Use of Duckweed (Landoltia punctata) as a Fermentation Substrate for

Mar 31, 2014 - (6) First, duckweed has few requirements for production: its fast growth .... Double-headed arrows represent the 2-keto acid decarboxyl...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/EF

Use of Duckweed (Landoltia punctata) as a Fermentation Substrate for the Production of Higher Alcohols as Biofuels Haifeng Su,† Yun Zhao,† Juan Jiang,† Qiuli Lu,† Qing Li,† Yao Luo,† Hai Zhao,*,‡ and Maolin Wang*,† †

Key Laboratory of Bio-resources and Eco-environment of the Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610064, Sichuan, People’s Republic of China ‡ Bioenergy Laboratory, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, Sichuan, People’s Republic of China ABSTRACT: Duckweed (Lemnaceae) is a family of aquatic plants with potential for use as the next generation of alternative energy feedstocks, yet little related information about producing higher alcohols from duckweed has been published. We investigated the process of producing higher alcohols from duckweed via fermentation. Results showed that these plants have a promising future as the basis for developing biofuels. This could be achieved through fermentation by yeasts, producing not only traditional forms of energy such as ethanol but also higher alcohols with high energy yields through bioconversion by Clostridium acetobutylicum, mutant yeast strains, and bioengineered strains of Escherichia coli. The concentrations of butanol and total solvent produced via fermentation by C. acetobutylicum CICC 8012 were 12.03 and 20.03 g/L using acid hydrolysate of duckweed versus 12.33 and 20.05 g/L using enzymatic hydrolysate. The yields obtained of 24.06 g/L ethanol and 680.36 mg/L of isopentanol from duckweed using acid hydrolysate are 15 times higher than what could be obtained through the fermentation of the mutation of yeast. In addition, we were able to obtain yields of 16.27 mg/L butanol, 24.68 mg/L isopentanol, and 195.85 mg/L pentanol from the acid hydrolysate of duckweed via fermentation by the bioengineered strains of E. coli. Our results illustrated that duckweed represent an ideal fermentation substrate: they require only simple pretreatment, without the need for supplementary nitrogen or strengthening with redox agents. This provides a foundation for further development of industrialized biofuel production using duckweed.

■

INTRODUCTION Given the widely recognized unsustainability of depending solely on petroleum for development and environmental problems, increasing efforts have been directed at synthesizing biofuels from renewable resources.1−3 To date, several such renewable sources of energy have been developed, including ethanol from sugar cane, corn, and cassava and biodiesel from various plant oils such as coconut, palm, and rapeseed, which are also the sources of food for people and livestock. The increasing demand for ethanol and other biofuels could contribute to a global food shortage. Given this concern about the competing uses of resources for “food versus fuel”, the rising scarcity and price of fossil fuels, and the need to protect global environmental resources and food security, there is an even greater need to find new, renewable, nonfood sources for biofuel production. The use of agricultural waste or byproducts and nonfood crop sources as cheap fermentation substrates to produce biofuels has high economic appeal.4 Among nonfood crops, duckweed, a family of fast-growing, floating species that represent the world’s smallest and simplest flowering plants, has been proposed as an inexpensive, sustainable source of plant biomass for producing biofuels.5 There are many advantages to using duckweed in this regard, compared to other starch feedstocks such as corn and cassava.6 First, duckweed has few requirements for production: its fast growth ensures that a maximum yield of biomass is obtained in a short time with minimum costs,7 it thrives in wastewater that has no other use, it does not impact the food supply, and it can be © 2014 American Chemical Society

harvested more easily than algae and other aquatic plants. Second, duckweed is easy to grind and needs minimal energy for pretreatment. Additionally, biofuel from duckweed is considered as a “green fuel”, due to plants its consumption of carbon dioxide, the same byproduct obtained when the fuel is burned as an energy source. Analysis of composition shows that duckweed is rich in cellulose and pectin but contains little lignin.8 Thus, this plant family has promise not only to clean contaminated water, but also to provide an energy source with high starch and low-lignin content might suitable for conversion into biofuels through fermentation.9 A few recent studies have been conducted on the use of duckweed as a raw material for biofuel production. The exploitation of duckweed to date has concentrated on the production of gas, oil, and biochar through pyrolysis10,11 and thermolysis.12 Duckweed tissues have been gasified in a thermochemical-based superstructure to produce gasoline, diesel, and kerosene.13 Duckweed has also been used to produce ethanol5,14 and biogas15,16 by fermentation. Although combined, these reports indicated that duckweed biomass can produce significant quantities of starch that is readily usable for the production of ethanol via bioconversion, the yield is very low. The existing approaches are not yet sufficient to meet the requirements of industrial application. Thus, there is a need for Received: February 6, 2014 Revised: March 29, 2014 Published: March 31, 2014 3206

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

Figure 1. Flowsheet of the experimental design for fermentation processes. SC: S. cerevisiae AH109. EC: E. coli. CA: C. acetobutylicum CICC 8012. PFM: fermentation substrate (duckweed) for acid hydrolysate was filtered with a 0.22 μm membrane. NFM: the fermentation substrate without filtration. EP: pretreatment with enzymatic hydrolysis. AP: pretreatment with acid hydrolysis. AHD: acid hydrolysate of duckweed as the fermentation substrate, meaning the products resulting from pretreatment of duckweed with acid hydrolysis. EHD: enzymatic hydrolysate as the fermentation substrate, meaning the products resulting from pretreatment of duckweed with enzymatic hydrolysis. Cultivation and Mutagenesis of Saccharomyces cerevisiae AH109. The yeast strain S. cerevisiae AH109 (purchased from Clonetech, Beijing) was refrigerated and then inoculated into a YPDA liquid medium in an incubator shaker at 200 rpm up to OD600 of 1.5, kept at a constant temperature at 30 °C. A suspension liquid of yeast (15 mL per sample, total of four samples) was centrifuged at 3000 rpm for 1 min, and the supernatants were discarded. The yeast cells were further pretreated with the following three solutions: pretreatment 1 (“NJ”) contained 1.5% methanol; pretreatment 2 (“NS”) contained 5% methanol and 0.2% Tween 80; pretreatment 3 (“NC”) contained sorbitol buffer. Pretreatment 4 (“PS”) involved the preparation of competent yeast cells, which were washed with sterilized water (5 mL) and then centrifuged at 3000 rpm for 5 min, once again to collect the yeast cells. The cells were resuspended in a 5 mL solution containing 5% (v/v) glycerol, and 10% (v/v) dimethyl sulfoxide (DMSO). Mutagenesis experiment was then conducted by adding 0.1 g of NTG (1-methyl-3-nitro-1-nitroso-guanidin) as the mutagen into the yeast−cell solution and left for 10 min in each sample. The treated cells were washed three times with deionized water. Finally, 200 μL of the mutated cells were cultured on plates of YNB medium containing 20 mg/mL of AZL (4-aza-DL-leucine dihydrochloride) purchased from Sigma-Aldrich. Construction of Engineering Strains of Escherichia coli. E. coli DH5α competent cells (Takara: 9057) were used to propagate all plasmids. For propagating experiments to construct the strains, E. coli was grown in M9 medium containing 20 g/L glucose, 5 g/L yeast extract, and Trace Metals Mix A5 (2.86 g of H3BO3, 1.81 g of MnCl2· 4H2O, 0.222 g of ZnSO4·7H2O, 0.39 g of Na2MoO4·2H2O, 0.079 g of CuSO4·5H2O, and 49.4 mg of Co(NO3)2·6H2O per L water). Bacteria were inoculated with 1% (v/v) bacterium suspension from 3 mL overnight cultures in LB medium into 10 mL of fresh medium placed in 25 mL screw-cap baffled shake flasks and incubated at 37 °C in a rotary shaker for 4 h. The culture was then induced with 1 mM IPTG (isopropyl-β-D-thiogalactoside) and grown at 30 °C for 18 h. Antibiotics were added as needed (ampicillin, 100 μg/mL; chloramphenicol, 35 μg/mL; kanamycin, 50 μg/mL). The flasks containing the 10 mL cultures were inoculated at 1% from 3 mL overnight cultures in LB. All cultures were incubated at 37 °C for 4 h, induced with 1 mM IPTG, and harvested after 18 h of further growth at 30 °C. For the DNA cloning procedure, all restriction enzymes were purchased from Takara (Chengdu); the T4 DNA ligase was supplied by MBI Company (EL0334, Chengdu), and oligonucleotides were ordered from BGI Company (Beijing).

