Folding Proteome of Yarrowia lipolytica Targeting with Uracil Permease Mutants Dominique Swennen,*,† Ce´line Henry,‡ and Jean-Marie Beckerich† INRA, UMR1319 Micalis, Domaine de Vilvert, F-78352 Jouy-en-Josas, France, and PAPPSO (Plate-Forme d’Analyse Prote´omique de Paris Sud-Ouest), INRA, UMR1319 Micalis, Domaine de Vilvert, F-78352 Jouy-en-Josas, France Received April 14, 2010
The acquisition of the correct folding of membrane proteins is a crucial process that involves several steps from the recognition of nascent protein, its targeting to the endoplasmic reticulum membrane, its insertion, and its sorting to its final destination. Yarrowia lipolytica is a hemiascomycetous dimorphic yeast and an alternative eukaryotic yeast model with an efficient secretion pathway. To better understand the quality control of membrane proteins, we constructed a model system based on the uracil permease. Mutated forms of the permease were stabilized and retained in the cell and made the strains resistant to the 5-fluorouracil drug. To identify proteins involved in the quality control, we separated proteins extracted in nondenaturing conditions on blue native gels to keep proteins associated in complexes. Some gel fragments where the model protein was immunodetected were subjected to mass spectrometry analysis. The proteins identified gave a picture of the folding proteome, from the translocation across the endoplasmic reticulum membrane, the folding of the proteins, to the vesicle transport to Golgi or the degradation via the proteasome. For example, EMC complex, Gsf2p or Yet3p, chaperone membrane proteins of the endoplasmic reticulum were identified in the Y. lipolytica native proteome. Keywords: Membrane protein • folding • chaperone • blue native gel • Yarrowia lipolytica • uracil permease • translocation complex • endoplasmic reticulum • immunofluorescence
Introduction Secreted and membrane proteins acquire their native structure in the endoplasmic reticulum, and their correct folding requires molecular chaperones. The quality-control systems enable that only the native proteins follow their route through the secretory pathway (see refs 1-3 for reviews). Proteins that are not able to be correctly folded or assembled or some regulated proteins are degraded by the cytoplasmic ubiquitinproteasome system through a pathway called endoplasmic reticulum associated degradation (ERAD) (reviewed in refs 4-6). This pathway protects the cell from endoplasmic reticulum stress, cellular dysfunction, and death.7 Yarrowia lipolytica is a hemiascomycetous dimorphic yeast with an efficient secretion pathway that is, in several aspects, close to the mammalian one.8 Study of Y. lipolytica specificities can bring complementary knowledge to the yeast Saccharomyces cerevisiae studies. For example, the cotranslational translocation of secreted proteins through the endoplasmic reticulum membrane is preferred in Y. lipolytica,9 the calnexin cycle, that plays a role in glycosylated protein folding, is present * To whom correspondence should be addressed. Dominique Swennen, INRA UMR1319, Micalis, Poˆle Ecosyste`mes, AgroParisTech, Centre de Biotechnologie Agro-Industrielle, F-78850 Thiverval-Grignon, France. Tel: 33 1 30815444. Fax: 33 1 30815457. E-mail:
[email protected]. † INRA, UMR1319 Micalis. ‡ PAPPSO. 10.1021/pr100340p
2010 American Chemical Society
in Y. lipolytica10 and Y. lipolytica has multiple membrane ubiquitin ligases that tag the proteins to degrade.11 To better understand the quality control of membrane proteins, we constructed a model system based on the uracil permease (YlFur4p). A three-amino acid insertion in a cytoplasmic loop of the S. cerevisiae uracil permease makes the protein an ERAD substrate.12 We introduced this mutation and two other mutations unexpectedly obtained in YlFur4p, and a C-terminal Myc-tag was added. We followed the protein through several assays: 5-fluorouracil sensitivity, protein stability, and immunofluorescence. To identify proteins involved in the quality control, we separated protein extracted in nondenaturing conditions and analyzed the native proteome.
Experimental Procedures Strains and Growth Conditions. Escherichia coli strain DH5alpha (F′/endA1 hsdR17 (rK- mK+) supE44 thi-1 recA1 gyrA (Nalr) relA1 ∆(lacIZYA-argF) U169deoR (φ80dlac∆(lacZ)M15) was used as host strain for bacterial transformations and plasmid propagation. The Y. lipolytica strain INAG136463 (MatB, scr1::ADE1, SCR2, his-1, leu-2, ura3) transformed with p0 plasmid13 cut by NcoI to become URA+ was used as recipient wild type strain. Escherichia coli cells were grown in LB medium (1% bactotryptone, 1% yeast extract, 0.5% NaCl), 50 µg/mL ampicillin, 28 °C. Yarrowia lipolytica cells were cultivated on rich YPD Journal of Proteome Research 2010, 9, 6169–6179 6169 Published on Web 10/18/2010
research articles medium (1% yeast extract, 1% bactopeptone, 1% glucose), 28 °C or minimal YNB medium (0.67% yeast nitrogen base without amino acids (Difco laboratories)), 2% glucose as carbon source, 0.1% proline as nitrogen source, 50 mM phosphate buffer pH 6.8, with amino acids required, 28 °C. Plasmids. Plasmid p013 was used as a vector for the constructions of the Y. lipolytica integrative plasmids. A BamHIEcoRI fragment containing 13 repetitions of the c-myc epitope from pINA300′-cmyc11 was inserted in p0. The HinDIII-BamHI fragment was replaced by the pBR322 fragment to insert a NheI site. The URA3 marker was replaced by the NcoI-NheI fragment from pINA240 (plasmid pBR322 with Y. lipolytica LEU2 and ARS18, unpublished data) containing LEU2 gene. YlFUR4 gene (YALI0D05621g, Genolevures Web site: http://www.genolevures.org) was amplified by PCR on genomic DNA from Y. lipolytica INAG136463 with the couple of oligonucleotides A (A: 5′CTA GCTATTNheI TCGAGGTCGCCCGCCAGA3′)andD(D:5′CGGGATCCBamHI G GGAGATAATGGCGGTTGTCTT3′), and the NheIBamHI fragment was cloned in frame with the c-myc epitope. After integration in the Y. lipolytica genome, we had a tagged copy of the gene under the control of its native promoter and a truncated copy in tandem. The insertion of Asn-Gly-Thr aminoacids between Met392 and Thr393 in a cytoplasmic loop was introduced by amplifying the gene with the couples of oligonucleotides A-B (B: 5′GTCG AATATTSspI GATGTACTTGGGCAGCAGCGCGGT GGTT ACCG GTTN CATGTCTGTGCCTGC3′) and C-D (C: 5′GCTGCCCAAGTACATC AATATTSspI 3′). Unexpected mutations were obtained during gene amplification or cloning, in potential transmembrane segments, TGC codon (aminoacid L323), which became GGC (aminoacid P323, P mutation), and the codon CTG (aminoacid C409), which became CCG (aminoacid G409, G mutation). The three mutations were separated or combined by subcloning wild type fragments and mutated fragments using SalI, BglI, SspI and BamHI restriction sites. DNA Techniques. Standard techniques have been used according to Sambrook et al.14 Enzymes were supplied by New England Biolabs. All vectors were checked by sequencing by Genome express (France). Transformation and Screening Procedures. The E. coli strains were transformed with the method of Chung and Miller.15Yarrowia lipolytica strain transformations were carried out according to Xuan et al.16 The integrative plasmids were introduced in Y. lipolytica after SalI restriction. Clones were screened by dot blot. Protein extracts were prepared by alkaline lysis of the cells as described in Volland et al.17 Five microliters of the extracts were dropped onto nitrocellulose membrane (Schleicher & Schuell), and positive clones were selected by immunodetection with anti-myc polyclonal antibody (Sigma). Extracts from these clones were analyzed on 10% acrylamide SDS-PAGE.18 Proteins were transferred onto nitrocellulose membrane followed by immunodetection with anti-myc polyclonal antibody. Positive clones were sequenced. Sensitivity to 5-Fluorouracil. Cells were grown in YPD medium. Five microliter droplets of serial dilutions (OD600 0.1, 0.01, 0.001, 0.0001) of exponentially growing cultures of each strain were inoculated on the surface of YNB plates containing 2.5 µM 5-fluorouracil (5-FU) (Sigma). Results were obtained after 2 days of incubation at 28 °C. Hygromycin B Decay Experiment. Cells were grown in YPD medium, 100 µg/mL hygromycin B (Sigma) was added, and cells were collected at indicated time. Cells extracts were prepared by alkaline lysis, or cells were broken in phosphate 6170
