Validation of A Fully Integrated Microfluidic Array Device for Influenza

Jun 15, 2006 - and a microfluidic cartridge that automates the fluidic handling steps required to carry out a genotyping assay for pathogen identifica...
0 downloads 0 Views 744KB Size
Download PDF
Anal. Chem. 2006, 78, 4184-4193

Validation of A Fully Integrated Microfluidic Array Device for Influenza A Subtype Identification and Sequencing Robin Hui Liu,* Michael J. Lodes, Tai Nguyen, Tony Siuda, Mike Slota, H. Sho Fuji, and Andy McShea

CombiMatrix Corp., 6500 Harbor Heights Parkway, Mukilteo, Washington 98275

Rapid detection and identification of influenza virus is becoming increasingly important in the face of concerns over an influenza pandemic. A fully integrated and selfcontained microfluidic device has been developed to rapidly identify influenza A hemagglutinin and neuraminidase subtypes and sequence portions of both genes. The device consists of a DNA microarray with 12 000 features and a microfluidic cartridge that automates the fluidic handling steps required to carry out a genotyping assay for pathogen identification and sequencing. The fully integrated microfluidic device consists of microfluidic pumps, mixers, valves, fluid channels, reagent storage chambers, and DNA microarray silicon chip. Microarray hybridization and subsequent fluidic handling and reactions were performed in this fully automated and miniature device before fluorescent image scanning of the microarray chip. A micromixing technique based on gas bubbling generated by electrochemical micropumps was developed. Low-cost check valves were implemented in the cartridge to prevent cross talk of the stored reagents. The genotyping results showed that the device identified influenza A hemagglutinin and neuraminidase subtypes and sequenced portions of both genes, demonstrating the potential of integrated microfluidic and microarray technology for multiple virus detection. The device provides a cost-effective solution to eliminate labor-intensive and time-consuming fluidic handling steps and allows the detection and identification of influenza virus in a rapid and automated fashion. Timely acquisition of information on the influenza A subtypes that are circulating in human and animal populations is crucial for the global surveillance program to effectively monitor disease outbreaks.1 Knowledge of the exact strain, origin of the strain, and probable characteristics of the virus is essential for surveillance of a disease outbreak and preventing the spread of the disease. Identification of a virus subtype can be realized by molecular identification of the subtype of viral hemagglutinin (HA) and neuraminidase (NA) genes. Viruses with any combination of the 16 HA and 9 NA subtypes can infect aquatic birds while few * To whom correspondence should be addressed. E-mail: rliu@ combimatrix.com. (1) Hay, A.; Gregory, V.; Douglas, A. R.; Lin, Y. P. Philos. Trans. R. Soc. London 2001, B356, 1861-1870.

4184 Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

subtypes have been found to infect humans.2 However, interspecies transmission can occur after recombination or mixing of subtypes in birds or pigs.3-5 In addition, new human strains of virus can arise by reassortment or antigenic shifts when two or more subtypes are circulating in the human population.6,7 Maintenance of a subtype in the human population can also occur by antigenic drift,7 which occurs when genetic mutations of the HA and NA genes create virons that escape immune surveillance. These mutations arise as a result of viral polymerase infidelity. Therefore, in addition to identification of the circulating subtype, specific knowledge of the genetic makeup of the virus is required in many situations. For example, the avian H5N1 virus (“bird flu”) has significant potential for further recombination with common human strains (such as H3N2) or other nonhuman strains common in avian populations (H7 and H9 strains). The H5N1 subtype is also difficult to identify because of the lack of sensitivity and specificity of many of the commercial tests, such as viral detection (cell culture) and serological techniques.8-10 In addition, genotype Z, the dominant H5N1 virus genotype, contains a mutation that is associated with resistance to amantadine and rimantadine. Because of the high susceptibility in humans and resistance to antivirals of this isolate, neuraminidase inhibitors must be given within 48 h of onset of illness to be effective. Thus, rapid and specific identification of this subtype and accurate sequence information are crucial for proper treatment. Rapid subtype identification of flu is not always straightforward. Simple serological tests on infected individuals are an ineffective tool for monitoring viruses undergoing a high rate of mutation or rapid recombination. Reverse transcription-polymerase chain reaction (RT-PCR) assays have better sensitivity but are problematic (2) Fouchier, R. A.; Munster, V.; Wallensten, A.; Bestebroer, T. M.; Herfst, S.; Smith, D.; Rimmelzwaan, G. F.; Olsen, B.; Osterhaus, A. D. J. Virol. 2005, 79, 2814-2822. (3) Hoffmann, E.; Stech, J.; Guan, Y.; Webster, R. G.; Perez, D. R. Arch. Virol. 2001, 146, 1-15. (4) Lipatov, A. S.; Govorkova, E. A.; Webby, R. J.; Ozaki, H.; Peiris, M.; Guan, Y.; Poon, L.; Webster, R. G. J. Virol. 2004, 78, 8951-8959. (5) Scholtissek, C.; Burger, H.; Kistner, O.; Shortridge, K. F. Virology 1985, 147, 287-294. (6) Mizuta, K.; Katsushima, N.; Ito, S.; Sanjoh, K.; Murata, T.; Abiko, C.; Murayama, S. Microbiol. Immunol. 2003, 47, 359-361. (7) Webby, R. J.; Webster, R. G. Philos. Trans. R. Soc. London 2001, B356, 1815-1826. (8) Allwinn, R.; Preiser, W.; Rabenau, H.; Buxboum, S.; Sturmer, M.; Doerr, H. W. Med. Microbiol. Immunol. (Berl) 2002, 191 (3-4), 157-160. (9) Amano, Y.; Cheng, Q. Anal. Bioanal. Chem. 2005, 381 (1), 156-184. (10) Ueda, M.; Maeda, A.; Nakagawa, N.; Kase, T.; Kubota, R.; Takakura, H.; Ohshima, A.; Okuno, Y. J. Clin. Microbiol. 1998, 36 (2), 340-344. 10.1021/ac060450v CCC: $33.50