more research to develop the methods and microbial resources for utilizing duckweed. As an effective replacement for ethanol, the use of renewable, higher alcohols obtained from fermentation by microorganisms has been proposed as one solution to the energy crisis.17 Bioproduction of higher alcohols is desirable because they have the desired properties of renewable liquid fuels, such as higher energy density and lower hygroscopicity, along with wide applications in commodity chemicals. Higher alcohols, including isobutanol, 1-butanol, 2-methyl-1-butanol, 3-methyl1-butanol, and 2-phenylethanol, contain more than three carbon atoms and long carbon-chain enol compounds. They demonstrate the greatest potential as the substitute for petroleum. However, to our knowledge, there is no published research about the methods for using duckweed to produce higher alcohols through bioconversion. In this study, we report the first assessment of the potential for producing higher alcohols (containing butanol, isopentanol, and other compounds) using duckweed as a feedstock for fermentation by strains of Saccharomyces cerevisiae, Clostridium acetobutylicum and bioengineered Escherichia coli.

■

MATERIALS AND METHODS

Experimental Design. Experiments were conducted following the methodology illustrated in the flowsheet of fermentation processes (Figure 1). Duckweed were pretreated with two different methods of hydrolysis. The products of hydrolysis were then fermented by either the yeast, C. acetobutylicum, or bioengineered strains of E. coli. Microbial Strains for Fermentation. Cultivation of Clostridium acetobutylicum CICC 8012. The strain of C. acetobutylicum CICC 8012 was obtained from the China Center of Industrial Culture Collection, CICC (Beijing). Unless otherwise indicated, all experiments with this strain were performed under anaerobic conditions. As a breeding, a mixture of TGY medium and PT buffer (0.1 g of peptone, 8.5 g of sodium chloride, and 1 g of sodium thioglycollate solubilized in 1 L of distilled water) was placed in an anaerobic chamber (filled with N2) at least 24 h before the start of experiments to ensure that all dissolved oxygen was removed. The stock cultures were maintained as spores in sterilized, distilled and deionized water at room temperature. 3207

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

E. coli strains BW25113 (CGSC# 128747) and JM109 (Takara: D9052A) were used as the host strains for fermentation. All strains and plasmids are listed in Table 1, and the oligonucleotides used are listed in Table 2.

The plasmids pHAA1, pCAA1, and pPAA1 were constructed as follows (Table 1). The ARO10-ADH2 genes from S. cerevisiae AH109 (ADH2, KEGG YMR303C EC:1.1.1.1), C. tropicalis CICC 1275 (ADH2 CTRG_06113 EC:1.1.1.1), and P. pastoris GS115 (ADH2 KEGG YMR303C EC:1.1.1.1) were inserted into vector pHSG298, using the restriction enzymes KpnI, BamHI, and SphI for the construction of plasmid pHAA1, (b) SacI, BamHI, and SphI for plasmid pCAA1, and (c) KpnI, SalI, and SphI for plasmid pPAA1. The ribosome binding site (RBS) sequence (AGGAGA) was inserted upstream of each structural gene, with 6−8 nucleotides in between, to facilitate mRNA translation. The bioengineered E. coli strains with expressed ARO10 genes from C. tropicalis, P. pastoris, and S. cerevisiae were respectively named MAD, PAD, and SAD. The MAD contained the plasmids pSTACD and pCAA1; the PAD contained the plasmids pSTACD and pPAA1; the SAD contained the plasmids pSTACD and pHAA1. Pretreatment for Duckweed, Corn, and Cassava Biomass. Pretreatment for Dried Duckweed with Acid Hydrolysis. Duckweed (Landoltia punctata) was collected from ponds in Huilong Town, Xinjin County, Chengdu, China, and was cultivated to accumulate starch, and then was dried at 60 °C and crushed into powder. The duckweed powder (starch content 47.8%) was hydrolyzed using 1% sulfuric acid solution at 121 °C for 1 h. We determined the main nutritional components of duckweed (Table 3) to understand the baseline and then repeated the content analysis after pretreatment of 10 g of duckweed with acid hydrolysis (Table 4). The initial total glucose of the pretreated duckweed was adjusted to 80 ± 3.05 g/L, and the pH values of hydrolysates were adjusted to a neutral pH of 7.0 using 0.1% calcium hydroxide. The liquefied hydrolysates of duckweed were used as the substrates for further fermentation. Pretreatment for Fresh Biomass with Enzymatic Hydrolysis. Fresh duckweed was ground into a paste, suspended in 100 mL of water, and stirred. The pH of this solution was adjusted to 6.2 using 5% (w/v) Na2CO3. Then 1 mL of 5% (w/v) CaCl2 was added, and the mixture was heated in a water bath at 90−95 °C. Next, 0.012 KUN of αamylase (120 KUN/g, equivalent to 8000 U/g; Novozymes) was added to the paste, which was incubated at 70−80 °C until the paste was liquefied. The liquefied solution was heated for 10 min at 95 °C, cooled to 55 °C, the pH was adjusted to 4.8 with 1% (v/v) phosphoric acid, and 5 U glucoamylase (300 AGU/mL, 1 AGU equal to the quantity of enzyme used to hydrolyze 1 μg of maltose in 1 min. Novozymes) was added. Next, 1 mL of xylanase (enzyme activity ≥ 120 000 U/g, purchased from Heshibi Company, China) was added, the solution was kept at 50−55 °C for 4 h, 1 mL of pectinase (enzyme activity ≥ 100 000 U/g, purchased from Heshibi company, china) was added, and the resulting solution was kept at 45−50 °C for 1 h. Finally, the hydrolysate was cooled to room temperature for fermentation. Corn and cassava were pretreated in the same way. We assessed the components of 10 g of duckweed, corn, and cassava after pretreatment with enzyme hydrolysis (Table 4). The total glucose of all pretreated substances was adjusted to 80 ± 3.05 g/L and sterilized before they were used as a fermentation substrate. Fermentation Methods. Fermentation Conditions for C. acetobutylicum CICC 8012. The C. acetobutylicum CICC 8012 that had been cultured for 24 h (10% inoculum dose (v/v) was inoculated into 50 mL of duckweed hydrolysate with P2 medium18 without ammonium acetate and CaCO3 in a 150 mL Erlenmeyer flask and fermented at 37 °C for 72 h under anaerobic conditions (container filled with nitrogen). We individually investigated the influences of ammonium acetate and CaCO3, neutral red, sodium sulfide, and chloramphenicol on butanol production using acid hydrolysates of duckweed as the fermentation substrate. The concentrations of ammonium acetate and CaCO3 individually were prepared as 1, 2, 3, and 4 g/L. We also compared the butanol yields from enzymatic hydrolysates of duckweed, maize, and cassava. The amounts of initial total glucose in the pretreated substrates were adjusted to 80 ± 2.05 g/ L and sterilized; the initial pH values of fermentation substrates were adjusted to 7.0. Fermentation Conditions for the Mutated S. cerevisiae AH109. The initial total glucose of the pretreated duckweed was adjusted to 80

