharmaceutical University, Nanjing, People’s Republic of China, and Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, New Jersey Polymerase chain reaction (PCR) is a basic technique with wide applications in molecular biology. Despite the development of different methods with various modifications, the amplification of GC-rich DNA fragments is frequently troublesome due to the formation of complex secondary structure and poor denaturation. Given the fact that GC-rich genes are closely related to transcriptional regulation, transcriptional silencing, and disease progression, we developed a PCR method combining a stepwise procedure and a mixture of additives in the present work. Our study demonstrated that the PCR method could successfully amplify targeted DNA fragments up to 1.2 Kb with GC content as high as 83.5% from different species. Compared to all currently available methods, our work showed satisfactory, adaptable, fast and efficient (SAFE) results on the amplification of GC-rich targets, which provides a versatile and valuable tool for the diagnosis of genetic disorders and for the study of functions and regulations of various genes. Most tumor-suppressor genes, housekeeping genes, and approximately 40% of tissue-specific genes in their promoter regions contain high GC content,1 and 28% of genes in the human genome are located in GC-rich regions.2 The GC-rich genes in these regions are closely related to transcriptional regulation, transcriptional silencing, and disease progression. Therefore, study of GCrich regions is of great interest to biological and clinical investigations. To study the function and regulation of various genes of interest, amplification of related genes typically is an essential and necessary step. Polymerase chain reaction (PCR) is a powerful technique to amplify DNA fragments but needs specific adjustments to amplify GC-rich DNA fragments (usually greater than 60%) due to complex secondary structures and poor denaturation * To whom correspondence should be addressed. Address: Laboratory of Chemical Biology, China Pharmaceutical University, 24 Tongjia Street, Nanjing, Jiangsu Province, 210009, People’s Republic of China. Tel: 86-25-83271045. Fax: 86-25-83271249. E-mail:
[email protected]. † Laboratory of Chemical Biology, China Pharmaceutical University. ‡ Jiangsu Provincial Key Laboratory of Molecular Targeted Antitumor Drug Research, China Pharmaceutical University. § Rutgers University. (1) Hube, F.; Reverdiau, P.; Iochmann, S.; Gruel, Y. Mol. Biotechnol. 2005, 31, 81–84. (2) Saccone, S.; De Sario, A.; Della Valle, G.; Bernardi, G. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 4913–4917. 10.1021/ac100797t 2010 American Chemical Society Published on Web 06/21/2010