© 2006 American Chemical Society Published on Web 04/27/2006

in scenarios where new strains of virus emerge or mixtures of viruses exist. Because of their sensitivity, specificity, and accuracy, DNA microarrays have become an acceptable technology for screening samples for the presence or absence of a large variety of viruses simultaneously and identifying the genotype of an unknown specimen.11-14 Microarrays are particularly useful for molecular detection and identification of influenza viruses because of their genetic and host diversity and the availability of an extensive sequence database.13-15 Microarrays that contain several thousand different DNA sequences (probes) can theoretically identify several thousand different organisms. However, traditional microarrays using standard thermal hybridization have a few issues: 16 such as suboptimal hybridization conditions for all probes; mismatches that are difficult to detect (G-G or G-T, for example); or mismatches that reside in a context (GC-rich) that makes detection problematic. To overcome the difficulties associated with traditional microarray thermal techniques, we have recently developed an oligonucleotide microarray technology that combines the sensitivity and specificity of enzymatic reactions with a cost-effective strategy of using a labeled common oligonucleotide that is extended to the site of the match/mismatch.16 The oligonucleotide microarray was manufactured using a semiconductor-based in situ synthesis technology. The oligonucleotides were synthesized on an array of electrodes on a semiconductor chip using phosphoramidite chemistry under electrochemical control. The electrochemical reaction activated at specific electrodes on the chip generated protons, which in turn removed the blocking group in a membrane coated on the electrodes, allowing subsequent DNA synthesis to take place.17,18 The flu sequencing assay used an onchip enzymatic method of DNA synthesis and ligation where mismatch discrimination is achieved at the enzymatic step. This ligation reaction occurs only for perfect matches between the probes on the chip and the target DNA with an incorporated tag and labeled primer. Sequences with mismatches are not ligated and the label is washed away, leaving signal only for perfect matches. The influenza subtyping assay utilized standard hybridization conditions and biotin-labeled single-stranded target DNA. This semiconductor-based microarray chip detected and accurately typed flu strains with hemagglutinin subtypes 1-15 and neuraminidase subtypes 1-9 using a protocol that required less than 4 h from start to finish.16 In addition to providing very high resolution information on the genotype of any given flu strain, the microarray chip also provided information on novel strains of flu produced by rapid mutation or recombination between multiple strains of flu. This microarray chip can be employed as an adjunct (11) Ellis, J. S.; Zambon, M. C. Rev. Med. Virol. 2002, 12 (6), 375-389. (12) Ivshina, A. V.; Vodeiko, G. M.; Kuznetsov, V. A.; Volokhov, D.; Taffs, R.; Chizhikov, V. I.; Levandowski, R. A.; Chumakov, K. M. J. Clin. Microbiol. 2004, 42 (12), 5793-5801. (13) Kessler, N.; Ferraris, O.; Palmer, K.; Marsh, W.; Steel, A. J. Clin. Microbiol. 2004, 42 (5), 2173-2185. (14) Li, J.; Chen, S.; Evans, D. H. J. Clin. Microbiol. 2001, 39 (2), 696-704. (15) Sengupta, S.; Onodera, K.; Lai, A.; Melcher, U. J. Clin. Microbiol. 2003, 41 (10), 4542-4550. (16) Lodes, M. J.; Suciu, D.; Elliott, M.; Stover, A. G.; Ross, M.; Caraballo, M.; Dix, K.; Crye, J.; Webby, R. J.; Lyon, W. J.; Danley, D. L.; McShea, A. J. Clin. Microbiol. 2006, 44, 1209-1218. (17) Dill, K.; Montgomery, D. D.; Ghindilis, A. L.; Schwarzkopf, K. R. J. Biochem. Biophys. Methods 2004, 59, 181-187. (18) Oleinikov, A. V.; Gray, M. D.; Zhao, J.; Montgomery, D. D.; Ghindilis, A. L.; Dill, K. J. Proteome Res. 2003, 2, 313.

to existing technology: to type difficult or ambiguous samples of flu, provide greatly increased confidence in RT-PCR assays, or study genetic drift in a flu virus as it moves through a population. To simplify the assay procedure for running the influenza assays, we have developed a microfluidic platform to integrate microfluidic lab-on-a-chip technology with microarrays for rapid and automated identification and sequencing of influenza virus. The fully integrated microfluidic device automated the entire hybridization and posthybridization process that involves multistage fluidic handling (such as primer extension, ligation reactions, and washing), which are generally labor-intensive and timeconsuming using conventional manual handling methods. Processing microarrays typically employs a conglomeration of dishes, hot plates, thermometers, and water baths. The processes involve many manual steps (handling arrays, moving, agitating racks, etc.), which are carried out in laboratories with dedicated equipment by professionally trained personnel. Robotic workstations have been developed to automate the whole hybridization and posthybridization process but such benchtop instruments are bulky, delicate, and expensive for most in-field detection or clinical diagnostic applications. It is therefore desirable to develop a costeffective method to integrate and automate the microarray processing in a single and miniature device using microfluidic technology. We have previously reported a self-contained and fully integrated microfluidic device for gene expression analysis.19 In this paper, we report on a modified and optimized microfluidic device that automated hybridization and posthybridization processes for rapid and automated identification and sequencing of influenza virus. The device consists of a CombiMatrix influenza microarray slide and a microfluidic plastic cartridge. The description of a unique sequencing assay technique is included. The integrated device design, fluidics, and developments of the key microfluidic components, such as mixers and valves, are described. Genotyping experiment results for identification and sequencing of influenza A hemagglutinin and neuraminidase subtypes are presented. EXPERIMENTAL SECTION DNA Microarray. The integrated microfluidic device (Figure 1) consists of a CombiMatrix microarray slide and a microfluidic plastic cartridge. The microarray slide is a 1 in. × 3 in. alumina slide with an 11 × 25 mm silicon chip affixed in a cavity in the ceramic package. The silicon chip is an integrated circuit manufactured using a commercial mixed signal complementary metal oxide semiconductor process.17,18 The microarray chip used in this work has 12 544 electrodes, each with a size of 44 µm in diameter. The CombiMatrix microarray technology platform allows the manufacture of oligonucleotide arrays using electrochemical control. Utilization of active circuit elements in the design permits the selection and parallel activation of individual electrodes in the array to perform in situ oligonucleotide synthesis of customized content on the chip. Using this in situ synthesis method, unique oligomers of 35-40 bases were synthesized at each electrode. The design of the subtyping array probes was based on the viral sequence data obtained from the GenBank database and from (19) Liu, R. H.; Nguyen, T.; Schwarzkopf, K.; Fuji, H. S.; Petrova, A.; Siuda, T.; Peyvan, K.; Bizak, M.; Danley, D.; McShea, A. Anal. Chem. 2006, 78, 19801986.