Table 1. Strains and Plasmids Used in This Study strain or plasmid

relevant genotypes

reference or source

strains DH5α

BW25 113 JM109

MAD-BW25 113 PAD-BW25 113 SAD-BW25 113 MAD-JM109 PAD-JM109 SAD-JM109 plasmids pSTV29 pHSG298 pSTCD pSTACD pHAA1 pCAA1 pPAA1

F-, φ 80dlacZ ΔM15, Δ(lacZYAargF)U169, deoR, recA1, endA1, hsdR17 (rK-, mK+), phoA, supE44, λ-, thi −1, gyrA96, relA1 rrnBT14 DlacZWJ16 hsdR514 DaraBADAH33 DrhaBADLD78 recA1, endA1, gyrA96, thi-1, hsdR17, e14-(mcrA-), supE44, relA1, Δ(lacproAB)/F′[traD36, proAB+, lac Iq, lacZΔM15] host strain BW25113 contained pSTACD and pCAA1; host strain BW25113 contained pSTACD and pPAA1 host strain BW25113 contained pSTACD and pHAA1 host strain JM109 contained pSTACD and pCAA1; host strain JM109 contained pSTACD and pPAA1 host strain JM109 contained pSTACD and pHAA1 pACYC184 ori; Cmr; PLlacO-1: MCS pMB1 ori; Kanr; PLlacO-1: MCS pACYC184 ori; Cmr; PLlacO-1: ilvCilvD(EC) pACYC184 ori; Cmr; PLlacO-1: alsS(BS)-ilvC-ilvD(EC) pMB1 ori; Kanr; PLlacO-1: ARO10(SC)-ADH2(SC) pMB1 ori; Kanr; PLlacO-1: ARO10(CT)-ADH2(CT) pMB1 ori; Kanr; PLlacO-1: ARO10(PP)-ADH2(PP)

Takara: 9057

CGSC: 128 747 Takara: D9052A

this study this study this study this study this study this study

Takara: 3332 Takara: 3298 this study this study this study this study this study

EC, E. coli; SC, S. cerevisiae; BS, Bacillus subtilis; CT, Candida tropicalis; PP, Pichia pastoris GS115. To improve the yield of higher alcohols, a modified metabolic pathway C was used (Figure 2). We cloned the higher alcohols biosynthesis-related genes ilvC (which codes keto-acid reductoisomerase, KEGG EC:1.1.1.86) and ilvD (which codes dihydroxy acid dehydratase, KEGG EC:4.2.1.9) from E. coli using primers iC and iD. The plasmid pSTCD was constructed by cloning ilvC and ilvD from E. coli into vector pSTV29, and the plasmid pSTACD was constructed by cloning alsS (which codes for acetolactate synthase, KEGG EC:2.2.1.6) from Bacillus subtilis CICC 10025 into vector pSTCD. To obtain the greatest possible yields of higher alcohols, we experimented with different strains of E. coli, that we bioengineered with decarboxylase genes (ARO10) extracted from different yeast species and then used to ferment hydrolysates of duckweed. The ARO10 genes (which code for phenylpyruvate decarboxylase) were amplified with PCR from the genomic DNA of S. cerevisiae AH109 (KEGG YDR380W, EC:4.1.1.-), Candida tropicalis CICC 1275 (KEGG K12732, EC:4.1.1.-) purchased from the China Center of Industrial Culture Collection, and Pichia pastoris GS115 (ATCC NO. 20864) (KEGG PAS_chr3_0095 EC:4.1.1.-) with primer pairs SCAro10, CT-Aro10, and P2-1PP-Aro, respectively. The ADH2 genes were amplified from the genomic DNA of S. cerevisiae AH109, C. tropicalis CICC 1275, and P. pastoris GS115 with primers sc-AHD-2B, pp-ADH-2, and mb-ADH-2, respectively (Table 2). 3208

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

Table 2. Primer Pairs Used in This Study name

sequence (5′ to 3′)

alsS

s-GCCTGCGCATGCCACAAAAGCAACAAAAGA as-ACGCAGTCGACCTAGAGAGCTTTCG s-ACGCGTCGACAGGAAACAGACCATGGCTAACTACTTCAAT as-CGGGATCCTTAACCCGCAACAGCAATAC s-CGGGATCCAGGAGATATACCATGCCTAAGTACCGTTC as-GCCGAGCTCTTAACCCCCCAGTTTCGATTTATC s-CGGGATCCAGGAAGATATACCATGTCTATTCCAGAA as-ACATGCATGCTTATTTAGAAGTGTC s-ACGCGTCGACAGGAAGATATACCATGGCGTACCCAGAC as-ACATGCATGCCTATTTGAATGCCTT s-CGGGATCCAGGAAGATATACCATGTCCCTTGTTCTC as-ACATGCATGCTCATGGATGGAAAAC s-GGGGTACCATGGCACCTGTTACAATTGA as-CGGATCCCTATTTTTTATTTCTTTTAA s-CGAGCTCATGGCTCCAATACAACAATC as-CGGGATCCCTAATTCTTGCACATCATGT s- GGGGTACCATGGCCCCAGTTAAACAAGA as-ACGCGTCGACCTAATGAATACTTTTACTTG