Journal of Proteome Research • Vol. 9, No. 12, 2010
Swennen et al. saline buffer (PBS), 10% glycerol, antiprotease cocktail (Roche), and glass beads (protein concentration was estimated with Bradford assay (Biorad)). Extracts were analyzed on 10% acrylamide SDS-PAGE18 or 10% acrylamide Tris-HEPES-SDS gels (Pierce Biotechnology) (protein standard was Precision plus protein standards from Biorad). Proteins were transferred onto a nitrocellulose membrane followed by immunodetection with anti-myc polyclonal antibodies or monoclonal antibodies against S. cerevisiae phosphoglycerate kinase-3 (PGK) (InVitrogen) for the primary antibodies and alkaline phophate antirabbit or anti-mouse antibodies as the secondary antibodies (Promega). Detection was done with BCIP/NBT color substrate as indicated by the manufacturer (Promega). Immunofluorescence. Cells were grown in YPD medium to an OD600 of 1-3. Cells were fixed by addition of 3.7% formaldehyde (Sigma). Cells were collected by centrifugation and incubated for 2 h at room temperature in 50 mM potassium phosphate buffer pH 6.5, 0.5 mM MgCl2, 3.7% formaldehyde. Cells were suspended in 100 mM potassium phosphate buffer pH 7.5 containing 1.2 M sorbitol, 25 mM β-mercaptoethanol, 1 mg/mL Zymolyase 20T (Seikagaku), and 2 mg/mL Cytohelicase (Sigma) for 35 min at 37 °C. After three washes in 100 mM potassium phosphate buffer pH 7.5, 1.2 M sorbitol, cells were subjected to immunofluorescence. Fifteen microliters of cell suspension were put in wells of Teflon slides (Fisher Scientific) pretreated with 1 mg/mL polylysine (Sigma). Cells were blocked with 15 µL of PBS with 0.5% bovine serum albumin and 0.05% Nonidet P40 for 15 min. After PBS washes, cells were incubated with a 1:300 dilution of anti-myc monoclonal antibody (Santa Cruz Biotechnology) or anti-Kar2 polyclonal antibodies (the C-terminal fragment of Y. lipolytica Kar2p from aminoacid 555 until the end of the protein was used to immunize rabbits; Beckerich, J.-M., unpublished data) for 1 h followed by PBS washes. Fifteen microliters of a 1:300 dilution of Alexafluor 488-anti-rabbit antibodies and Alexafluor 595anti-mouse antibodies (InVitrogen) were added. After PBS washing, cells were treated with 2 µg/mL 4,6-diamidino-2phenylindole (DAPI) and immediately washed with H2O. Slides were mounted with one drop of 1 mg/mL p-phenylenediamine, 10% PBS pH 9, 90% glycerol. Slides were observed with a fluorescence microscope (Olympus BX51) equipped with a 100x objective. Images were acquired with an EXI Retiga camera (QImaging) and equally processed with Image Pro Express software. (Color composite: red, green, blue or merge coloration. Brightness: 50. Contrast: 60. Gamma: 0.8. Filters: Sharpen. Options: 7 × 7. Passes: 1. Strength: 10). Sample Preparation for Protein Identification. Exponential YPD cultures were harvested and cells were broken in Native Sample Buffer (InVitrogen) (50 mM BisTris, 6 N HCl, 50 mM NaCl, 10% w/v glycerol, 0.0001% Ponceau S, pH 7.2), antiprotease cocktail (Roche), and glass beads. Unbroken cells were discarded by low speed centrifugation and the supernatants were centrifuged at 16,000g for 30 min. Membrane enriched pellets were suspended in Native Sample Buffer and incubated with 1% digitonin (InVitrogen), 30 min, 4 °C; then centrifuged at 16,000g for 30 min. Protein concentration in supernatants was estimated with a Bradford assay (BioRad). Twenty micrograms/lane of proteins were loaded on two Blue Native gels 3-12% (protein standard was NativeMark Unstained Protein Standard). Running conditions were done as indicated by the manufacturer (InVitrogen). One gel was transferred onto PVDF membrane (Whatman) before immunodetection with anti-myc
research articles
Folding Proteome of Yarrowia lipolytica polyclonal antibodies (NBT-BCIP detection kit, Promega). The second gel was stained with EZBlue (Sigma), and protein complexes were analyzed by liquid chromatography coupled with mass spectrometry (LC-MS/MS) (PAPPSO, INRA, France). LC-MS/MS Analysis. In-gel digestion was performed with the Progest system (Genomic Solution) according to a standard trypsin protocol. Gel pieces were washed twice by successive separate baths of 10% acetic acid, 40% ethanol, and acetonitrile (ACN). They were then washed twice with successive baths of 25 mM NH4CO3 and ACN. Gels were dried and reduction with 10 mM Dithithreitol in 25 mM NH4HCO3, and alkylation with 55 mM iodoacetamide in 25 mM NH4HCO3 was performed. Digestion was subsequently performed for 6 h at 37 °C with 125 ng of modified trypsin (Promega) dissolved in 20% methanol and 20 mM NH4CO3. The peptides were extracted successively with 2% trifluoroacetic acid (TFA) and 50% ACN and then with ACN. Peptide extracts were dried in a vacuum centrifuge and suspended in 20 µL of 0.05% TFA, 0.05% HCOOH, and 2% ACN. HPLC was performed on an Ultimate 3000 LC system (Dionex). A 4 µL sample was loaded at 20 µL/min on a precolumn cartridge (stationary phase: C18 PepMap 100, 5 µm. column: 300 µm i.d., 5 mm; Dionex) and desalted with 0.08% TFA and 2% ACN. After 4 min, the precolumn cartridge was connected to the separating PepMap C18 column (stationary phase: C18 PepMap 100, 3 µm. column: 75 µm i.d., 150 mm; Dionex). Buffers were 0.1% HCOOH, 2% ACN (A) and 0.1% HCOOH and 80% ACN (B). The peptide separation was achieved with a linear gradient from 0 to 36% B for 18 min at 300 nL/min. Including the regeneration step at 100% B and the equilibration step at 100% A, one run took 50 or 145 min. Eluted peptides were analyzed online with a LTQ-Orbitrap mass spectrometer (Thermo Electron) using a nanoelectrospray interface. Ionization (1.3 kV ionization potential) was performed with liquid junction and a capillary probe (10 µm i.d.; New Objective). Peptide ions were analyzed using Xcalibur 2.07 with the following data-dependent acquisition steps: (1) full MS scan in orbitrap (mass-to-charge ratio (m/z) 300 to 1600, profil mode) and (2) MS/MS in linear trap (qz ) 0.25, activation time ) 30 ms, and collision energy ) 45%; centroid mode). Step 2 was repeated for the four major ions detected in step 1. Dynamic exclusion time was set to 90 s. A database search was performed with XTandem 2008.02.01 (http://www.thegpm.org/TANDEM/). Enzymatic cleavage was declared as a trypsin digestion with one possible misscleavage. Cys carboxyamidomethylation and Met oxidation were set to static and possible modifications, respectively. Precursor mass and fragment mass tolerance were 10 ppm and 0.5 Da, respectively. A refinement search was added with similar parameters except that semitrypsic peptide and possible N-ter proteins acetylation were searched. Few databases were used: the Y. lypolytica strain CLIB122 database (6448 entries, version 2008/09/10 from http://www.genolevures.org/download.html), contaminant database (trypsin, keratins, ...). Only peptides with a E value smaller than 0.1 were reported. Identified proteins were filtered according to (1) a minimum of two different peptides was required with a E value smaller than 0.05, (2) a protein E value smaller than 10-4. In the case of identification with only two or three MS/MS spectra, similarity between the experimental and the theoretical MS/ MS spectra was visually checked. All contaminants proteins were removed.