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

4185

Figure 1. (A) Schematic of the microfluidic array device that consists of five electrochemical micropumps (on the top row), six duckbill check valves, five chambers for the storage of different buffers and reagents (i.e., storage 1-5), an array chamber, and a waste chamber. Each storage chamber has two loading ports: one is used to load solution while the other one is used to vent out the gas during the loading. Note that the hydrophobic membrane vent to seal the venting hole of the waste chamber is not shown here. (B) Photograph of the integrated device that consists of a plastic fluidic cartridge and a CombiMatrix CustomArray chip.

the Influenza Sequence Database (ISD).20 For HA serotypes, 1614 animal and 1937 human isolates were selected; and for NA serotypes, 552 human and 831 animal isolates were selected. Both data sets were treated in the same way following a modification of the method of Wang et al., where probe uniqueness was based on subtype differences.21 For each sequence, nonoverlapping appended primers were made, tiling the entire sequence. These oligonucleotides were designed to have similar annealing stability as judged by a nearest-neighbor thermodynamic model22 and were designed to have a Tm of 50 °C. Probes that had significant secondary structure (Tm > 40 °C) were taken out of the set. Finally, probes from only the first 500 bp of sequence were used (bp 50-500). After tiling and culling, there were 23 568 HA probes and 15 191 NA probes left. Each sequence and probe was grouped and labeled by its serotype, and databases were generated from the compiled sequences of HA and NA isolates. Probes were selected to be exclusive to a given subtype as judged by pairwise BLASTN.23 The details of probe sequences and the number of probes selected for each subtype are described by Lodes et al.16 A poly T10 spacer was added to the 3′ end of all probes to avoid surface inhibition. Probe design files for array synthesis were generated with Layout Designer (CombiMatrix Corp., Mukilteo, (20) Macken, C.; Lu, H.; Goodman, J.; Boykin, L. In Options for the Control of Influenza IV; A. D. M. E. Osterhaus, Hampton, A. W., Cox, N., Eds.; Elsevier Science: Amsterdam, 2001; pp 103-106. (21) Wang, D.; Urisman, A.; Liu, Y.-T.; Springer, M.; Ksiazek, T. G.; Erdman, D. D.; Mardis, E. R.; Hickenbotham, M.; Magrini, V.; Eldred, J.; Latreille, J. P.; Wilson, R. K.; Ganem, D.; DeRisi, J. L. PLoS Biol. 2003, 1 (2), 257-260. (22) Peyret, N.; Seneviratne, P. A.; Allawi, H. T.; SantaLucia, J., Jr. Biochemistry 1999, 38, 3468-3477. (23) Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D. J. Nucleic Acids Res. 1997, 25, 3389-3402.

4186

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

WA). Oligonucleotide microarrays were synthesized on semiconductor microchips containing over 12 000 independently addressable electrodes. After the in situ synthesis of microarray, the oligonucleotide probes on the chip were phosphorylated with T4 polynucleotide kinase for 30 min at 37 °C. The sequencing microarray chips were designed using sequences that were representative of each subtype of interest.16 For our experiments, we chose sequences that represent subtype H9N2 (GenBank accession numbers AF156378 and AF222654, respectively). Probes were tiled by one nucleotide to cover the sequences of interest and probes were designed with a Tm of ∼55 °C. Four probes were designed for each nucleotide to be examined that were identical except for the 5′-nucleotides, which contained either an A, C, T, or G (see Figure 2). The chips with this design were hybridized with both HA and NA gene targets prepared from influenza A isolates from infected quail and chicken (A/Quail/ Hong Kong/G1/97 (H9N2) and A/Chicken/Hong Kong/NT17/ 99 (H9N2). Microfluidic Cartridge. The plastic cartridge design is an advanced version of the cartridge we previously developed.19 The new cartridge consisted of six microvalves, five micropumps, five chambers for the storage of different buffers and reagents, an array chamber, and a waste chamber, as shown in Figure 1. The micropumps relied on electrolysis of water between two stainless steel electrodes in an electrolyte solution (1 M Na2SO4) to generate gases when a dc current was applied.19 The generated gas (H2 and O2) was used to move liquid solutions from chamber to chamber in the device. The micropumps also served as an actuation source for micromixing in the array chamber. The operation of the microfluidic device is as follows. A sample solution