iC iD sc-AHD-2B pp-ADH-2 mb-ADH-2 SC-Aro10 CT-Aro10 P2-1PP-Aro

s = sense and as = antisense. produced by acid hydrolysis were divided into two portions, one of portions was named PFM pretreatment (samples were passed through a 0.22 μm filter in order to remove impurities such as cellulose, lignin, and other compounds that otherwise may have been able to inhibit fermentation). The substrates were fermented under aerobiotic conditions for 96 h and other portion pretreatment was named NFM (samples were not filtered). P2 medium containing 0.1% yeast extract was added into the acid hydrolysates of duckweed, and 2 mL of a seeding solution from YPDA liquid medium was inoculated into 25 mL of the acid hydrolysates in a 100 mL triangular flask and fermented at 33 °C with shaking at 180 rpm for 96 h in a constant-temperature oscillation incubator. Fermentation Conditions for Bioengineered E. coli. The initial total glucose of the pretreated duckweed was adjusted to 80 ± 3.05 g/ L and sterilize, the pH values of hydrolysates were adjusted to 7.0 using 0.1% calcium hydroxide. A P2 medium containing 1% yeast extract and 2% peptone was prepared using the acid hydrolysate of duckweed as the carbohydrate source. The inoculum was cultivated with 5 mL of TGY medium. The seeds of E. coli were incubated for 16 to 18 h at 37 °C until the optical density at 600 nm was 1.0 to 1.5, and then inoculated into the 50 mL of P2 medium with 1 mM IPTG in a 150 mL Erlenmeyer flask. Fermentations were performed at 33 °C with shaking at 180 rpm for 96 h in a constant-temperature oscillation incubator under aerobic condition. Assessment of Duckweed Composition. Duckweed was hydrolyzed with 1% H2SO4, and the starch content was then calculated based on the total sugar content (starch content = glucose content × 0.91).19,20 The crude protein content was measured as CP = Kj N × 6.25, Xiao Yao.21,22 Cellulose content was measured with spectrophotometry: 10 g of duckweed was placed in 1 L of water, 60 mL of 60% H2SO4 were added, and the plants were left to decompose for 30 min. We added 2% anthrone reagent (v/v) to the hydrolyzed

Figure 2. Production of higher alcohols by constructing potential pathways. The synthetic networks that produced higher alcohols in bioengineered E. coli. Double-headed arrows represent the 2-keto acid decarboxylation and reduction pathways. ilvC: keto-acid reductoisomerase. ilvD: dihydroxy acid dehydratase. KDC: 2-keto acid decarboxylases. ADH: Ethanol dehydrogenase. ARO10: phenylpyruvate decarboxylase.

Table 3. Main Components of Duckweed (L. punctata) pretreatment sample dried duckweed fresh duckweed

cellulose content (%)

protein content (%)

starch content (%)

lignin content (%)

14.26

21.5

47.8

1.16

15.34

0.115

4.35

7.13

± 3.05 g/L and sterilized; the pH values of hydrolysates were adjusted to 7.0 by using 0.1% calcium hydroxide. Duckweed hydrolysates

Table 4. Carbohydrate Composition of Duckweed after Pretreatment with Acid or Enzymatic Hydrolysis (Before Fermentation: 0 h) pretreatment sample dried duckweeda fresh duckweedb cornb cassavab

glucose 4.94 1.96 6.12 5.21

± ± ± ±

1.13 0.51 1.54 1.36

xylose 1.35 0.71 1.13 2.03

± ± ± ±

galactose

0.35 0.14 0.21 0.84

0.51 0.263 0.447 0.324

± ± ± ±

0.24 0.085 0.11 0.125

fructose 1.02 0.425 1.163 0.948

± ± ± ±

0.27 0.092 0.26 0.278

arabinose 0.91 0.362 0.324 0.426

± ± ± ±

0.16 0.15 0.075 0.195

Content (g) of determinating various components with 10 g pretreatment samples. aAcid hydrolysis pretreatment method. bEnzymatic hydrolysis pretreatment method. 3209

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

mixture, left it for 2 min, and then measured the absorbance under 620 nm.23−25 We then calculated cellulose content of sample according to standard curve. Cellulose content Y (%) of duckweed = X (cellulose content of standard sample) × a (diluted multiples) × 100/W (total weight of samples). The content of lignin was determined using acetyl bromide according to standard methods.26,27 Detection of Alcohols Produced by Duckweed Biomass Fermentation. The alcohol compounds produced by fermentation were measured with a gas chromatograph (GC) equipped with a flame ionization detector. The system consisted of model 7820 GC (Agilent Technologies, Santa Clara, CA, USA) and a model 7673A automatic injector, sampler, and controller (Hewlett-Packard). The separation of alcohol compounds was carried out using an HP-5 capillary column (30 m, 0.25 mm inside diameter, 0.25 μm film thickness; Agilent, USA). The GC oven temperature was initially held at 40 °C for 5 min and then raised at a gradient of 15 °C/min until it reached 150 °C. It was then raised at a gradient of 50 °C/min up to 250 °C, and held for 4 min. Helium was used as the carrier gas, with an inlet pressure of 9.3 lb/in2. The injector and detector were maintained at 220 °C. Supernatant of culture broth (1 μL) was injected in split-injection mode with a 1:30 split ratio. Methanol or butanol was used as the internal standard. For other secreted metabolites, filtered supernatant (20 μL) was assessed with an Agilent 1100 high-performance liquid chromatography system equipped with an autosampler and a Bio-Rad (Hercules, CA: carbohydrate analysis column Aminex HPX-87P column 300 × 7.8 mm, catalog 125-0098, serial 426070) (5 mM H2SO4, 0.6 mL/min; column temperature at 65 °C). Glucose and other monosaccharides such as xylcose and galatcose were detected with an ELSD 2000 CSC detector, whereas organic acids were detected using a photodiode array detector at 210 nm. Concentrations were determined using extrapolation from standard curves. Statistical Analysis. Three replicates of each experiment and assay were carried out unless otherwise indicated, and for each we calculated the mean response variables with standard deviation (SD). An alpha level of 0.05 was used in ANOVA and t-tests, i.e., p < 0.05 was considered to be significant.

■

Figure 3. Mutant yeast strains with a relatively high yield of main products used glucose as the fermentation substrate. SC: the original strain S. cerevisiae AH109.