Figure 1. Yarrowia lipolytica hypothetical structure of uracil permease (YlFur4p-Myc). Trace of the YlFur4p-Myc structure estimated from the topology of S. cerevisiae uracil permease and from the prediction of transmembrane helices. The approximate positions of the NGT insertion, the P and G mutations, and the myc-tag are indicated. Ex: external side. In: cytoplasmic side.
Protein Sequence Analysis. Protein sequences alignment was obtained with ClustalX program, 1.81 version19 and presented with GeneDoc program, 2.6.002 version.20 Hypothetical topology of YlFur4p was estimated from S. cerevisiae Fur4p topology21 and TMHMM Server v.2.0: Prediction of transmembrane helices in proteins. CBS prediction servers Center for Biological Sequence Analysis. Saccharomyces cerevisiae protein sequences were collected from S. cerevisiae Genome Database (http://www.yeastgenome. org/). Blastp22 against Y. lipolytica sequences (Database: YALI_ORF.aa: 6448 sequences; 3,139,837 total letters) were obtained from the Genolevures Web site (http://cbi.labri.fr/ Genolevures/). Blastp against protein databases from NCBI (number of letters: 3,531,781,989; number of sequences: 10,356,581) (http://www.ncbi.nlm.nih.gov/BLAST/) gave Homo sapiens protein sequences.
Results Yarrowia lipolytica Uracil Permease. The Y. lipolytica gene YALI0D05621g codes for a 592 aminoacids protein homologous to the S. cerevisiae uracil permease. The protein alignment (Supplemental Figure 1 in Supporting Information) shows the conservation of the sequences of S. cerevisiae uracil permease, allantoin permease, uridine permease, Y. lipolytica uracil permease, and Schizosacchromyces pombe uracil permease and, especially, the conservation of the lysine residue of S. cerevisiae (K272) and Y. lipolytica (K237) proteins, which is essential for uracil binding and translocation.23 The insertion of three aminoacids (NGT) after the M429 residue of S. cerevisiae uracil permease makes the protein an ERAD substrate.12 We inserted these three aminoacids after the M392 residue (NGT insertion) in Y. lipolytica protein and during the cloning two other mutations were unexpectedly selected. The first one was a L323P323 mutation (P mutation) and the second was a C409-G409 mutation (G mutation) (Figure 1). As these mutations were located in potential transmembrane domains as predicted from the topology of S. cerevisiae uracil permease21 and from the prediction of transmembrane helices (TMHMM Server 2.0), we decided to analyze them. These three mutations alone or mixed (NGT, P, G, P-G, P-NGT-G) in the protein were studied. To follow the protein, we added a 13-myc tag on the C-terminal side of the protein (YlFur4p-Myc). Journal of Proteome Research • Vol. 9, No. 12, 2010 6171
research articles
Swennen et al.
Figure 2. 5-Fluorouracil sensitivity assay. Cells were grown in YPD medium. Droplets (5 µL) of serial dilutions (OD600 0.1, 0.01, 0.001, 0.0001) of exponential growing cultures of each strain were inoculated on the surface of YNB plates with or without 2.5 µM 5-fluorouracil. Results were obtained after 2 days of incubation at 28 °C.
Figure 3. Hygromycin B chase of the wild type YlFur4p-Myc. Cells were grown in YPD medium, 100 µg/mL hygromycin B was added, and cells were collected at the indicated time. Proteins from 1.5 OD600 unit culture were NaOH/TCA extracted and were loaded on a 10% acrylamide gel. Anti-myc polyclonal antibody for YlFur4p-Myc (Fur4p) immunodetection or monoclonal antibody against S. cerevisiae phosphoglycerate kinase-3 for YlPgk1p (Pgk1p) detection were used for the Western blot analysis.
5-Fluorouracil Sensitivity. The YlFur4p-Myc is also the permease of the 5-fluorouracil (5-FU) drug. A 5-FU sensitivity assay is a sensor of the correct uracil permease targeting. A permease retained in the cell makes the strain resistant to the drug. The results (Figure 2) indicated that the wild type permease and the permease with the G mutation are targeted to the plasma membrane and made the cells sensitive to 5-FU. The G mutation probably does not modify the three-dimensional structure of the protein nor its activity, but the cells retained the permease with the NGT insertion, the P mutation, and combination of the mutations and were resistant to 5-FU, indicating that these mutations were enough to block the targeting of the protein. Permease Stability Assay. To evaluate the turnover of the proteins, their synthesis is blocked by a protein synthesis inhibitor such as cycloheximide and the pool of the protein is studied versus time. Yarrowia lipolytica is resistant to cycloheximide (data not shown). To follow the stability of the proteins, we incubated the cells with hygromycin B, which interferes with protein synthesis.24 Three hours after the addition of hygromycin B, the wild type permease was nearly completely degraded (Figure 3). YlFur4p-Myc with the G mutation is degraded as rapidly as the wild type protein, whereas the proteins with the other mutations are stabilized, suggesting that these last one are not degraded in the vacuole and are retained a longer time in a compartment not accessible to the proteasome (Figure 4). YlFur4p-Myc Localization. Immunofluorescence allowed us to distinguish the targeting of the permease to the plasma membrane or its retention in the endoplasmic reticulum (Figure 5). As suggested by the 5-FU sensitivity assay and the protein stability assay, the wild type permease and the per6172
Journal of Proteome Research • Vol. 9, No. 12, 2010
Figure 4. Hygromycin B chase of the wild type and mutated YlFur4p-Myc. Cells were grown in YPD medium, 100 µg/mL hygromycin B was added, and cells were collected after 3 h. Proteins (25 µg) from a PBS/antiprotease glass beads protein extraction were loaded on two 10% acrylamide Tris-HEPES-SDS gels; the top of the figure is a Western blot analysis with antimyc polyclonal antibody, and the bottom is the second gel stained with EZblue.
mease with the G mutation are targeted to the plasma membrane and did not colocalize with the Kar2p protein, a chaperone protein of the endoplasmic reticulum lumen, whereas the permease with the other mutations is retained in the cells and colocalized with the endoplasmic reticulum protein, Kar2p. This retention was not continuous in the endoplasmic reticulum but seemed localized in distinct adjacent patches suggesting subregions specialized in ERAD. Identification of Protein Involved in Quality Control. To identify protein playing a role in the quality control of the YlFur4p-Myc protein, we extracted the proteins in non denaturing conditions in the presence of 1% digitonin to keep membrane protein complexes associated with soluble protein partners. These complexes were separated on a blue native gel (Figure 6). We selected three gel fragments where the model protein was immunodetected and analyzed the native proteome by LC-MS/MS. The total number of different proteins identified was 517 (Supplemental Table 1 in Supporting Information). Among these proteins, 22% were involved in translation, 25% in respiration and other mitochondrial functions, 15% in metabolism, 15% in protein folding and secretion, 10% in other functions, and 13% in unknown functions. Twenty-six percent of the proteins are potential membrane proteins as deduced from the prediction of transmembrane helices (TMHMM Server 2.0), and 34% are probably associated with a complex by analogy to S. cerevisiae proteins (Saccharomyces Genome Database: http://www.yeastgenome.org/). Proteins playing a potential role in the transport and the folding of membrane proteins are listed in Table 1 and Supplemental Table 2 in Supporting Information.