Figure 2. (a) Diagram of the strategy for microarray DNA sequencing. Four target-specific (antisense) probes, for each base of sequence, are identical except for the 5′ terminal residue (terminate in bases A, C, G, and T). After hybridization of probes and target DNA, annealed Cy3labeled primer, a mixture of enzymes, buffer, and dNTPs were added to the array and incubated for 30 min at 37 °C. The labeled primer (orange) was extended to matching probes and probes that are a perfect match to the target (blue) were ligated while mismatches (red) are not. The array was finally washed with 0.1 N NaOH and scanned for fluorescence. (b) Diagram of the strategy for enzyme-based microarray sequencing. Sequencing probes as described above were hybridized with single-strand target that contains a 3′ tag sequence and a labeled oligonucleotide that is complementary to the tag. After washing, an enzyme mix that contains Amplitaq polymerase Stoffel fragment and E. coli DNA ligase was added to the annealed complex. The labeled primer was extended on the target template to the probe. Ligation to the probe occurred when target and probe sequences match (1), and no ligation occurred when target and probe do not match (mismatch) (2). Stringent washing removed any signal that is not ligated to the probe.

was loaded in the array chamber using a pipet. Other solutions required for assays were separately loaded in different storage chambers. For subtyping assays, these solutions included four washing buffer solutions and a labeling solution. For sequencing assays, the solutions included a ligase buffer, an enzyme solution containing T4 DNA ligase and Taq polymerase, a NaOH solution, and a wash buffer solution. After sealing the loading ports using a sealing tape (Adhesive Research Inc., Glen Rock, PA), the device was then inserted into an instrument, which provided hybridization heating, temperature sensing, and electrical power for liquid pumping and mixing. The instrument is measured 140 × 200 × 200 mm. It consists of a clamping manifold, a printed circuit board, and a power supply. The microfluidic device was inserted into the manifold where a thin-film heating element (Minco Corp., Minneapolis, MN) was pressed on the microarray slide of the device to provide the heating of the array chamber during the hybridization process. The thin-film heating element consists of a temperature sensor that provided the temperature feedback to the control circuit board. A flexible cable connector was used to

connect the circuit board with the electrical pins for the electrochemical pumps in the cartridge. The board provides electronic control of the hybridization heating, temperature sensing, and electrical power for liquid pumping and mixing. For the subtyping assay, the on-chip process started with a 1-h biotinylated target hybridization step in the microarray hybridization chamber at 45 °C, followed by a three-step on-chip washing process. During the washing process, the nonstringent 6× saline-sodium phosphate-EDTA-Tween 20 (SSPET) washing buffer was first pumped through the hybridization chamber, removing the sample mixture into the waste chamber and washing the array chip. The stringent 3× SSPET washing buffer, followed by the 2× phosphate-buffered saline-Tween (PBST) buffer, was subsequently pumped through the hybridization chamber to ensure a thorough washing and removal of nonspecific binding. After the on-chip washing steps, the labeling solution, containing streptavidin-Cy5 in 2× PBS, 0.1% Tween-20, and 1% acetylated BSA, was pumped into the hybridization chamber followed by a 30-min incubation at room temperature. Once the labeling was Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

4187

completed, the 2× PBST buffer was pumped through the hybridization chamber to ensure a thorough washing and removal of residual labeling reagents. The device was then removed from the instrument. The microarray chip was detached from the microfluidic plastic cartridge before it was scanned using a commercial fluorescent scanner. The on-chip sequencing assay process started with a 1-h hybridization step in the array chamber at 45 °C. Following the hybridization process, the ligase buffer mixture was first pumped through the array chamber, removing the sample mixture into the waste chamber and washing the array. The pumping was performed using an integrated electrochemical micropump that operated with a dc voltage of 4 V. The enzyme solution was subsequently pumped through the array chamber followed by a 30-min incubation at 37 °C. Once the ligation and extension were completed, the 0.1 N NaOH solution was pumped through the array chamber to denature any unligated probe-target complexes and remove background signal. The 2× PBST buffer was subsequently pumped through the array chamber to ensure a thorough washing. The microarray chip was then detached from the microfluidic plastic cartridge before it was scanned. The fluorescent hybridization signals corresponding to the sequence information of the biological sample were detected on the chip and analyzed. The plastic cartridge measures 40 × 76 × 10 mm and has channels and chambers that range from 500 µm to 3.2 mm in depth and 0.5 to 8.5 mm in width. The prototype of the plastic cartridge consists of multiple layers of acrylic materials that were fabricated using a CO2 laser (Universal Laser Systems, Scottsdale, AZ) and assembled using double-sided adhesive tape.19 The thicknesses of the five layers of acrylic sheets (MacMaster-Carr, Atlanta, GA) ranges from 0.5 to 5.7 mm. The 5.7-mm-thick acrylic layer has valve seats containing six duckbill check valves (Vernay Laboratories Inc., Yellow Springs, OH). The assembly of the device and formation of the electrochemical pumps have been previously described.19 Stainless steel pins with 0.5-mm diameter were used as electrodes for the electrochemical pumps. Each electrochemical pumping chamber was loaded with 50 µL of 1 M Na2SO4 solution to form an electrochemical pump. The venting hole of the waste chamber was sealed with a hydrophobic membrane vent (Sealing Devices, Lancaster, NY) that allowed gas molecules to pass through while the liquid solution was retained in the waste chamber. The plastic cartridge was then bonded with the microarray chip using a 0.6-mm-thick double-sided adhesive tape (Adhesive Research Inc., Glen Rock, PA) that was machined with a pattern of the hybridization chamber using the CO2 laser. Influenza Virus Subtyping and Sequencing Assays. The influenza virus subtype reference samples were prepared as follows. The influenza viruses were isolated using Madin-Darby canine kidney (MDCK) cells supplemented with 1 µg/mL L-(tosylamido-2-phenyl)ethyl chloromethyl ketone-treated trypsin. The samples were first added to monolayers of MDCK cells and incubated for 1 h at 37 °C to allow viral adsorption to the cells. The inoculum was decanted, Eagle’s minimum essential medium supplemented with 0.2% bovine serum albumin was added, and monolayers were incubated for 3-5 days at 37 °C. After cytopathic effects appeared, influenza virus was confirmed by using hemagglutination of chicken erythrocytes and RT-PCR against the HA 4188