RESULTS Higher Alcohols Obtained from Acid Hydrolysates of Duckweed Using the Mutants of S. cerevisiae AH109. We selected a mutant-producing isopentanol from AZL-resistant mutants derived from S. cerevisiae to confer a considerable yield. We used the mutant strain to produce distinctively higher alcohols from duckweed. First, we used glucose (20 g/L) as the fermentation substrate to screen out a mutant strain that might have high productivity for higher alcohols. A total of 30 mutant clones appeared in the medium; the higher alcohols that these mutants produced were determined, and we found a total of 8 mutants that produced large quantities of isopentanol: PS-3, NS-3, NC-17, NC-14, NC-12, NC-6, NC-4, and NC-1. There was no significant increase in ethanol production by mutants compared to SC (S. cerevisiae AH109), but the yield of isoamyl alcohol increased significantly, with up to 6 times the normal yield, from NC-1 (Figure 3). Overall, when these mutants were used to ferment duckweed, there was a large difference in isopentanol yield between unfiltered (Figure 4B-a) versus filtered duckweed hydrolysate (Figure 4B-b), depending on the mutant used. The mutants NC-4, NC-6, and NC-17 produce more isopentanol, and NC-17 had highest yield at 680.36 mg/L, 15 times greater than with SC (Figure 4B-a). When the hydrolysates were filtered, the alcohol yield of the mutants declined dramatically, and some were entirely unable to produce isopentanol (e.g., NC-17). In terms of ethanol production, the mutant NS-3 produced the highest yield (Figure 4A-a), reaching 24.06 g/L, which is far greater than that of SC. To our knowledge, this

value is actually second only to the maximum reported yield of alcohol from studies that have used duckweed to produce biofuels.14 The change in glucose consumption during acid hydrolysis of duckweed was also surveyed. Glucose from unfiltered samples (Figure 5a) was more fully utilized compared to that from filtered samples have been (Figure 5b). The mutants NC-4 and NC-17 had a better ability to produce isopentanol, so they were chosen for further analysis. The glucose from the filtered pretreatment would not be consumed after 63 h, whereas that from the unfiltered samples was utilized at up to 80 h (Figure 5c). This pattern means that the fermentation stopped very early on for filtered samples, leading to little production of isopentanol and ethanol. ABE Production from Acid Hydrolysates of Dried Duckweed and Enzymatic Production from Fresh Duckweed via Fermentation by C. acetobutylicum CICC 8012. We chose to use an inorganic nitrogen source (ammonium acetate) rather than an organic protein nitrogen source, because it is absorbed more easily and quickly by microbes. Ammonium acetate concentrations of 1, 2, 3, and 4g/L led to productions of 10.91, 10.61, 10.67, and 10.15 g/L of butanol, respectively, corresponding to total solvent yields of 17.36, 17.43, 17.83, and 16.85 g/L (Figure 6 a,b). However, comparison to the butanol production of 12.2 g/L and a 3210

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

Figure 4. Ethanol and isopentanol yields of mutant strains in the acid hydrolysate of duckweed. Panel b: the acid hydrolysate of duckweed was filtered with a 0.22 μm membrane. Panel a: no filtration. SC: the original strain S. cerevisiae. ND: production was not detected.

(Figure 8b). There was an exponential growth phase between 24 and 48 h. The tendency for a total reduction in sugar consumption was relatively gradual. Production of Higher Alcohols from Acid Hydrolysates of Duckweed Using Bioengineered E. coli. We selected three ARO10 genes of decarboxylases and dehydrogenases from three different yeasts, S. cerevisiae (SAD), C. tropicalis (MAD), and P. pastoris (PAD). When these genes were cloned into two E. coli hosts with different genotypes, and the hydrolysates of the PFM pretreatment were selected as fermentation substrates, MAD and PAD did not perform well: MAD produced only butanol (4.96 mg/L) using BW25113 as the expression host, PAD produced isobtanol (4.42 mg/L) and butanol (4.86 mg/L), while other higher alcohols such as isopentanol and pentanol were not detected (Figure 9a). Better results were obtained with SAD, which produced isobutanol (50.12 mg/L), isopentanol (15.01 mg/L), and pentanol (6.03 mg/L). It also produced high amounts of ethanol (294.13 mg/ L) and propanol (14.61 mg/L). However, the yields of higher alcohols butanol, isopentanol, and pentanol from MAD were improved when JM109 was used as the expression host, compared to BW25113 (Figure 9b). Production of butanol reached 10.23 mg/L, isopentanol was 11.15 mg/L, and pentanol was 26.76 mg/L. Similarly, PAD produced butanol at 6.58 mg/L, isopentanol at 8.68 mg/L, and pentanol at 6.33 mg/L. Results for SAD were also improved with JM109 as the expression host, resulting in 16.27 mg/L of butanol, 24.68 mg/ L of isopentanol, and 195.85 mg/L of pentanol. When bioengineered strains of E. coli were used, glucose consumption in the acid hydrolysate of duckweed did not differ (Figure 9c); the remaining sugar was almost equal, and the utilization efficiency reached up to 95%. This result suggests that the antinutritive compounds that may be produced during acid hydrolysis of duckweed cause no apparent inhibition of the growth and development of bioengineered E. coli strains.

total solvent yield of 19.33 g/L with the control sample (CK), in the absence of ammonium acetate, showed that adding this accelerator resulted in no obvious improvement in butanol yield. The result demonstrated that Butanol yields from CK were the highest, reaching 12.23 g/L compared with the treatments that included CaCO3 at different concentrations (Figure 6c,d). The highest amount of total solvent reached was 20.35 g/L, and the lowest final pH value was 4.32 (Figure 8a). The effects on butanol production from adding a reducing agent such as neutral red (Figure 7a) or Na2S (Figure 7b) into the acid hydrolysates of duckweed have no significant difference. The highest butanol yield from CK under these conditions was 12.34 g/L, and the amount of total solvent reached 20.5 g/L, higher compared to those samples to which neutral red was added (Figure 7a). Similarly, the highest butanol yield was 12.24 g/L and the total solvent obtained reached 20.05 g/L using CK (Figure 7b). When chloramphenicol (120 μg/L) was added into the acid hydrolysates of duckweed, the highest butanol production with CK was 12.33 g/L and total solvent reached 20.05 g/L. Thus, adding chloramphenicol during any time of the fermentation process did not significantly improve butanol yields (Figure 7c,d). Compared to the use of fresh duckweed, enzymatic hydrolysates of the energy crops corn and cassava did not produce different yields of butanol (Table 5). The highest butanol yield from duckweed (12.33 g/L) was not different from what was obtained using corn or cassava under the same initial concentration of fermentation substrates (80 g/L). The total residual sugars were also not significantly different, illustrating that the ability of C. acetobutylicum CICC 8012 to produce sugars in the enzymatic hydrolysis of duckweed was as good as in the hydrolysis of corn and cassava. The pH value reached its lowest point after 15 h of fermentation, at above 4.0 3211