Folding Proteome of Yarrowia lipolytica
Figure 5. Immunolocalization of YlFur4p-Myc. YlFur4p-Myc was detected with monoclonal anti-myc antibody and colored with Alexafluor 595-anti-mouse antibodies (red). The endoplasmic reticulum chaperone Kar2p was detected with polyclonal antiKar2p and colored with Alexafluor 488-anti-rabbit antibodies (green). Cells were treated with 2 µg/mL 4,6-diamidino-2-phenylindole (DAPI) for the nucleus coloration (blue). Slides were observed with an Olympus fluorescence microscope (100x objective). Images were acquired with an EXI Retiga camera and processed with Image Pro Express software.
Endoplasmic Reticulum Translocation. Translocation across the endoplasmic reticulum membrane is the first step in the biogenesis of secreted and membrane protein. This translocation can occur cotranslationally or post-translationally (reviewed in ref 25). In S. cerevisiae, the proteins are preferentially translocated post-translationally through a Sec complex comprising the heterotrimecic Sec61 complex (Sec61p, Sbh1p, Sss1p), the tetrameric Sec62-Sec63 complex (Sec62p, Sec63p, Sec71p, Sec72p), and the luminal Hsp70 chaperone Kar2p. In cotranslational translocation, the signal sequence or the transmembrane domain is recognized by the signal recognition particle (SRP), which slows translation and targets the ribosome-nascent chain complex to the endoplasmic reticulum membrane through the interaction with its receptor (the SRP receptor). Then the ribosome interacts with the translocating channel and the Sec61 complex, and the translocation occurs. Both the Hsp70 chaperone Kar2p and the Hsp40 cochaperone Sec63p are involved in cotranslational translocation.26,27 In mammalian cells, Sec62p and Sec63p were found associated with Sec61Rp.28,29 In Y. lipolytica30 as in mammals, the cotranslational translocation is preferred, and 70-80% of the Y. lipolytica Sec61 complex has been found in association with ribosomes.31 In the native proteome, we identified the Sec61p, Sbh1p, Sec62p, and Sec63p. This translocation complex could be associated with a second Hsp40 co-chaperone Erjp as in the mammals.32,33 One SRP receptor subunit and two subunits of the signal sequence peptidase complex were also detected. Protein Folding. Cytosolic Chaperones. Molecular chaperones are proteins involved in all steps of protein folding from their translation, the acquisition of their correct folding, and their transport, to
research articles
Figure 6. Blue native gel separation of the Y. lipolytica native proteome. Exponential YPD cultures were harvested. Cells were broken in native buffer. Unbroken cells and soluble proteins were discarded by centrifugation. Insoluble pellet was incubated with 1% digitonin. Proteins (20 µg) were loaded on a 3%-12% blue native gel. Proteins were transferred on a PVDF membrane before immunodetection with anti-myc monoclonal antibodies. Positions of the gel fragments collected for further LC-MS/MS analysis are indicated.
their degradation. The Hsp70 chaperones are members of a well-conserved protein family that bind to short hydrophobic patterns of unfolded proteins and are regulated by Hsp40 cochaperone (DnaJ family) and nucleotide exchange factors (ref 34 and references therein and ref 35). Three Hsp70 Ssa proteins were identified in the fragments of the native proteome. Their pleiotropic activities in protein folding and transport though slight specificities36 could explain their association with different complexes. The ribosome associated Hsp70 Ssb1 and Ssz137,38 were also detected in the fragments. Several Hsp90 were identified: Hsp104p,39 Sti1p40 that interact with Ssap, and Hsp82 that docks preprotein to the mitochondrion.41 The nucleotide exchange factor Hsp110: Sse1p42 and the Hsp90 cochaperone Sba1p43 were also detected. Endoplasmic Reticulum Chaperones. The chaperones of the endoplasmic reticulum lumen assist the folding of secreted proteins (reviewed in refs 44-46). As soon as the protein translocates, the oligosaccharyltransferase complex adds an N-linked oligosaccharide, which is, after the removal of terminal glucose by glucosidases leaving one glucose residue, recognized by the calnexin (Cne1p), the lectin-like chaperone that facilitates the correct folding of the protein with the protein disulfide isomerase (Pdip) favoring disulfide bond formation. After removal of the last glucose residue, the protein continues its route to its destination. If its correct folding is not acquired, the unfolded protein is recognized by UDP-glucose:glycoprotein glucosyltransferase (Ugt1p), which adds a glucose to the N-linked glycan. The monoglucosylated peptide re-enters the calnexin cycle. This folding cycle, which does not exist in S. cerevisiae, is present in Y. lipolytica10 as in higher eukaryotes. Yarrowia lipolytica calnexin Cne1p, detected in the proteome, is known to interact with the translocon subunit Sbh1p.47 Journal of Proteome Research • Vol. 9, No. 12, 2010 6173
research articles
Swennen et al.
Table 1. Some Components Identified in the Native Proteome components
Srp102p
location
Signal recognition particle receptor ER membrane
Yarrowia lipolytica
gel fragments
YALI0D17952g
1, 2
Translocation complex Sec61-complex Sec61p Sbh1p Sec62p Sec63p
ER membrane ER membrane ER membrane ER membrane
YALI0E21912g YALI0F08481g YALI0B17512g YALI0A17985g
1, 2, 3 1, 2, 3 2, 3 1, 2, 3
Sec11p Spc2p
Signal peptidase complex ER membrane ER membrane
YALI0D02849g YALI0A19492g
1, 2 1, 2
ER lumen cytoplasm cytoplasm cytoplasm cytoplasm cytoplasm
YALI0E13706g YALI0F25289g YALI0E35046g YALI0D08184g YALI0A00132g YALI0B12474g
1, 2, 3 1, 2, 3 1, 2, 3 1, 2, 3 1, 2, 3 1, 2
cytoplasm ER lumen
YALI0E13255g YALI0B08778g
1, 2 2, 3
ER membrane Cytoplasm cytoplasm cytoplasm cytoplasm-nucleus
YALI0C05819g YALI0C07953g YALI0E27962g YALI0C08987g YALI0D00429g
2 1, 2, 3 1, 2 1, 2 1
ER membrane ER membrane ER membrane ER membrane
YALI0B16434g YALI0D06589g YALI0F14795g YALI0D11066g
3 3 3 3
ER lumen ER-membrane
YALI0E03036g YALI0E02420g
1, 2 1, 2
Protein folding Hsp70 family Kar2p Ssa5p Ssa6p Ssa7p Ssb1p Ssz1p nucleotide exchange factor Sse1p Lhs1p DnaJ family ErJp Hsp82p Hsp104p Sti1p Sba1p (Hsp90-interacting protein) oligosaccharyltransferase complex Stt3p Wbp1 Ost1p Ost3p protein disulfide isomerase Pdi1p Eps1p lectin Cne1p Ugt1p EMC complex Emc1p Emc2p Emc3p Emc4p Yet3 Gsf2p
ER membrane ER lumen
YALI0B13156g YALI0C12661g
1, 2, 3 1, 2
ER membrane ER membrane ER membrane ER membrane ER membrane ER membrane
YALI0E14575g YALI0C23188g YALI0E21670g YALI0A10274g YALI0E26026g YALI0D02739g
2, 3 2 2 2 1, 2, 3 1, 2
Ssh1p
Retrotranslocation ER membrane
YALI0D22594g
1, 2, 3
Ubiquitylation E1 ubiquitin-activating enzyme Uba1p deubiquitylating enzyme Bre5p
cytoplasm
YALI0E06017g
1
cytoplasm
YALI0F00638g
1, 2
Cdc48p
Proteasomal targeting cytoplasm
YALI0F12155g
1, 2, 3
YALI0B11374g YALI0B15224g YALI0F14861g YALI0E32505g YALI0C17325g YALI0B14267g
3 3 3 3 3 3
Proteasome catalytic subunits Pre1p Pre2p Pre3p Pre4p Pre5p Pre6p 6174
Journal of Proteome Research • Vol. 9, No. 12, 2010
cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus
research articles
Folding Proteome of Yarrowia lipolytica Table 1. Continued components
Pre7p Pre8p Pre9p Pre10p Pup2p Scl1p
location
Yarrowia lipolytica
cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus cytoplasm-nucleus
gel fragments
YALI0D06523g YALI0F06314g YALI0C19382g YALI0F07469g YALI0E02794g YALI0C06039g
3 3 3 3 3 3
YALI0C21824g YALI0E16995g YALI0F05324g YALI0E30635g YALI0C18073g YALI0B13882g YALI0E22220g YALI0C13112g YALI0E34852g YALI0E06347g
1 1, 2 1 2 3 1, 2, 3 1, 2, 3 1 1, 2, 3 2
Endoplasmic reticulum-Golgi transport COPII Sar1p Sec23p Sec24p Sec31p Erp1p Erp2p Erv25p Erv46p Emp24p Emp47p
ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle ER-Golgi vesicle