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

gene. A panel of reference influenza A virus RNA samples for 15 HA and 9 NA subtypes was developed by conducting hemagglutination inhibition assays with a panel of reference antisera against HA subtypes 1-15 and NA subtypes 1-9. Reference virus sequences were confirmed for each HA and NA subtype. Viral RNA was extracted from supernatants of cultures of infected cells by using the RNeasy Mini Kit (Qiagen, Chatsworth, CA) according to the manufacturer’s instructions. Reverse transcription and PCR amplification were carried out under standard conditions by using influenza-specific primers. PCR products were purified with QIAquick PCR purification kits (Qiagen, Chatsworth, CA), and sequencing reactions were performed at the Hartwell Center for Bioinformatics and Biotechnology at St. Jude Children’s Research Hospital (Memphis, TN). The target for both subtyping and sequencing studies is a 500600-bp amplicon that contains the 5′ end of either the HA or the NA gene and was amplified from first-strand cDNA. First-strand cDNA was produced from influenza virus RNA (5-20 ng/µL) with SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) and a tagged universal primer, TAATACGACTCACTATAGGAGCAAAAGCAGG (tag sequence is underlined and universal influenza sequence is in boldface type). Amplifications were accomplished with a 10 µM forward tag primer [GCATCCTAATACGACTCACTATAGG] and specific reverse primer and 2-5 µL of first-strand cDNA per 100-µL reaction.16 The reaction conditions consisted of a 5-min denaturation at 94 °C, followed by 40 cycles of a 30-s 94 °C denaturation step, a 30-s 55 °C annealing step, and a 30-s 72 °C extension, and finally a 10-min extension at 72 °C. The resulting PCR product was cleaned with a Qiagen QIAquick PCR purification kit and eluted in 100 µL of distilled water. A second, one-way amplification resulted in a single-stranded target. One-way amplifications were accomplished with the respective specific reverse primer only and 2-5 µL of cleaned amplification product from the first amplification. The reaction conditions were similar to those described above with 50 cycles of amplification. The resulting product was purified with a Qiagen QIAquick PCR purification kit and eluted in 100 µL of distilled water. This step resulted in tagged, single-stranded target for hybridization in sequencing assays. For subtyping assays, biotinylated singlestrand target for standard hybridizations was produced as described above for one-way PCR; however, biotin-14-dCTP (Invitrogen) was incorporated into the product during amplification. Prior to hybridization, the single-stranded target was heated to 95 °C for 10 min and then placed on ice. Ten× T4 ligase buffer was then added to bring the solution to 1× concentration, and finally, a 5′-labeled T7 oligonucleotide (Cy-3 or Cy-5; Integrated DNA Technologies, Inc., Coralville, IA) was added to a concentration of 1 µM. During the on-chip sequencing assay, 95 µL of the hybridization sample solution was loaded into the array chamber in the cartridge. Other solutions include the following: (1) 200 µL of 1 × Escherichia coli ligase buffer; (2) 200 µL of a mixture containing 155 µL of dH2O, 18 µL of 10× E. coli ligase buffer, 3 µL of 10 mM dNTP, 2 µL (20 units) of AmpliTaq DNA polymerase, Stoffel fragment (Applied Biosystems, Foster City, CA), and 2 µL (20 units) of E. coli ligase; (3) 200 µL of 0.1 N NaOH buffer; (4) 200 µL of 2× PBS, 0.1% Tween-20, were separately loaded in the storage chambers 1-4 (Figure 1A). The fifth storage chamber

was left empty in the device. Hybridization was carried out for 1 h at 45 °C. Following the hybridization process, the ligase buffer solution was first pumped through the array chamber, removing the sample mixture into the waste chamber and washing the array. The DNA ligase/polymerase mixture was subsequently pumped through the array chamber followed by a 30-min incubation at 37 °C. Once the extension and ligation were completed, the 0.1 N NaOH buffer was pumped through the array chamber at room temperature to denature and wash the array. The 2× PBST buffer was subsequently pumped through the array chamber to ensure a thorough washing. During each pumping step, a bubbling mixing procedure as described in the following section was implemented. The total on-chip processing time is ∼1 h, 45 min. The device was then removed from the instrument. The microarray chip was separated from the microfluidic plastic cartridge with the use of a razor blade before it was scanned using a commercial fluorescent scanner (GenePix 4000B, Molecular Devices, Sunnyvale, CA). Imaging was performed while the array was wet with 2× PBST under a LifterSlip glass coverslip (Erie Scientific, Portsmouth, NH). Image intensities were analyzed and quantified using Microarray Imager software (CombiMatrix Corp.). HA and NA subtype DNA sequence information was generated from sequencing array intensity data with a Microsoft Excel routine designed to interrogate units of four data points and then associate the most intense signal with the nucleotide represented by that probe. Sequence strings were then used to search the GenBank nonredundant database with BLASTN. For the subtyping assay, 95 µL of the hybridization sample solution was loaded into the array chamber in the cartridge. Other solutions including, (1) 200 µL of 6× SSPE, 0.05% Tween-20; (2) 200 µL of 3× SSPE, 0.05% Tween-20; (3) 200 µL of 2× PBST, 0.1% Tween-20; (4) 200 µL of a labeling solution; and (5) 200 µL of 2× PBS, 0.1% Tween-20, were separately loaded in the storage chambers 1-5 (Figure 1A). The labeling solution contains streptavidin-Cy5 (Molecular Probes, Eugene, OR) that was diluted in a blocking solution (2× PBS, 0.1% Tween-20, 1% acetylated BSA) to a final concentration of 1 µg/mL. Hybridization was carried out for 1 h at 45 °C in the microarray chamber. Following hybridization, the array was washed with 6× SSPE, 0.05% Tween-20. On-chip washings continued with 3× SSPE, 0.05% Tween-20 and 2× PBS, 0.1% Tween-20, respectively. The labeling solution was then pumped into the hybridization chamber and incubated for 30 min at room temperature. The final washing step was performed by flowing 2× PBST through the hybridization chamber. During each pumping step, a bubbling mixing procedure was implemented. The microarray chip was then detached from the microfluidic plastic cartridge before it was scanned. The total on-chip processing time is ∼1 h, 50 min. Subtype identification was accomplished by averaging HA and NA subtype intensity values and graphing in Microsoft Excel. Controls for monitoring subtyping and sequencing cartridge efficiency were performed with the same protocols; however, conventional hybridization chambers that have no integrated microfluidic components were used. All of the fluidic handling and processes were carried out manually using pipets. For manual processing, each fluidic handling step started with emptying the hybridization chamber using a pipet followed by loading a fresh solution into the chamber using another pipet. The hybridization