resulting in the formation of short and nonspecific DNA fragments instead of the desired products.3-5 To amplify GC-rich templates, several approaches have been attempted with different additives and PCR procedures. For example, addition of chemical reagents, such as dimethylsulfoxide (DMSO),6 glycerol,7 sulfoxide,8,9 betaine,10 and 7-deaza-dGTP11 and combinations of betaine and DMSO12-14 or DMSO, betaine, and 7-deaza-dGTP,15 have shown promises to improve the amplification of GC-rich templates to some extent. However, the performance of these additives alone has been unsatisfactory without further modification of the PCR procedures. On the other hand, “Slowdown PCR”11 and “Two-Step PCR”16 exhibit superiority in amplifying GC-rich sequences. Unfortunately, when dealing with extremely GC-rich (greater than 80%) fragments, none of them was able to provide adequate results. To the best of our knowledge, the only successful example for amplifying target DNA, which is located in the 5′ noncoding region of the Gas subunit of heterotrimeric G protein (GNAS1) (GenBank Accession No. M21139), with GC content of 83%, was a combination of “Slowdown PCR” and 7-deaza-dGTP. However, this method did not work on the amplification of the same gene longer than 250 bp.11 Thus, current PCR protocols have considerably limited the (3) McDowell, D. G.; Burns, N. A.; Parkes, H. C. Nucleic Acids Res. 1998, 26, 3340–3347. (4) Tindall, E. A.; Petersen, D. C.; Woodbridge, P.; Schipany, K.; Hayes, V. M. Hum. Mutat. 2009, 30, 876–883. (5) Mamedov, T. G.; Pienaar, E.; Whitney, S. E.; TerMaat, J. R.; Carvill, G.; Goliath, R.; Subramanian, A.; Viljoen, H. J. Comput. Biol. Chem. 2008, 32, 452–457. (6) Sun, Y.; Hegamyer, G.; Colburn, N. H. Biotechniques 1993, 15, 372–374. (7) Choi, J. S.; Kim, J. S.; Joe, C. O.; Kim, S.; Ha, K. S.; Park, Y. M. Exp. Mol. Med. 1999, 31, 20–24. (8) Chakrabarti, R.; Schutt, C. E. Biotechniques 2002, 32, 866, 868, 870-872, 874. (9) Chakrabarti, R.; Schutt, C. E. Gene 2001, 274, 293–298. (10) Henke, W.; Herdel, K.; Jung, K.; Schnorr, D.; Loening, S. A. Nucleic Acids Res. 1997, 25, 3957–3958. (11) Frey, U. H.; Bachmann, H. S.; Peters, J.; Siffert, W. Nat. Protoc. 2008, 3, 1312–1317. (12) Ralser, M.; Querfurth, R.; Warnatz, H. J.; Lehrach, H.; Yaspo, M. L.; Krobitsch, S. Biochem. Biophys. Res. Commun. 2006, 347, 747–751. (13) Sahdev, S.; Saini, S.; Tiwari, P.; Saxena, S.; Singh Saini, K. Mol. Cell Probes 2007, 21, 303–307. (14) Kang, J.; Lee, M. S.; Gorenstein, D. G. J. Biochem. Biophys. Methods 2005, 64, 147–151. (15) Musso, M.; Bocciardi, R.; Parodi, S.; Ravazzolo, R.; Ceccherini, I. J. Mol. Diagn. 2006, 8, 544–550. (16) Schuchard, M.; Sarkar, G.; Ruesink, T.; Spelsberg, T. C. Biotechniques 1993, 14, 390–394.
Analytical Chemistry, Vol. 82, No. 14, July 15, 2010
6303
Figure 1. Procedures of “SAFE PCR”. “SAFE PCR” was performed with the following procedures. Denaturation: 98 °C for 5 min; Hot Start; 6 cycles: 30 s at 98 °C, 30 s annealing with a stepwise reduction of annealing temperature from 68 to 62 °C decreased by 1 °C every cycle, 40 s at 72 °C; pause to add Taq polymerase; another 6 cycles: 30 s at 98 °C, 30 s annealing with a progressively lowered temperature from 62 to 56 °C decreased by 1 °C every cycle, 72 °C at 40 s (ramp rate: 2.5 °C s-1; cooling rate: 1.5 °C s-1). After addition of Taq polymerase once again, 25 additional cycles with an annealing temperature of 56 °C were conducted. A final extension: 72 °C for 5 min.