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

it lowered yields to some extent. The reason may be that duckweed has been used as a plant resource to control environmental pollution, because it has the ability to clean polluted waters that are rich in nitrogen, phosphorus, potassium, and other nutrients.29 That is, duckweed is able to accumulate enough nitrogen by absorbing nutrients from polluted water,30 and, in fact, the protein content of duckweed (7.1−15%)31,32 is enough to support the growth of microbes (Table 3). The nutrient elements from duckweed remained in the fermentation substrates after pretreatment, and were absorbed and utilized by microbe. This suggests that the nitrogen content of duckweed was sufficient, such that supplemental nitrogen sources are unnecessary. This gives duckweed a clear advantage over other energy plants as potential biomass for use in biofuel production. The value of pH has an important effect on butanol fermentation; because CaCO3 has a buffering effect on the pH of a culture medium, its addition can effectively maintain pH in the appropriate range. Only when the pH is maintained between 4.5 and 5.0 will the growth of bacteria enough promote the synthesis of solvents and enable butanol yields that are high enough for industrial fermentation.33−35 We found that the acetic acid and butyric acid produced lowered pH to nearly 4 at the early stages of fermentation; these acids were not converted fully into ethanol and butanol, so pH was still below 4.5 during the later phases of fermentation. The experiment confirmed that butanol yields were not increased by the addition of calcium carbonate, so this step may not be necessary for pH adjustment during the acid hydrolysis of duckweed for use as a fermentation substrate. When the reducing power (ATP, NADH) is sufficient in vivo, precursor compounds like acetic acid and butyric acid can be converted fully to alcohol and butanol during fermentation by C. acetobutylicum. Neutral red can replace ferredoxin to transfer an electron and proton. Neutral red is used as an electron carrier to consume a large number of NADH, leading to the shortage of intracellular NADH, such that microbes have no choice but to supplement NADH through the reduction reaction for NAD at the cost of using hydrogen.36,37 Therefore, adding neutral red to the medium can enhance reducing power to go up in the fermentation process. We added different concentrations of neutral red to explore the effect of producing butanol in acid hydrolysate of duckweed. The balance of cell osmotic pressure can be adjusted and maintained; moreover, the redox potential of cells also can be controlled by adding Na2S similar [4Fe4S] ferredoxins.38−40 Therefore, adding Na2S may promote the growth of C. acetobutylicum and further improve the production of solvent. However, our results showed that adding neutral red and Na2S did not significantly improve butanol yields. This may have occurred because duckweed is able to accumulate enough of the compound with reducing action by absorbing some heavy metals such as mercury, copper, and lead.41,42 These compounds would then remain in the fermentation medium after duckweed pretreatment, providing adequate reducing power to meet the needs for C. acetobutylicum growth. Clearly, reducing power is not a limiting factor for butanol fermentation in acid hydrolysate of duckweed. There are other reports have confirmed butanol production is higher when bacteria enter the decline phase early, as a result of autolysis of C. acetobutylicum; this leads to an early end to fermentation and a reduction in butanol yields.43,44 However, if a certain amount of chloramphenicol is added at the

Figure 5. Glucose consumption in the acid hydrolysate of duckweed. Panel a: the acid hydrolysate of duckweed was not filtrated. Panel b: the acid hydrolysate of duckweed was filtered with a 0.22 μm membrane. SC: the original strain S. cerevisiae AH109. CK: the control sample in which glucose was not utilized. Panel c: change of glucose consumption in the acid hydrolysate of duckweed. PNM: the acid hydrolysate of duckweed was filtered with a 0.22 μm membrane. NFM: no filtration.

■

DISCUSSION Factors that Affect the Yield of Butanol Production from C. acetobutylicum CICC 8012 Fermentation. As duckweed is a new kind of energy crop, its elemental contents such as carbon, nitrogen, phosphorus, and other basic nutrients that influence fermentation by microorganisms need to be determined. A source of nitrogen is necessary for microbial growth. In industrial fermentation, organic nitrogen compounds such as yeast extract and inorganic compounds such as ammonium acetate are usually added into a bacterial culture media. Most nitrogen sources of protein exist as a powder or paste material; if added to the fermentation medium, this kind of nitrogen source increases the viscosity and leads to difficulties for adjusting the pH.28 Therefore, inorganic ammonium acetate was selected for use in this study. We found that the addition of ammonium acetate did not significantly improve butanol production, and, on the contrary, 3212

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

Figure 6. Effect of nutrilites on butanol yield. Panel a: the effect of adding ammonium acetate at different concentrations to the acid hydrolysate of duckweed. CK: the control sample without ammonium acetate. Panel b: the effect of adding calcium carbonate at different concentrations to the acid hydrolysate of duckweed. CK: the control sample without calcium carbonate.

Figure 7. Effects on butanol yield caused by adding neutral red and Na2S to acid hydrolysate of duckweed. CK: the control sample without neutral red and Na2S. The effect on butanol yield of adding chloramphenicol to the acid hydrolysate of duckweed. CK: the control sample without chloramphenicol.

appropriate growth period, the autolysis of C. acetobutylicum can be slowed and this extends the stabilization stage of microbial breeding, which increases the butanol yield.45 We found that adding chloramphenicol did not improve the butanol yield in acid hydrolysate of duckweed. Reduction in cellular autolysis in the presence of chloramphenicol is due mainly to a decreased rate of cell wall degradation by inhibition of autolysin synthesis, yet the butanol yield could be improved.

We surmise that some compounds have the same effect in acid hydrolysate of duckweed substitute for chloramphenicol, such as homoorientin and vitexin flavonoids: Luteolin-7-β-glucoside, 8-hydroxy luteolin-8-β-glucoside. Effect of Duckweed Pretreatment on the Production of Higher Alcohols. In this experiment, the experimental duckweed leaves that we used were divided into dry duckweed for pretreatment with acid hydrolysis and fresh duckweed used 3213

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

Table 5. Butanol Production from Duckweed (L. punctata), Corn, and Cassava substrates L. punctata corn casasva

butanol (g/L)

acetone (g/L)

ethanol (g/L)

total solvent (g/L)

TRRS (g/L)

butanol/ total solvent (%)