and DNA extension/ligation steps were performed in an oven for 1 h at 45 °C and 30 min at 37 °C, respectively. The total control processing times for both subtyping and sequencing assay are ∼2 h each. RESULTS AND DISCUSSION Microfluidics. All of the microfluidic components described here, including micropumps, microvalves, and micromixers, were designed to be simple, low-cost, and easy to fabricate and integrate into the plastic cartridge, resulting in a cost-effective, manufacturable, and disposable device. Previously, valves were eliminated from the design in order to simplify the cartridge design and fabrication.19 Liquid solutions were retained in their storage chambers by the use of surface tension. Prevention of liquid cross talk relied on the air plugs in the microchannels between two adjacent chambers. Subsequently, we found that it is necessary to incorporate microvalves in the cartridge to ensure robustness of the design and efficient isolation of liquid solutions in their storage chambers. Moreover, a normally closed valve between the array chamber and waste chamber could prevent evaporation of the hybridization solution during the 1-h hybridization process at 45 °C, which would otherwise result in reduction of the hybridization solution and an increase in the salt concentration of the hybridization solution that would in turn lead to increased nonspecific adhesion of DNA to the array and loss of hybridization stringency. In the new design reported here, six commercially available duckbill check valves (VA 3426, Vernay Laboratory Inc.) were integrated. The duckbill is a precision, one-piece elastomeric check valve that allows flow in one direction and checks flow in the opposite direction. These normally closed check valves are made of silicone and could be easily glued on the valve seats in the cartridge using epoxy. Once the upstream pumping pressure exceeded the cracking pressure of the valves, the valves were open. The implementation of these check valves did not require a microfabrication process, and their operation required no actuation. As a result, they are less expensive and easier to integrate and operate than most conventional microvalves.24-27 Integrated electrochemical micropumps were used to move liquid solutions in the cartridge.19 The pumps rely on electrolysis of water between two stainless steel electrodes in an electrolyte solution (1 M Na2SO4) to generate gases (H2 and O2) when a dc voltage of 4 V was applied. Gas generated from the electrochemical pumps moved liquid solutions from chamber to chamber in the device. The pumping rate was 100 µL/min. The pumps were also excellent sources to provide gas bubbles to enhance micromixing in the array chamber during the washing and reaction steps. Note that the cartridge was placed vertically during operation in order to take advantage of the fluid gravity and address the fluidic issues due to the presence of the air bubble. For example, air bubbles, which remained in the reagent storage chambers after reagent loading, stayed in the upper portion of the chambers. These air bubbles merged with the pumping gas generated by the electrochemical pumps during the pumping process to move the reagent (24) Beebe, D. J.; Moore, J. S.; Bauer, J. M.; Yu, Q.; Liu, R. H.; Devadoss, C.; Jo, B.-H. Nature 2000, 404, 588-590. (25) Liu, R. H.; Yu, Q.; Beebe, D. J. J. Microelectromechan. Syst. 2002, 11, 4553. (26) Jerman, H. J. Micromech. Microeng. 1994, 4, 210-216. (27) Ray, C. A.; Sloan, C. L.; Johnson, A. D.; Busch, J. D.; Petty, B. R. Proc. Mater. Rese. Soc. Symp. 1992, 276, 161-166.

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

4189

Figure 3. (A) Photograph showing the microfluidic device where no bubbling mixing was implemented in the hybridization chamber. A laminar flow was observed when a green-dyed washing buffer entered into the hybridization chamber (that was filled with a yellow dyed solution) from the lower portion. (B)-(D) Snapshot images showing the bubbling mixing process in the hybridization chamber of a microfluidic array device that was placed vertically. A red dye was used to visualize the mixing effect. (B) The hybridization chamber was initially filled with DI water followed by injection of a small amount of red food dye at the lower portion of the chamber before the introduction of the bubble; (C) A gas bubble generated using an electrochemical micropump was directed through a microchannel and introduced into the hybridization chamber from the lower portion of the chamber. (D) When the gas bubble traveled to the upper portion of the chamber, flow recirculation was observed in the liquid solution around the bubble, resulting in a dye mixing enhancement in the chamber. Finally, the bubble escaped from the hybridization chamber into the channel that is connected to the waste chamber (note that the escaping process is not shown here).

solutions out of the storage chambers into the downstream sections. The fluid gravity was used to remove the air bubbles from the system without the use of porous hydrophobic vents.19 Since the array chamber was designed with a depth of 600 µm and a width of 6.5 mm and fluid volume was on the order of tens of microliters, the Reynolds number for the fluid flow was less than 10.28 Fluid flows at such a low Reynolds number were predominantly laminar, as shown in Figure 3A. As a result, mixing of materials between streams in the array chamber was confined to molecular diffusion. The rapid mixing produced by turbulent flows is not available because the Reynolds number is below the critical value for transition to turbulence.28 A diffusion-limited mixing process can be very inefficient and often takes a long time, (28) Liu, R. H.; Stremler, M.; Sharp, K. V.; Olsen, M. G.; Santiago, J. G.; Adrian, R. J.; Aref, H.; Beebe, D. J. J. Microelectromechan. Syst. 2000, 9(2), 190197.