analyses of genotype and phenotype in the extremely GC-rich regions, and there is a high demand for a new protocol to conquer such a problem. EXPERIMENTAL SECTION Design of Primers. Primer design was performed by commercial software (Primer Premier 5.0, PREMIER Biosoft International, USA). All primers used in this study were synthesized by Invitrogen Bio. Inc. (Shanghai, China). Preparation of Templates. Human genomic DNA was prepared from healthy human blood using a QIAamp DNA Blood Mini Kit (Qiagen, Germany). Hamster genomic DNA was prepared from Cricetulus barabensis ovary cells using a Mammalian Cell Extraction kit (Biovision, USA). Oryza sativa Japonica genomic DNA was extracted according to the method described previously.17 PCR Reactions. PCR reactions were set up in a total volume of 25 µL containing 2.5 µL of 10× DNA polymerase buffer, 2.0 mM MgCl2, 0.2 mM of each dNTP, 2.0 µM of each primer, and 100 ng of genomic DNA; 1 U Taq polymerase such as LA Taq polymerase and Exact polymerase (TaKaRa Bio Inc., Japan) or thermo-stable polymerases including DeepVent polymerase, Pfu polymerase, and Vent (exo-) polymerase (New England Biolabs, Inc., USA) were added. 7-Deaza-dGTP (150 µM, New England Biolabs, Inc., USA) and 50 µM dGTP were used to replace 0.2 M dGTP in “Slowdown PCR”. GNAS1 was chosen to examine the effects of different additives on PCR amplifications. Additives were added alone at the following concentrations: 0.5-2.0 M betaine (Sigma, USA), 1- 10% DMSO (Sigma, USA), and 5-20% glycerol (Sigma, USA). Different mixtures of additives including A1 (5% DMSO, 5% glycerol and 1.4 M betaine), A2 (150 µM 7-deaza-dGTP and 50 µM dGTP), and A3 (5% DMSO, 50 µM 7-deaza-dGTP and 1.3 M betaine) were combined with procedures of “SAFE (satisfactory, adaptable, fast, efficient) PCR”, “Slowdown PCR”, and “Two-Step PCR”, respectively. Cycling Procedures. All PCR amplifications were performed with an Eppendorf Personal Master Cycler except for “Slowdown PCR’, which was conducted on a Bio-Rad Mycycler Thermal Cycler. (17) Sambrook, J.; Russell, D. W. Molecular cloning-a laboratory manual, 3rd ed.; Cold Spring Harbor: New York, 2001.
6304
Analytical Chemistry, Vol. 82, No. 14, July 15, 2010
“Conventional PCR” was performed with an initial step of 95 °C for 5 min, then 40 cycles with 30 s denaturation at 95 °C, 30 s annealing with fixed temperatures at optimal annealing temperature Ta calculated by Primer Premier 5.0 software, followed by primer extension of 40 s at 72 °C, and concluded with a final extension at 72 °C for 5 min. “Two-Step PCR” was conducted through a denaturation step of 3 min at 94 °C and 35 cycles consisting of 10 s at 94 °C and 3 min at 68 °C, completed with a final extension at 72 °C for 5 min. “Slowdown PCR” was carried out with the following cycling conditions: the templates were denaturized at 95 °C for 5 min, and then, 48 cycles composed of 30 s at 95 °C, 30 s annealing with a stepwise reduction of annealing temperature from 70 to 53 °C decreased by 1 °C every third cycle, 40 s at 72 °C (ramp rate: 2.5 °C s-1; cooling rate: 1.5 °C s-1), were run. After 48 cycles, 15 additional cycles with a denaturation step at 95 °C for 30 s, annealing step at 58 °C for 30 s, and elongation step at 72 °C for 40 s were conducted and completed with a final extension at 72 °C for 5 min. “SAFE PCR” was performed as described in Figure 1. All PCR products were analyzed with 1.5% agarose-gel electrophoresis and stained with GoldviewTM (SBS Bio Inc., Beijing, China). DNA Sequencing and Analysis. A single strip of PCR products was purified by an AxyPrepTM DNA gel extraction kit (Axygene Biotech Ltd., USA) and ligated to a pMD18T or pMD18T simple vector using a T-vector kit (TaKaRa Bio Inc., Japan). The constructs were transformed to E. coli Top10 cells. Endonuclease digestion was performed to select the positive clones. The positive colonies were sequenced by Invitrogen (Shanghai, China) with ABI Genetic Analyzer 3730 (Applied Biosystems). DNA alignments were conducted with BLASTnr from NCBI online service (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the base composition plot of GC content was conducted by Omiga 2.0 software (Oxford Molecular Ltd., USA). RESULTS AND DISCUSSION Optimizations of Procedure and Additives. GNAS1 is an important genetic marker for various diseases, such as pseudohypoparathyroidism, hypertension, bladder cancer, clear cell renal
Figure 2. Amplification of GNAS1 with different combinations of procedures and additives (a) GC content of the sequence. The amount and frequency of each base and the percentage of GC were calculated by Omiga 2.0 software (Oxford Molecular Ltd., USA). (b) Agarose gel electrophoresis. Ten microliters of PCR products obtained under different conditions were loaded. Lane M, molecular weight marker (DL2000, TaKaRa Bio Inc., Japan). A1, mixture of 5% DMSO, 5% glycerol, and 1.4 M betaine; A2, mixture of 150 µM 7-deaza-dGTP and 50 µM dGTP; A3, mixture of 5% DMSO, 50 µM 7-deaza-dGTP, and 1.3 M betaine.