12.33

6.17

0.83

19.23

1.24

63.46

12.19 11.78

6.63 5.47

1.02 1.21

19.84 19.22

1.38 1.17

61.42 61.30

and release enough reducing sugar; all of these conditions make duckweed a better option than other crops for developing potential sources of alternative energy from plant biomass. This point was confirmed by the finding that the glucose was thoroughly utilized when engineered strains of E. coli were used to ferment acid hydrolysate of duckweed, which showed that E. coli growth was not inhibited by toxic compounds. Thus, we have demonstrated that it is feasible to directly ferment the hydrolysate of duckweed without the complex detoxification process by constructing a suitable engineering strain of E. coli in the future. Mutant and Bioengineered Microorganisms to Augment the Production of Higher Alcohols. These experimental results demonstrate that it is feasible to obtain high yields of ethanol by using mutant strains of yeast to ferment acid hydrolysate of duckweed. Moreover, it is possible to obtain higher alcohols by improving the ability of fermentation of yeast. Further still, it is unnecessary to perform the step of filtering acid hydrolysates of duckweed to remove possible toxic compounds that inhibit microbial growth. Indeed, after filtration, we found that alcohols yields were significantly reduced. The reasons may be that (1) some nonhydrolytic starch and proteins were removed by filtering or (2) there may be trace amounts of inhibiting compounds in PNM, and beneficial compounds that compete with these inhibitor compounds were removed by filtering, allowing toxic substances to play an inhibitory effect on PNM, resulting in lower alcohol production. Our investigation has further significance for using duckweed to produce biofuels for industrial applications, as duckweed can rapidly grow to obtain a large quantity of biomass in a short time and can accumulate enough starch. Xumeng Ge et al. studied the growth of Lemna minor in swine lagoon wastewater and found that it has a growth rate of 3.5 and 14.1 g m−2 day−1 (dry basis) and a high ethanol yield of 48.5%.50 Jiele Xu et al.51 tested the biomass accumulation rate of Spirodela polyrrhiza in a pilot-scale culture pond that utilized diluted pig effluent and used duckweed to produce ethanol. The biomass was up to 12.4 g dry weight m−2 day−1 with a starch yield of 9.42 × 103 kg ha−1 and the ethanol yield reached 6.42 × 103 L ha−1. In addition, the better result from the research of our team’s other members, we obtained the maximum growth rate of Landoltia S3 strain was 30.35 g/m2/week, and Landoltia OT with the highest starch accumulation rate was achieved at 3.88 g/m2/ week via the way of storing enough energy in the form of starch under oligotrophic condition for survival. The Landoltia OT reached the highest starch content of 52.9% from the field experiment when harvesting on the proper time of early winter on December 28 in Huilong, Chengdu (subtropical zone).22 The highest ethanol yield of 30.8 ± 0.8 g/L was also obtained from our team.14 Beyond these researches, our results also showed that it is highly feasible to use duckweed after pretreatment as a fermentation substrate to produce higher alcohols. Yields of butanol produced by fermenting duckweed reached 12.33 g/L, production rate of 0.08g/g (dried duckweed), and total solvent reached 20.03 g/L, production rate of 0.13g/g (dried duckweed), productivity levels equivalent to those achieved using other crops. Higher ethanol yields were obtained using mutant yeast to ferment duckweed, and this also resulted in production of isopentanol. Similarly, higher alcohols could be obtained by constructing bioengineered strains of E. coli to ferment the acid hydrolysate of duckweed.

TRRS: total residual reducing sugar after fermentation finished.

Figure 8. Changes in fermentation indicators. Panel a: change of pH during fermentation when calcium carbonate is added to acid hydrolysate of duckweed. CK: the control sample without calcium carbonate. Panel b: changes in different products of fermentation in enzymatic hydrolysate of duckweed.

in enzymatic hydrolysis. In the butanol fermentation experiment, acid hydrolysis and enzymatic hydrolysis produced no difference in butanol yields. This shows that the two common methods for pretreating duckweed have no significant effect on butanol production. Again, the use of duckweed thus has clear advantages compared to other biofuel crops that contain more cellulose and lignin, such as cassava. Cassava contains more cellulose and hemicellulose, so butanol production is lower when enzymatic hydrolysate is used in industrial fermentation, compared to acid hydrolysate.46 Furthermore, when energy plants rich in cellulose, hemicellulose, and lignin undergo acid hydrolysis, they produce substances that inhibit microbial growth, such as furfural, leading to poor butanol yields.47−49 Duckweed contains less cellulose and hardly any lignin, and so it produces very few toxic compounds during acid hydrolysis. At the same time, our experiment showed that the method of enzymatic decomposition can also fully break down duckweed 3214

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

Figure 9. Production of higher alcohols from the acid hydrolysate of duckweed via fermentation with ARO10 from different yeast species in different E. coli expression hosts. Panel a, MAD-BW25113: ARO10 from C. tropicalis was overexpressed in E. coli BW25113. PAD-BW2511: ARO10 from P. pastoris GS115 was overexpressed in BW25113. SAD-BW25113: ARO10 from S. cerevisiae was overexpressed in E. coli BW25113. ND: production was not detected. Panel b, MAD-JM109: ARO10 from C. tropicalis was overexpressed in E. coli JM109. PAD-JM109: ARO10 from P. pastoris GS115 was overexpressed in E. coli JM109. SAD-JM109: ARO10 from S. cerevisiae was overexpressed in E. coli JM109. ND: production was not detected. Panel c, change of glucose consumption in the acid hydrolysate of duckweed by bioengineered E. coli.

■

CONCLUSION

■

AUTHOR INFORMATION

■

(1) Metzger, J. O.; Bornscheuer, U. Appl. Microbiol. Biotechnol. 2006, 71, 13−22. (2) Willke, T.; Vorlop, K. D. Appl. Microbiol. Biotechnol. 2004, 66, 131−142. (3) Zheng, S.; Jiang, W.; Cai, Y.; Dionysiou, D. D.; O’Shea, K. E. Catal. Today 2014, 224, 83−88. (4) Bender, M. Bioresour. Technol. 1999, 70, 81−87. (5) Cheng, J. J.; Stomp, A.-M. Clean: Soil, Air, Water 2009, 37, 17− 26. (6) Stomp, A.-M. The duckweeds: A valuable plant for biomanufacturing. Biotechnol Annual Rev. 2005, 11, 69−99. (7) Oron, G. Agric. Water Manage. 1994, 26, 27−40. (8) Ovodova, R. G.; Golovchenko, V. V.; Shashkov, A. S.; Popov, S. V.; Ovodov, Y. S. Russ. J. Bioorg. Chem. 2000, 26, 669−676. (9) Zhao, X.; Elliston, A.; Collins, S. R. A.; Moates, G. K.; Coleman, M. J.; Waldron, K. W. Biomass Bioenergy 2012, 47, 354−361. (10) Muradov, N.; Fidalgo, B.; Gujar, A. C.; Garceau, N.; T-Raissi, A. Biomass Bioenergy 2012, 42, 123−131. (11) Muradov, N.; Fidalgo, B.; Gujar, A. C.; T-Raissi, A. Bioresour. Technol. 2010, 101, 8424−8428. (12) Campanella, A.; Muncrief, R.; Harold, M. P.; Griffith, D. C.; Whitton, N. M.; Weber, R. S. Bioresour. Technol. 2012, 109, 154−162. (13) Baliban, R. C.; Elia, J. A.; Floudas, C. A.; Xiao, X.; Zhang, Z.; Li, J.; Cao, H.; Ma, J.; Qiao, Y.; Hu, X. Ind. Eng. Chem. Res. 2013, 52, 11436−11450. (14) Chen, Q.; Jin, Y.; Zhang, G.; Fang, Y.; Xiao, Y.; Zhao, H. Energies (Basel, Switz.) 2012, 5, 3019−3032. (15) Balasubramanian, P. R.; Kasturi Bai, R. Bioresour. Technol. 1992, 41, 213−216. (16) Jain, S. K.; Gujral, G. S.; Jha, N. K.; Vasudevan, P. Bioresour. Technol. 1992, 41, 273−277.