4190

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

particularly when the solution streams contain macromolecules (e.g., proteins) that have diffusion coefficients orders of magnitude lower than that of most liquids. Since the residence time of fluid elements in the flow was smaller than the diffusion time, pure diffusion failed to provide homogeneous mixing of confluent reagent solutions in the array chamber. Therefore, an efficient micromixer was required to enhance micromixing in this device. We have developed a simple and easy-to-operate mixing technique that is based on the continuous bubbling effect. During the mixing steps, gas bubbles generated by the electrochemical micropump entered into the array chamber from the lower portion. Buoyant force allowed gas bubbles to travel quickly to the upper portion of the chamber. During this traveling process, the two-phase flow resulted in flow recirculation29 in the liquid solution around the (29) Anderson, R. C.; Su, X.; Bogdan, G. J.; Fenton, J. Nucleic Acids Res. 2000, 28, e60.

Figure 4. Influenza subtype analysis demonstrates the robustness of the microfluidic system. The correct influenza A hemagglutinin (H2) and neuraminidase (N7) subtypes were identified with this automated system with results equal to or better than standard manual techniques.

bubbles. As a result, the mixing was enhanced in the chamber. As shown in Figure 3B-D, fluidic experiments with dye solutions demonstrated the efficiency of the mixing enhancement using this bubbling effect. The fluidic experiment showed that the flow recirculation around the continuously pumped bubbles produced homogeneous solutions in the chamber and thus facilitated a uniform reaction on the array surface during the reaction process (e.g., ligation, extension, or labeling) or washing steps. The assay experiments with DNA hybridization described in the following sections showed high sensitivity, low background signals, and uniform hybridization signals on the microfluidic arrays, which suggested that on-chip microfluidic mixing was uniform and efficient and the bubbling mixing technique has a relatively low shear strain rate and is thus biofriendly to the hybridized DNA on the array. The use of gas bubbles to enhance mixing in the microfluidic chamber proved to be a simple but effective micromixing technique without the use of any external actuation methods such as acoustic agitation 30,31 or physical rotation. Subtyping Assay. The broad-scan microarray was designed to identify influenza A subtypes based on unique probe sets for HA subtypes 1-15 and NA subtypes 1-9. After hybridization of biotinylated H2- and N7-specific target and labeling with streptavidin-Cy5, high fluorescent signal intensity demonstrates that the subtype-specific target DNA annealed to the correct probes, as shown in Figure 4. By averaging subtype probe signal intensities and graphing the results, the correct influenza A subtypes were identified using the microfluidics device. In general, average positive probe signal was at least 4 times greater than average negative probe signal. Variable signal intensities from the negative probes are the result of cross hybridizations that are due to the close relationship among subtype sequences. Results using the microfluidics device were comparable to the manual control results (where the average signal intensities for H2 and N7 are 3400 and 2500, respectively, and the negative probe and background signals are below 600), suggesting that on-chip microfluidic washing and labeling are efficient and compatible with manual washing and labeling processes. Since there were no replicate probes in the current subtyping array, it is difficult to study the hybridization uniformity. The influenza A subtyping array used in this study (30) Liu, R. H.; Yang, J.; Lenigk, R.; Bonanno, J.; Grodzinski, P. Anal. Chem. 2004, 76, 1824-1832. (31) Liu, R. H.; Lenigk, R.; Yang, J.; Druyor-Sanchez, R.; Grodzinski, P. Anal. Chem. 2003, 75, 1911-1917.

has previously been shown to positively identify all 15 hemagglutinin and all 9 neuraminidase subtypes.16 Previous study with gene expression analysis in the microfluidic array devices showed high detection sensitivity (375 fM) and uniform hybridization signals, 19 further indicating that the on-chip fluidic handling (washing and reaction) is efficient and can be automated with no loss of performance. Sequencing Assay. In many cases, the identification of an influenza A subtype is not sufficient for making decisions on vaccine development, patient treatment, and general surveillance, and specific sequence is needed. For example, mutations in sequence coding for the hemagglutinin receptor binding site of subtype H5N1 have been shown to be important for replication of avian viruses in humans.32 In this study, viral HA and NA subtype sequencing was accomplished with a simple and rapid enzymatic assay in a microfluidics device. In the microfluidics device, a mixture including DNA polymerase and ligase extended a labeled common primer on single-stranded target DNA to the 5′ end of the hybridized HA and NA sequencing probes and then ligated the extended primer to probes that matched the target sequence (Figure 2). A 0.1 N NaOH wash, a stringent washing procedure, removed any unligated signal, and after scanning the array, intensity data were exported to an Excel worksheet. Sequence information was extracted with a routine designed to associate the correct base with the highest signal from sets of four probes that were tiled by one nucleotide to cover the sequence of interest (Figure 2b). The results of hemagglutinin (H9) and neuraminidase (N2) subtype sequencing in the microfluidic cartridge is shown in Figure 5. With such an array chip that has over 12 000 features, we were able to sequence over 500 nt, depending upon the length of the target DNA, of both the HA and NA genes with an accuracy of over 90%. In this study, the sequencing accuracies of the HA and NA genes using the microfluidic device are 91 and 94%, respectively, as compared to 95% for HA gene and 93% for NA gene using the conventional manual handling array (i.e., the control). The results indicated that the performance of the microfluidic array device was comparable to that of conventional manual handling. Inaccurate sequence calls were generally the result of difficulty to detect mismatches, such as A/G or T/G mismatches or secondary structure within the probe sequences. This artifact of the sequencing array can be resolved by including replicates of the sequencing probes. The average values will reduce signal from ligated mismatches and other artifacts on the chip. This approach to sequencing is rapid, requiring less than 2 h on chip to sequence a target. The integrated microfluidic array device automates genotyping and sequencing assays that involve multistage sample processing and fluidic handling that are in general labor-intensive and timeconsuming and have significant potential to be error prone.33 Automation of the hybridization and posthybridization process allows more stringent processing control over the microarrays and eliminates variations in array data caused by subtle, day-to(32) Iwatsuki-Horimoto, K.; Kanazawa, R.; Sugii, S.; Kawaoka, Y.; Horimoto, T. J. Gen. Virol. 2004, 85, 1001-1005. (33) Dobbin, K. K.; Beer, D. G.; Meyerson, M.; Yeatman, T. J.; Gerald, W. L.; Jacobson, J. W.; Conley, B.; Buetow, K. H.; Heiskanen, M.; Simon, R. M.; Minna, J. D.; Girard, L.; Misek, D. E.; Taylor, J. M.; Hanash, S.; Naoki, K.; Hayes, D. N.; Ladd-Acosta, C.; Enkemann, S. A.; Viale, A.; Giordano, T. J. Clin. Cancer Res. 2005, 11, 565-572.