Ret1p Sec21p Sec26p Mtcp (colocalize with COPI)
Golgi-ER vesicle Golgi-ER vesicle Golgi-ER vesicle
YALI0E19767g YALI0F03454g YALI0F19074g
1, 2, 3 1, 2 1 1
Uso1p
Tethering factor ER-Golgi transport
YALI0D23947g
1, 2
Sec18p Pga3p Sec4p
Vesicular trafficking ER-Golgi transport vesicular transport Golgi-plasma membrane vesicle
YALI0E29249g YALI0F29161g YALI0E23067g
1, 2 3 1, 2
Rtn1p Sey1p Yip2p
ER membrane ER membrane ER membrane
YALI0B01738g YALI0F01166g YALI0B19668g
1, 2, 3 3 3
Pmt1p Pmt2p Pmt4p Anp1p Mnn9p Mnn11p Gda1p
Glycosylation ER membrane ER membrane ER membrane Golgi membrane Golgi membrane Golgi membrane Golgi lumen
YALI0E15081g YALI0C23364g YALI0E05929g YALI0C04004g YALI0B12518g YALI0F17402g YALI0C17941g
2, 3 2, 3 2, 3 3 1, 3 3 1, 2, 3
Act1p Crn1p Abp1p Srv2p
cytoplasm cytoplasm cytoplasm cytoplasm
YALI0D08272g YALI0A19470g YALI0B14102g YALI0B10516g
1, 2 1, 2, 3 1, 2 2
COPI
ER morphology
Actin
Protein disulfide isomerase Pdi1p, the membrane Pdi1phomologue Eps1p,48 and UDP-glucose:glycoprotein glucosyltransferase Ugt1p were also detected. Four subunits of the oligosaccharyltransferase complex were identified. Endoplasmic Reticulum Membrane Chaperones. The endoplasmic reticulum membrane protein complex (EMC1-EMC6) was identified in S. cerevisiae as playing a role in the folding of membrane proteins.49 In the native proteome of Y. lipolytica, four subunits of the EMC complex were identified. No homologue of the S. cerevisiae Emc5p was found in Y. lipolytica, and Emc6p (YALI0A21010g) was not detected in the native proteome. In S. cerevisiae, the endoplasmic reticulum membrane chaperone Gsf2p enables the correct folding of the hexose transporters.50 This chaperone could have a similar role in Yarrowia lipolytica.
Yet3p, which was also identified in the native proteome, is homologous to the mammalian Bap31p. Human Bap31p is an endoplasmic reticulum membrane protein that cycles between the endoplasmic reticulum and a compartment intermediate between the endoplasmic reticulum and Golgi; its traffic is dependent on vesicular transport and is associated with new synthesized membrane proteins whose fate (secretion or degradation) depends on Bap31p.51-54 Retrotranslocation. We identified the translocon Sec61p homologue, Ssh1p, which could be associated with Sbh1p and with the SRP receptor subunit. In S. cerevisiae, Ssh1p was identified in a heterotrimeric complex dedicated to cotranslational translocation and dislocation for endoplasmic reticulum associated degradation, and it was associated with the SRP Journal of Proteome Research • Vol. 9, No. 12, 2010 6175
research articles 55-57
receptor. The Y. lipolytica Ssh1p could be involved in retrotranslocation of ubiquitylated proteins. Ubiquitylation. After their recognition by the quality control system, the misfolded proteins are ubiquitylated. Ubiquitylation begins by the ATP-dependent activation of ubiquitin by the ubiquitin-activating enzyme E1. Ubiquitin is then transferred through a transesterification reaction to the ubiquitin-conjugating enzyme E2, and the ubiquitin protein ligase E3 ubiquitylates the targeted substrate. The ubiquitylated proteins are dislocated from the endoplasmic reticulum with the aid of the Cdc48p-Ufd1p-Npl4p complex and are degraded by the proteasome. In S. cerevisiae, two endoplasmic reticulum E3 complexes, HRD1 and DOA10, have been involved in ERAD (reviewed in refs 58-60). The HRD1 and the DOA10 complexes were not identified in the native proteome, but the E1 ubiquitin-activating enzyme Uba1p and one deubiquitylating enzyme Bre5p were detected. Bre5p, in association with Ubp3p (which was not detected in the proteome), plays a role in anterograde and retrograde endoplasmic reticulum-Golgi traffic.61 Proteasomal Targeting. From the tethering complex Cdc48pUfd1p-Npl4p to the proteasome, only the cytosolic AAA-ATPase Cdc48p was identified in all gel fragments and was more abundant in the fragment 3 where are found the catalytic subunits of the proteasome. Proteasome. The 26S proteasome is composed of two subparticles, the 20S proteolytic particle and the 19S regulatory particle, and catalyzes the degradation of most nucleus or cytosol proteins.62 An ATP-dependent cycle of assembly and disassembly of the particles regulates protein degradation.63 The 19S regulatory particle can also function alone in regulation of transcription.64,65 In the native proteome of Y. lipolytica, the subunits of the catalytic particle of the proteasome have been identified in the gel fragment 3. The proteins of the regulatory particle were not detected. Endoplasmic Reticulum-Golgi Transport. Anterograde and retrograde transport from endoplasmic reticulum to Golgi are mediated, respectively, by COPII and COPI vesicles (reviewed in ref 66). COPII coat proteins were detected in the three fragments collected. The heterodimer Sec23p/Sec24p, the Sec31p subunit of the heterotetramer composed of Sec13p/ Sec31p, which forms the outer layer coat, and the regulatory G protein Sar1p were detected, but the Sar1p guanine exchange factor Sec12p or the stabilization factor Sec16p were not identified. Cargo receptors were also present: the transmembrane proteins of the p24 family, Erp1p, Erp2p, Emp24p, and Erv25p, which function together in a heteromeric complex;67 Emp47p, with a lectin-like carbohydrate recognition domain, a cargo receptor for exporting N-linked glycoproteins from the endoplasmic reticulum68 (EMP46, coding for the homologue protein and partner complex of Emp47p was not identified in Y. lipolytica genome); and Erv46p but not Erv41p (YALI0A17600g), the complex that influences the membrane fusion stage of transport.69 Sec21p, Sec26p, and Ret1p, coat proteins of the COPI vesicles, were detected in gel fragments. Uso1p (see ref 70 for a review about tethering factors) was also identified in the proteome, a coiled-coil protein that plays a role in vesicle tethering between the endoplasmic reticulum and Golgi. The mammalian homologue p115 and S. cerevisiae Uso1p have been shown to tether COPII vesicles, and p115 has also been found associated with COPI vesicles. Yarrowia lipolytica Uso1p could have a potential role in retrieval of mutant membrane protein to the endoplasmic reticulum 6176
Journal of Proteome Research • Vol. 9, No. 12, 2010
Swennen et al. through COPI vesicles in a post-endoplasmic reticulum quality control mechanism. YlFur4p Is Immunodetected in Early Steps of Its Secretion. The membrane enriched fraction was solubilized with digitonin and separated on a native gel. Only 5 distinct bands could be detected on the native gel, whereas the majority of the proteins had a diffuse migration (Figure 6). The immunodetection with the anti-myc antibody allowed the identification of gel fragments where YlFur4p was concentrated (Figure 6). In the Y. lipolytica strain containing the wild type permease, YlFur4p was more concentrated in gel fragment 2 where the endoplasmic reticulum translocation complex was detected but also where the membrane protein folding EMC complex and three endoplasmic reticulum membrane proteins playing a role in glycosylation were identified. In the strains containing the mutant permeases, YlFur4p was concentrated in the gel fragment 2 but also in the gel fragment 1 in which neither the folding EMC complex nor the glycosylation proteins were detected but two proteins of the ubiquitylation machinery were identified. In these strains, the mutant permeases were also concentrated in the gel fragment 3 perhaps because of their association with the proteasome catalytic subunits, whereas the wild type permease could be associated in gel fragment 3 with the oligosaccharyltransferase complex or the endoplasmic reticulum or the Golgi glycosylation proteins.