cell carcinoma, and pituitary tumor.18,19 Because the mutations of GNAS1 cause genetic diseases and cancers,18 the analysis of single nucleotide polymorphisms of this gene has been a valuable tool for pharmacogenetics studies. However, mutational scanning of GNAS1 was only limited to short sequences.20 Considering that an 826 bp fragment of GNAS1 contains a GC content of 83% with internal partial sequences greater than 90% (Figure 2a), it was chosen as a subject to examine currently available PCR procedures in conjunction with different additives in the present study. Related primers used in this work are listed in Table 1. As shown in Figure 2b lanes 5, 6, and 8, all PCR procedures with different additives failed to amplify the GNAS1 gene except for the combination of “Two-Step PCR” and a mixture of DMSO, betaine, and 7-deaza-dGTP (Figure 2b lane 9); the causes for failures are unclear at present. However, this method resulted in band compression and random mutagenesis after sequencing multiple times (see Figure S1 in Supporting Information), which is possibly due to the sequencing errors in the presence of 7-deazadGTP and incorporation of 7-deaza-dGTP.21 To avoid such low (18) Krechowec, S.; Plagge, A. Physiology (Bethesda) 2008, 23, 221–229. (19) Weinstein, L. S.; Chen, M.; Liu, J. Ann. N.Y. Acad. Sci. 2002, 968, 173– 197. (20) Jia, H.; Hingorani, A. D.; Sharma, P.; Hopper, R.; Dickerson, C.; Trutwein, D.; Lloyd, D. D.; Brown, M. J. Hypertension 1999, 34, 8–14. (21) Motz, M.; Paabo, S.; Kilger, C. Biotechniques 2000, 29, 268–270.
fidelity, investigation of different additives was then undertaken. Since glycerol is known to lower melting temperature of DNA and its special polyhydroxy structure can reduce the inhibitory effect of DMSO on the polymerase,22 we examined the possibility of substituting 7-deaza-dGTP with glycerol. After evaluating different ratios of the additives, a combination consisting of 5% DMSO, 5% glycerol, and 1.4 M betaine was identified to be optimal. We found that “Two-Step PCR” plus this mixture of additives could amplify the target fragment from human genomic DNA, but the yield was low and increase of cycling number did not give more products (Figure 2b lane 7). To effectively improve PCR product yield without altering DNA replication fidelity, it is necessary to optimize the PCR procedure in the presence of this mixture of additives. Since “Slowdown PCR” and 7-deaza-dGTP was able to amplify a 241 bp fragment of GNAS1,11 we tested the combination of this procedure and our additives to amplify the 826 bp fragment of this gene. Surprisingly, the desired PCR product could not be obtained (Figure 2b lane 4), suggesting the incompatibility of this PCR procedure. Subsequently, a denaturation temperature of 98 °C and hot-start in the initial step were adopted to avoid incomplete denaturation of the templates and to enhance the specificity. To (22) Ruan, K.; Xu, C.; Li, T.; Li, J.; Lange, R.; Balny, C. Eur. J. Biochem. 2003, 270, 1654–1661.