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

4191

Figure 5. (A) Probe hybridization intensity values for hemagglutinin H9 and neuraminidase N2 sequencing using the automated cartridge. Although the entire sequences of the HA (∼1700 bp) and NA (∼1400 bp) genes were encoded on the array, the targets were synthesized from and hybridized to the 5′ 500 nucleotides of the genes as demonstrated by the hybridization patterns (underlined). After extraction of data, resulting sequences for the HA and NA genes were 91 and 94%, respectively, identical to the correct GenBank sequence data. (B) Sequence information is obtained by associating the DNA bases with the greatest signals from groups of four sequencing probes. An expanded section of the neuraminidase gene is shown here. DNA bases above the figure indicate the sequence at the 5′ end of probes and bases below the figure indicate the sequence extracted from the data.

day differences in protocol and manual handling.19 This selfcontained and fully integrated microfluidic array device is disposable and requires simple, low-cost, and portable instruments for operation, as compared to some bulky, expensive, and delicate commercial robotic workstations. The plastic microfluidic cartridges can be fabricated using injection molding (instead of laser machining reported here) that would lead to low-cost microfluidic devices. The cost of a microfluidic plastic cartridge component (estimated less than $10 for high-volume manufacturing) is small as compared to the cost of the microarray chip (on the order of hundreds of dollars). To reduce the overall cost of the device (primarily of the microarray chip) for diagnostic applications, we are currently developing different methods or technologies. For example, the array is currently being redesigned to have four identical subarray sectors so that four assays can be run on the same array chips. Moreover, the reuse of the array by stripping the hybridized DNA/RNA targets using chemicals before the next use is being explored. These strategies will reduce the per-assay costs so that the arrays are comparable in cost to other diagnostic technologies (e.g., real-time PCR). Furthermore, the fluorescent detection method used for the semiconductor-based microarrays reported in this work can be replaced with the electrochemical detection-based method. Using an electrochemical detector (cur4192

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

rently under development), we could further reduce the costs of equipment by eliminating the expensive optical scanning instrument. The integration of microfluidics adds new significant functionalities to the conventional microarray platform. Although sequencing and subtyping assays were demonstrated in this study, this integrated microfluidic platform can potentially be applied to many other assays. Although the sample and reagent consumption in the current microfluidic device design is tens to hundreds of microliters, it is believed that the design could be further miniaturized so that the sample and reagent consumption could be significantly reduced. It is also possible to integrate front-end sample preparation and DNA amplification into the same platform, which would lead to a fully integrated system with direct sampleto-answer capability.30 The microfluidic components in the device, including electrochemical pumps, duckbill check valves, and bubbling mixer, are simple in design, inexpensive, and easy to fabricate and integrate into a complex microfluidic system, as compared with most of the existing micropumps, microvalves, and micromixers. Because the power consumption of the electrochemical pumps is low (∼mW), hand-held field use of the integrated microfluidic components is feasible. The combination of integrated microfluidics

with the electrochemical detection-based microarray that is currently under development would allow one to identify influenza subtypes and sequence samples of interest rapidly and costeffectively. The readout will no longer be visual and rely on fluorescence that often suffers from photobleaching issues, but rather be electrochemical, relying on the intrinsic electronic functionality of the silicon integrated circuit chip. The electrochemical detection will be a key differentiation of the integrated microfluidic array device since the chip will no longer need to be removed from the microfluidic cartridge for fluorescent scanning. The analysis work flow will also be improved as the stitching or templating of the fluorescent image will not be required. The integrated microfluidic platform provides a step toward fulfilling the promise of rapid, automated genetic analysis from complex sample fluids in cost-effective and portable instruments. CONCLUSION A self-contained and disposable microfluidic array device for integrated sequencing and diagnostic assays has been developed. The device automated and integrated hybridization, sample processing, and fluidic handling steps that are considered labor-

intensive and time-consuming in a regular manual handling process. All microfluidic components such as micropumps, microvalves, and micromixers are integrated on the microfluidic cartridge, but use simple and inexpensive approaches in order to reduce device complexity. The genotyping results showed that the microfluidic array device identified influenza A hemagglutinin and neuraminidase subtypes and sequenced portions of both genes, demonstrating the potential of integrated microfluidic and microarray technology for multiple virus detection. ACKNOWLEDGMENT The authors thank Kia Peyvan, Dr. Dominic Suciu, Alla Petrova, Michael Bizak, Dr. David Danley, Jeff Kemper, and Al Pierce for technical support and useful discussions. This work has been sponsored by DoD contract 1999011104A.

Received for review March 10, 2006. Accepted March 29, 2006. AC060450V

Analytical Chemistry, Vol. 78, No. 12, June 15, 2006

4193