Discussion Yarrowia lipolytica is an alternative eukaryotic yeast model that has a secretion pathway closer to the mammalian one than S. cerevisiae.8 The acquisition of the correct folding of membrane proteins is a crucial process that involves several steps from the recognition of nascent protein, its targeting to the endoplasmic reticulum membrane, its insertion, and its sorting to its final destination. Many molecular chaperones from the cytosol, the endoplasmic reticulum membrane, or lumen assist the folding of the proteins, control their folding, and direct them to degradation through the ubiquitin-proteasome pathway if they are unable to acquire the correct native structure. To analyze the protein machineries involved in membrane protein folding and secretion, in a yeast close to mammalian cells, we constructed a model polytopic membrane protein, the uracil permease, in which mutations were introduced or not and a C-terminal 13-Myc tag was added to follow the protein. The advantage of the uracil permease as a model protein is the 5-FU sensitivity assay, which is a sensitive sensor of the target of the protein to the cell surface. A retained protein will make the cells resistant to the drug, which is the case for the strains containing the mutated forms (-NGT, -P, and combined mutations) of YlFur4p-Myc. These results were confirmed with the stability assay and the immunolocalization of the proteins. These three assays indicated that YlFur4p-Myc was an efficient model protein to analyze the folding and secretion of membrane proteins. To obtain knowledge about proteins involved in these processes, we analyzed the membrane enriched native proteome after migration on a blue native gel. We selected three gel fragments where YlFur4p-Myc was immunodetected. The gel fragments were analyzed by LC-MS/MS, and 517 different proteins were identified; 15% of them were involved in protein folding and secretion and particularly in the early steps of the protein secretion. The proteomic analysis of microsome enriched fraction of the filamentous fungus Aspergillus niger71 allowed the identification of 1081 proteins; 14% (148 proteins)
research articles
Folding Proteome of Yarrowia lipolytica were involved in the early steps of protein folding and secretion. Among these 148 proteins, 56 proteins were the same as those identified in Y. lipolytica proteome. We selected the proteins that could potentially play a role in the folding and transport of membrane proteins. We obtained a dynamic picture of the folding proteome, from the translocation across the endoplasmic reticulum membrane, the folding of the proteins to the vesicle transport to Golgi, or the degradation via the proteasome. The comparison of the same strain containing a wild type protein or the mutant proteins showed different patterns of immunodetection. The wild type permease was mostly immunodetected in one fragment where the translocon, membrane chaperone, and protein from the endoplasmic reticulum glycosylation process were identified, whereas the mutant proteins were also associated with other fragments in which ubiquitylation proteins or proteasome subunits were detected. This could reflect a longer association of the mutant permeases with these complexes. The translocation machinery that has been detected in the Y. lipolytica proteome could be composed of the heterotrimeric complex (Sec61p, Sbh1p, Sss1p), the heterodimer Sec62p/ Sec63p, and one endoplasmic reticulum membrane protein, ErJp, containing a DnaJ domain. This translocon, which looks like the mammalian one,72 could be involved in cotranslational translocation of secreted proteins and integration of membrane proteins. A great number of chaperone proteins have been detected from both sides of the endoplasmic reticulum membrane, and some membrane proteins potentially participate in the folding. The EMC complex, Gsf2p or Yet3p, the homologue of mammalian Bap31p are potentially involved in Y. lipolytica membrane protein fate. The Cdc48 protein, the major subunit of the tethering complex to the proteasome, and catalytic subunits of the proteasome were also present in the Y. lipolytica proteome. Associated in the fragments where YlFur4p-Myc was immunodetected, we could identify coat subunits and several cargo receptors of the COPII and COPI vesicles responsible for the traffic between the endoplasmic reticulum and Golgi, suggesting a competition between degradation and secretion of proteins.73 In the microsome enriched fraction of Aspergillus niger71 COPII, COPI, and the proteasome subunits were also recruited to the endoplasmic reticulum membrane. Proteins that could be involved in retrotranslocation from the endoplasmic reticulum for proteasomal degradation are the Sec61p homologue Ssh1p associated with the SRP receptor and the membrane chaperone Yet3p.53 The endoplasmic reticulum associated degradation HRD1 and DOA10 complexes described in S. cerevisiae were not detected in the Y. lipolytica proteome. We could hypothesize that the nondenaturing extraction method, the solubilization of the membranes with digitonin, and the migration in a native gel kept these complexes too compact to be accessible to the trypsin digestion and escaped the analysis or these complexes migrated in another gel fragment. For YlFur4p, the concentration was perhaps too low to be detected. We have limited our analysis of the native proteome in the folding and transport of protein, but we probably could have enlarged our picture to the translasome as described in Schizosaccharomyces pombe74 where the translation initiation factor eiF3 assembles in a supercomplex containing elongation factors, tRNA synthetases, 40S and 60S ribosomal proteins, chaperones, proteasome, ribosome biogenesis factors, and importin β. All of these proteins have been identified in the Y. lipolytica native proteome.
In conclusion, we have constructed a model to study the fate of a polytopic membrane protein from its translation to its final destination. We showed that the separation of digitonin solubilized membrane on a blue native gel and the LC-MS/MS analysis of the immuno-targeted protein complexes could bring knowledge on this complex and dynamic process.