Analytical Chemistry, Vol. 82, No. 14, July 15, 2010
6305
Table 1. Genes and Oligonucleotides Used in This Study origin
genea
primer sequence (from 5′ to 3′)
Tmb (°C)
human
GNAS1
human
ARX
human
Contig
hamster
GSPT2
plant
Dof
plant
CGT
forward CCCCTTCCGCCCACCCC reverse GCCTTCTCCTCGTTGCGC forward CCAAGGCGTCGAAGTCTGGTGGTGC reverse TCATCTTCTTCGTCCTCCAGCAGC forward CCGCCTCCTGGTGACTCACGCT reverse GCCGCCTCCTGCCCAGCCCC forward ATGGATCTCGGCAGTAGCAG reverse CTGAAAGTTCCATGGTAACAGCTGA forward CACGGGGCAGCAGGAGAAGAAGCAG reverse GGCGATGTCGGCGAAGTTGTCCCAC forward GCATGGGCCACCTCGTCCCCTTCG reverse CCTTCATCCGCAACGCCTCGTCCGC
67.5 61.4 74.5 66.9 70.3 76.4 57.6 61 72.9 74.4 77.7 77
product length (bp)
GCc (%)
Tad (°C)
826
83.53
65.8
658
78.88
66.3
308
70.78
64.9
415
60.48
58.8
472
71.4
65.3
1242
71.42
67.6
a GNSA1, gene encoding the Gas subunit of heterotrimeric G protein; ARX, aristaless-related homeobox; GSPT2, translation termination factor 3; Dof, protein of DNA binding with one finger; CGT, C-glucosyltransferase. b The melting temperatures (Tm) of the primers were calculated by “primer 5.0”. The predicted optimal annealing temperatures (Ta) for any pair of primers were calculated by Primer Primer 5.0 (PREMIER Biosoft International, USA). c Overall, GC-content of the expected amplicons were calculated by Omiga 2.0 software. d Optimal annealing temperature.
compromise the higher temperature, thermo-stable polymerases, including Deep Vent, Vent (exo-), Pfu, were employed in the presence or absence of additives in the PCR procedures. Contrary to the expectation, these enzymes did not yield any products, which are likely due to uracil sensitivity, lower elongation rate, high level of 3′-5′ exonuclease activity,23 or possible incompatibility of these enzymes with the reaction systems. Then, Taq DNA polymerase was utilized in the subsequent amplification. Because the half-live of Taq DNA polymerase at 97.5 °C is only 5 min,24 the enzyme was supplemented 2 times after the initial addition to maintain enough enzymatic activity. As a result, the combination of increased denaturing temperature, hot-start, and multiple addition of the polymerase provided a new PCR procedure as shown in Figure 1. Utilization of this procedure coupled with the mixture of additives effectively amplified the target fragment with high fidelity and yield (Figure 2b lane 1 and Figures S1and S2 in Supporting Information). To compare it with other PCR protocols, we examined different combinations of additives associated with their respective procedures. Figure 2b and Figure S3 (Supporting Information) indicate that all other PCR methods known to amplify GC-rich DNA fragments could not produce satisfactory results. Amplification of Other GC-Rich Genes from Human Genomic DNA. In order to evaluate the versatility of this new protocol for amplifying GC-rich DNA fragments, we explored the possibility of amplifying two other GC-rich sequences from human genomic DNA. A 658 bp fragment (78.88% GC) of aristaless-related homeobox (ARX) gene (GenBank Accession No. NG_008281), a regulator of embryonic myoblast differentiation,25 was effectively amplified (Figure 3 lane 1 and Figure S4 in Supporting Information). Similarly, one of the Contigs, a set of overlapping DNA segments functioning as a marker to deduce the physical map of the human genome,26 was also amplified successfully to obtain a 308 bp DNA fragment (GenBank Accession No. NT_008046, (23) Arezi, B.; Xing, W.; Sorge, J. A.; Hogrefe, H. H. Anal. Biochem. 2003, 321, 226–235. (24) Pavlov, A. R.; Pavlova, N. V.; Kozyavkin, S. A.; Slesarev, A. I. Trends Biotechnol. 2004, 22, 253–260. (25) Gecz, J.; Cloosterman, D.; Partington, M. Curr. Opin. Genet. Dev. 2006, 16, 308–316. (26) Huang, X. Genomics 1992, 14, 18–25.