To summarize the aforementioned results, our experiments illustrated that duckweed has very high energy efficiency for producing biofuels that contain higher alcohols such as butanol and isopentanol. Duckweed can clearly be used as a biofuel and production should concentrate on higher alcohols in the future. There is much potential for further research and development of these methods, which will provide an opportunity to realize the great prospects for duckweed as an industrial feedstock in alternative energy production. Our research provides a foundation for further development of industrialized biofuel production using duckweed.

Corresponding Authors

*M. Wang. E-mail: [email protected]. *H. Zhao. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

REFERENCES

ACKNOWLEDGMENTS

The authors gratefully acknowledge the support of the organizations who funded this work: the National “863” Programme (No. 2011AA10A10401), the Knowledge Innovation Program of the Chinese Academy of Sciences (No. KSCX1-YW-11C4), and the 12th “five-year” key task project in crop breeding of Sichuan Province (SN: 2011yzgg05). 3215

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216

Energy & Fuels

Article

(17) Lee, S. K.; Chou, H.; Ham, T. S.; Lee, T. S.; Keasling, J. D. Curr. Opin. Biotechnol. 2008, 19, 556−563. (18) Ezeji, T. C.; Qureshi, N.; Blaschek, H. P. Appl. Microbiol. Biotechnol. 2004, 63, 653−658. (19) Rose, R.; Rose, C. L.; Omi, S. K.; Forry, K. R.; Durall, D. M.; Bigg, W. L. J. Agric. Food Chem. 1991, 39, 2−11. (20) Pirt, S. J.; Whelan, W. J. J. Sci. Food Agric. 1951, 2, 224−228. (21) Thiex, N. J.; Manson, H.; Anderson, S.; Persson, J.-Å. J. AOAC Int. 2002, 85, 309−317. (22) Xiao, Y.; Fang, Y.; Jin, Y.; Zhang, G.; Zhao, H. Ind. Crops Prod. 2013, 48, 183−190. (23) Viles, F. J.; Silverman, L. Anal. Chem. 1949, 21, 950−953. (24) Hansen, J.; Møller, I. Anal. Biochem. 1975, 68, 87−94. (25) Black, H. Anal. Chem. 1951, 23, 1792−1795. (26) Iiyama, K.; Wallis, A. F. J. Sci. Food Agric. 1990, 51, 145−161. (27) Iiyama, K.; Wallis, A. F. A. Wood Sci. Technol. 1988, 22, 271− 280. (28) Gu, Y.; Hu, S.; Chen, J.; Shao, L.; He, H.; Yang, Y.; Yang, S.; Jiang, W. J. Ind. Microbiol Biotechnol. 2009, 36, 1225−1232. (29) Körner, S.; Vermaat, J. E. Water Res. 1998, 32, 3651−3661. (30) Fasakin, E. A. Bioresour. Technol. 1999, 69, 185−187. (31) Fasakin, E. A.; Balogun, A. M.; Fasuru, B. E. Aquacult. Res. 1999, 30, 313−318. (32) Rusoff, L. L.; Blakeney, E. W., Jr.; Culley, D. D., Jr. J. Agric. Food Chem. 1980, 28, 848−850. (33) Bahl, H.; Andersch, W.; Braun, K.; Gottschalk, G. Eur. J. Appl. Microbiol. Biotechnol. 1982, 14, 17−20. (34) Monot, F.; Engasser, J.-M.; Petitdemange, H. Appl. Microbiol. Biotechnol. 1984, 19, 422−426. (35) Lepage, C.; Fayolle, F.; Hermann, M.; Vandecasteele, J. P. Microbiology 1987, 133, 103−110. (36) Girbal, L.; Vasconcelos, I.; Saint-Amans, S.; Soucaille, P. FEMS Microbiol. Rev. 1995, 16, 151−162. (37) Park, D. H.; Laivenieks, M.; Guettler, M. V.; Jain, M. K.; Zeikus, J. G. Appl. Environ. Microbiol. 1999, 65, 2912−2917. (38) Guerrini, O.; Burlat, B.; Léger, C.; Guigliarelli, B.; Soucaille, P.; Girbal, L. Curr. Microbiol. 2008, 56, 261−267. (39) Ford, T. E.; Searson, P. C.; Harris, T.; Mitchell, R. J. Electrochem. Soc. 1990, 137, 1175−1179. (40) Grethlein, A. J.; Soni, B. K.; Worden, R. M.; Jain, M. K. Appl. Biochem. Biotechnol. 1992, 34−35, 233−246. (41) Lone, M.; He, Z.-l.; Stoffella, P.; Yang, X.-e. J. Zhejiang Univ., Sci., B 2008, 9, 210−220. (42) Hou, W.; Chen, X.; Song, G.; Wang, Q.; Chi Chang, C. Plant Physiol. Bioch. 2007, 45, 62−69. (43) Croux, C.; Canard, B.; Goma, G.; Soucaille, P. Microbiology 1992, 138, 861−869. (44) Westhuizen, A. V. D.; Jones, D. T.; Woods, D. R. Appl. Environ. Microbiol. 1982, 44, 1277−1281. (45) Zhou, X.; Traxler, R. Appl. Microbiol. Biotechnol. 1992, 37, 293− 297. (46) Lépiz-Aguilar, L.; Rodríguez-Rodríguez, C.; Arias, M.; Lutz, G.; Ulate, W. World J. Microbiol. Biotechnol. 2011, 27, 1933−1939. (47) Ezeji, T.; Qureshi, N.; Blaschek, H. P. Biotechnol. Bioeng. 2007, 97, 1460−1469. (48) Qureshi, N.; Saha, B. C.; Hector, R. E.; Cotta, M. A. Biomass Bioenergy 2008, 32, 1353−1358. (49) Zhang, Y.; Han, B.; Ezeji, T. C. New Biotechnol. 2012, 29, 345− 351. (50) Xu, J.; Zhao, H.; Stomp, A.-M.; Cheng, J. J. Biofuels 2012, 3, 589−601. (51) Xu, J.; Cui, W.; Cheng, J. J.; Stomp, A.-M. Biosyst. Eng. 2011, 110, 67−72.

3216

dx.doi.org/10.1021/ef500335h | Energy Fuels 2014, 28, 3206−3216