Acknowledgment. This work was supported by INRA, CNRS, and AgroParisTech. We gratefully thank R. HaguenauerTsapis and D. Urban-Grimal from Institut Jacques MonodCNRS (France) for helpful discussions about uracil permease. Supporting Information Available: Multiple sequence alignment of uracil permease; combined results of the spectral count of the Yarrowia lipolytica proteome; proteins involved in folding and secretion; abbreviations of the supplemental tables; LC-MS/MS results listed by proteins in each gel fragment; LC-MS/MS results listed by peptides in each gel fragment. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Hirsch, C.; Gauss, R.; Horn, S. C.; Neuber, O.; Sommer, T. The ubiquitylation machinery of the endoplasmic reticulum. Nature 2009, 458 (7237), 453–460. (2) Hoseki, J.; Ushioda, R.; Nagata, K. Mechanism and components of endoplasmic reticulum-associated degradation. J. Biochem. 2010, 147 (1), 19–25. (3) Ma¨a¨tta¨nen, P.; Gehring, K.; Bergeron, J. J.; Thomas, D. Y. Protein quality control in the ER: the recognition of misfolded proteins. Semin. Cell Dev. Biol. 2010, 21, 500–511. (4) Ro¨misch, K. Endoplasmic reticulum-associated degradation. Annu. Rev. Cell Dev. Biol. 2005, 21, 435–456. (5) Vembar, S. S.; Brodsky, J. L. One step at a time: endoplasmic reticulum-associated degradation. Nat. Rev. Mol. Cell. Biol. 2008, 9 (12), 944–957. (6) Bagola, K.; Mehnert, M.; Jarosch, E.; Sommer, T. Protein dislocation from the ER. Biochim. Biophys. Acta 2010Epub ahead of print July 3, 2010; DOI:, 10.1016/j.bbamem.2010.06.025. (7) Kincaid, M. M.; Cooper, A. A. ERADicate ER stress or die trying. Antioxid. Redox Signaling 2007, 9, 2373–2387. (8) Swennen, D.; Beckerich, J. M. Yarrowia lipolytica vesicle-mediated protein transport pathways. BMC Evol. Biol. 2007, 7, 219. (9) He, F.; Yaver, D.; Beckerich, J. M.; Ogrydziak, D.; Gaillardin, C. The yeast Yarrowia lipolytica has two, functional, signal recognition particle 7S RNA genes. Curr. Genet. 1990, 17 (4), 289–292. (10) Babour, A.; Beckerich, J. M.; Gaillardin, C. Identification of an UDPGlc:glycoprotein glucosyltransferase in the yeast Yarrowia lipolytica. Yeast 2004, 21 (1), 11–24. (11) Boisrame, A.; Chasles, M.; Babour, A.; Beckerich, J. M. Two Hrd1p homologues in the yeast Yarrowia lipolytica which act in different pathways. Mol. Genet. Genomics 2006, 275 (3), 242–250. (12) Galan, J. M.; Cantegrit, B.; Garnier, C.; Namy, O.; HaguenauerTsapis, R. ‘ER degradation’ of a mutant yeast plasma membrane protein by the ubiquitin-proteasome pathway. FASEB J. 1998, 12 (3), 315–323. (13) Swennen, D.; Paul, M. F.; Vernis, L.; Beckerich, J. M.; Fournier, A.; Gaillardin, C. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis. Microbiology 2002, 148 (Pt 1), 41–50. (14) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning: a Laboratory Manual, 2nd ed.; Cold Spring Harbor: Plainview, NY, 1989. (15) Chung, C. T.; Miller, R. H. A rapid and convenient method for the preparation and storage of competent bacterial cells. Nucleic Acids Res. 1988, 16 (8), 3580. (16) Xuan, J. W.; Fournier, P.; Declerck, N.; Chasles, M.; Gaillardin, C. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica. Mol. Cell. Biol. 1990, 10 (9), 4795–4806. (17) Volland, C.; Urban-Grimal, D.; Ge´raud, G.; Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. J. Biol. Chem. 1994, 269 (13), 9833–9841.
Journal of Proteome Research • Vol. 9, No. 12, 2010 6177
research articles (18) Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227 (5259), 680– 685. (19) Thompson, J. D.; Gibson, T. J.; Plewniak, F.; Jeanmougin, F.; Higgins, D. G. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25 (24), 4876–4882. (20) Nicholas, K. B.; Nicholas, H. B., Jr. GeneDoc: a tool for editing and annotating multiple sequence alignments. Distributed by the author. (21) Garnier, C.; Blondel, M. O.; Haguenauer-Tsapis, R. Membrane topology of the yeast uracil permease. Mol. Microbiol. 1996, 21 (5), 1061–1073. (22) Altschul, S. F.; Madden, T. L.; Scha¨ffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D. J. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997, 25 (17), 3389–3402. (23) Urban-Grimal, D.; Pinson, B.; Chevallier, J.; Haguenauer-Tsapis, R. Replacement of Lys by Glu in a transmembrane segment strongly impairs the function of the uracil permease from Saccharomyces cerevisiae. Biochem. J. 1995, 308 (Pt3), 847–851. (24) Brodersen, D. E.; Clemons, W. M., Jr.; Carter, A. P.; Morgan-Warren, R. J.; Wimberly, B. T.; Ramakrishnan, V. The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell 2000, 103 (7), 1143– 1154. (25) Rapoport, T. A. Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes. Nature 2007, 450 (7170), 663–669. (26) Brodsky, J. L.; Goeckeler, J.; Schekman, R. BiP and Sec63p are required for both co- and posttranslational protein translocation into the yeast endoplasmic reticulum. Proc. Natl. Acad. Sci. U.S.A. 1995, 92 (21), 9643–9646. (27) Young, B. P.; Craven, R. A.; Reid, P. J.; Willer, M.; Stirling, C. J. Sec63p and Kar2p are required for the translocation of SRPdependent precursors into the yeast endoplasmic reticulum in vivo. EMBO J. 2001, 20 (1-2), 262–271. (28) Meyer, H. A.; Grau, H.; Kraft, R.; Kostka, S.; Prehn, S.; Kalies, K. U.; Hartmann, E. Mammalian Sec61 is associated with Sec62 and Sec63. J. Biol. Chem. 2000, 275 (19), 14550–14557. (29) Tyedmers, J.; Lerner, M.; Bies, C.; Dudek, J.; Skowronek, M. H.; Haas, I. G.; Heim, N.; Nastainczyk, W.; Volkmer, J.; Zimmermann, R. Homologs of the yeast Sec complex subunits Sec62p and Sec63p are abundant proteins in dog pancreas microsomes. Proc. Natl. Acad. Sci. U.S.A. 2000, 97 (13), 7214–7219. (30) He, F.; Yaver, D.; Beckerich, J. M.; Ogrydziak, D.; Gaillardin, C. The yeast Yarrowia lipolytica has two, functional, signal recognition particle 7S RNA genes. Curr. Genet. 1990, 17 (4), 289–292. (31) Boisrame, A.; Kabani, M.; Beckerich, J. M.; Hartmann, E.; Gaillardin, C. Interaction of Kar2p and Sls1p is required for efficient cotranslational translocation of secreted proteins in the yeast Yarrowia lipolytica. J. Biol. Chem. 1998, 273 (47), 30903–30908. (32) Blau, M.; Mullapudi, S.; Becker, T.; Dudek, J.; Zimmermann, R.; Penczek, P. A.; Beckmann, R. ERj1p uses a universal ribosomal adaptor site to coordinate the 80S ribosome at the membrane. Nat. Struct. Mol. Biol. 2005, 12 (11), 1015–1016. (33) Dudek, J.; Greiner, M.; Mu ¨ ller, A.; Hendershot, L. M.; Kopsch, K.; Nastainczyk, W.; Zimmermann, R. ERj1p has a basic role in protein biogenesis at the endoplasmic reticulum. Nat. Struct. Mol. Biol. 2005, 12 (11), 1008–1014. (34) Kabani, M.; Martineau, C. N. Multiple hsp70 isoforms in the eukaryotic cytosol: mere redundancy or functional specificity. Curr. Genomics 2008, 9 (5), 338–348. (35) Gong, Y.; Kakihara, Y.; Krogan, N.; Greenblatt, J.; Emili, A.; Zhang, Z.; Houry, W. A. An atlas of chaperone-protein interactions in Saccharomyces cerevisiae: implications to protein folding pathways in the cell. Mol. Syst. Biol. 2009, 5, 275. (36) Sharma, D.; Martineau, C. N.; Le Dall, M. T.; Reidy, M.; Masison, D. C.; Kabani, M. Function of SSA subfamily of Hsp70 within and across species varies widely in complementing Saccharomyces cerevisiae cell growth and prion propagation. PLoS One 2009, 4 (8), e6644. (37) Pfund, C.; Lopez-Hoyo, N.; Ziegelhoffer, T.; Schilke, B. A.; LopezBuesa, P.; Walter, W. A.; Wiedmann, M.; Craig, E. A. The molecular chaperone Ssb from Saccharomyces cerevisiae is a component of the ribosome-nascent chain complex. EMBO J. 1998, 17 (14), 3981– 3989. (38) Gautschi, M.; Lilie, H.; Fu ¨nfschilling, U.; Mun, A.; Ross, S.; Lithgow, T.; Ru ¨ cknagel, P.; Rospert, S. RAC, a stable ribosome-associated complex in yeast formed by the DnaK-DnaJ homologs Ssz1p and zuotin. Proc. Natl. Acad. Sci. U.S.A. 200198, (7), 3762–3767.