6306
Analytical Chemistry, Vol. 82, No. 14, July 15, 2010
Figure 3. Amplification of GC-rich genes from eukaryotic genomic DNA by “SAFE PCR”. Ten microliters of PCR product was loaded on a 1.5% agarose gel. Lane 1, ARX; Lane 2, Contig; Lane 3, Dof; Lane 4, C-glucosyltransferase; Lane 5, GSPT2; Lane M, molecular weight marker (DL 2000, TaKaRa Bio Inc., Japan).
70.78% GC) (Figure 3 lane 2 and Figure S5 in Supporting Information). Amplification of GC-Rich Genes from Other Eukaryotic Genomic DNA. To further examine the utility spectrum, we employed this protocol to other eukaryotic GC-rich genes. For example, the protein of DNA binding with one finger (Dof) (GenBank Accession No. GQ184611, 71.4% GC) (Figure 3 lane 3 and Figure S6 in Supporting Information), a plant transcription factor involved in gene expression,27 and C-glucosyltransferase in rice (GenBank Accession No. FM179712, 71.42% GC) (Figure (27) Yanagisawa, S. Trends Plant Sci. 2002, 7, 555–560.
3 lane 4 and Figure S7 in Supporting Information), functioned in energy storage, cell membrane synthesis, and exogenous compound detoxification,28 were also efficiently amplified, resulting in DNA fragments of 472 bp and 1242 bp, respectively. In addition, the translation termination factor 3 (GSPT2) gene (GenBank Accession No. EU635753, 60.48% GC) from Cricetulus barabensis pseudogriseus, serving as a phylogenetic marker,29 was amplified to yield a fragment of 415 bp (Figure 3 lane 5 and Figure S8 in Supporting Information). In summary, we have developed a PCR method with SAFE (satisfactory, adaptable, fast, efficient) results for the amplification of GC-rich DNA fragments. “SAFE PCR” developed in the present study combines a stepwise procedure and a combination of additives. Compared to currently available methods for the amplification of GC-rich DNA fragments, “SAFE PCR” exhibits the following advantages: (a) extremely GC-rich genes with partial GC content greater than 90% can be amplified efficiently; (b) a wide range of biological samples with high GC content are applicable; (c) genomic DNA can be effectively served as templates; (d) on the top of high fidelity, the additives are costeffective; and (e) the entire protocol only takes 2.5 h to complete. Moreover, the optimal annealing temperature (Ta) for different samples in “SAFE PCR” was not a decisive factor to the outcomes of the amplification. This PCR method is a valuable addition to current methodologies for the diagnosis of various
biomarkers associated with different diseases and for the study of functions and regulations of various genes from different eukaryotic species.
(28) Coutinho, P. M.; Deleury, E.; Davies, G. J.; Henrissat, B. J. Mol. Biol. 2003, 328, 307–317. (29) Hoshino, S.; Imai, M.; Kobayashi, T.; Uchida, N.; Katada, T. J. Biol. Chem. 1999, 274, 16677–16680.
Received for review March 28, 2010. Accepted June 9, 2010.
CONCLUSIONS A versatile PCR method, in terms of “SAFE PCR”, for the amplification of DNA fragments with high GC content has been developed in the present study. Combination of a stepwise procedure and a mixture of additives is a unique feature of “SAFE PCR”. This PCR method can be applied to amplify GC-rich DNA fragments from a wide range of biological samples, which will facilitate our thorough understanding to genes and their regulations and functions. ACKNOWLEDGMENT M.W. and J.D. contributed equally to this work. This work was supported by the “111 Project” from the Ministry of Education of China and the State Administration of Foreign Expert Affairs of China (No. 111-2-07), a Doctoral Fund of Ministry of Education of China (No. 200803160005), and a National Key Project on Science and Technology of China (2009ZX09103-089). SUPPORTING INFORMATION AVAILABLE Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.
AC100797T
Analytical Chemistry, Vol. 82, No. 14, July 15, 2010
6307