6178
Journal of Proteome Research • Vol. 9, No. 12, 2010
Swennen et al. (39) Glover, J. R.; Lindquist, S. Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins. Cell 1998, 94 (1), 73–82. (40) Wegele, H.; Haslbeck, M.; Reinstein, J.; Buchner, J. Sti1 is a novel activator of the Ssa proteins. J. Biol. Chem. 2003 278, (28), 25970– 25976. (41) Young, J. C.; Hoogenraad, N. J.; Hartl, F. U. Molecular chaperones Hsp90 and Hsp70 deliver preproteins to the mitochondrial import receptor Tom70. Cell 2003, 112 (1), 41–50. (42) Dragovic, Z.; Broadley, S. A.; Shomura, Y.; Bracher, A.; Hartl, F. U. Molecular chaperones of the Hsp110 family act as nucleotide exchange factors of Hsp70s. EMBO J. 2006 25, (11), 2519–2528. (43) Fang, Y.; Fliss, A. E.; Rao, J.; Caplan, A. J. SBA1 encodes a yeast hsp90 cochaperone that is homologous to vertebrate p23 proteins. Mol. Cell. Biol. 1998, 18, 3727–3734. (44) Tu, B. P.; Weissman, J. S. Oxidative protein folding in eukaryotes: mechanisms and consequences. J. Cell Biol. 2004 164, (3), 341– 346. (45) Christis, C.; Lubsen, N. H.; Braakman, I. Protein folding includes oligomerization-examples from the endoplasmic reticulum and cytosol. FEBS J. 2008 275, (19), 4700–4727. (46) Vembar, S. S.; Brodsky, J. L. One step at a time: endoplasmic reticulum-associated degradation. Nat. Rev. Mol. Cell. Biol. 2008, 9 (12), 944–957. (47) Boisrame, A.; Chasles, M.; Babour, A.; Beckerich, J. M.; Gaillardin, C. Sbh1p, a subunit of the Sec61 translocon, interacts with the chaperone calnexin in the yeast Yarrowia lipolytica. J. Cell Sci. 2002, 115 (Pt 24), 4947–4956. (48) Wang, Q.; Chang, A. Eps1, a novel PDI-related protein involved in ER quality control in yeast. EMBO J. 1999, 18, 5972–5982. (49) Jonikas, M. C.; Collins, S. R.; Denic, V.; Oh, E.; Quan, E. M.; Schmid, V.; Weibezahn, J.; Schwappach, B.; Walter, P.; Weissman, J. S.; Schuldiner, M. Comprehensive characterization of genes required for protein folding in the endoplasmic reticulum. Science 2009, 323 (5922), 1693–1697. (50) Kota, J.; Gilstring, C. F.; Ljungdahl, P. O. Membrane chaperone Shr3 assists in folding amino acid permeases preventing precocious ERAD. J. Cell Biol. 2007 176, (5), 617–628. (51) Ladasky, J. J.; Boyle, S.; Seth, M.; Li, H.; Pentcheva, T.; Abe, F.; Steinberg, S. J.; Edidin, M. Bap31 enhances the endoplasmic reticulum export and quality control of human class I MHC molecules. J. Immunol. 2006 177, (9), 6172–6181. (52) Wakana, Y.; Takai, S.; Nakajima, K.; Tani, K.; Yamamoto, A.; Watson, P.; Stephens, D. J.; Hauri, H. P.; Tagaya, M. Bap31 is an itinerant protein that moves between the peripheral endoplasmic reticulum (ER) and a juxtanuclear compartment related to ERassociated degradation. Mol. Biol. Cell 2008, 19 (5), 1825–1836. (53) Wang, B.; Heath-Engel, H.; Zhang, D.; Nguyen, N.; Thomas, D. Y.; Hanrahan, J. W.; Shore, G. C. BAP31 interacts with Sec61 translocons and promotes retrotranslocation of CFTRDeltaF508 via the derlin-1 complex. Cell 2008, 133 (6), 1080–1092. (54) Abe, F.; Van Prooyen, N.; Ladasky, J. J.; Edidin, M. Interaction of Bap31 and MHC class I molecules and their traffic out of the endoplasmic reticulum. J. Immunol. 2009 182, (8), 4776–4783. (55) Wilkinson, B. M.; Tyson, J. R.; Stirling, C. J. Ssh1p determines the translocation and dislocation capacities of the yeast endoplasmic reticulum. Dev. Cell 2001, 1 (3), 401–409. (56) Wittke, S.; Du ¨nnwald, M.; Albertsen, M.; Johnsson, N. Recognition of a subset of signal sequences by Ssh1p, a Sec61p-related protein in the membrane of endoplasmic reticulum of yeast Saccharomyces cerevisiae. Mol. Biol. Cell 2002, 13 (7), 2223–2232. (57) Jiang, Y.; Cheng, Z.; Mandon, E. C.; Gilmore, R. An interaction between the SRP receptor and the translocon is critical during cotranslational protein translocation. J. Cell Biol. 2008 180, (6), 1149–1161. (58) Glickman, M. H.; Ciechanover, A. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol. Rev. 2002, 82 (2), 373–428. (59) Kostova, Z.; Tsai, Y. C.; Weissman, A. M. Ubiquitin ligases, critical mediators of endoplasmic reticulum-associated degradation. Semin. Cell. Dev. Biol. 2007, 18 (6), 770–779. (60) Hirsch, C.; Gauss, R.; Horn, S. C.; Neuber, O.; Sommer, T. The ubiquitylation machinery of the endoplasmic reticulum. Nature 2009, 458 (7237), 453–460. (61) Cohen, M.; Stutz, F.; Dargemont, C. Deubiquitination, a new player in Golgi to endoplasmic reticulum retrograde transport. J. Biol. Chem. 2003 278, (52), 51989–51992. (62) Voges, D.; Zwickl, P.; Baumeister, W. The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu. Rev. Biochem. 1999, 68, 1015–1068.
research articles
Folding Proteome of Yarrowia lipolytica (63) Babbitt, S. E.; Kiss, A.; Deffenbaugh, A. E.; Chang, Y. H.; Bailly, E.; Erdjument-Bromage, H.; Tempst, P.; Buranda, T.; Sklar, L. A.; Baumler, J.; Gogol, E.; Skowyra, D. ATP hydrolysis-dependent disassembly of the 26S proteasome is part of the catalytic cycle. Cell 2005, 121 (4), 553–565. (64) Gonzalez, F.; Delahodde, A.; Kodadek, T.; Johnston, S. A. Recruitment of a 19S proteasome subcomplex to an activated promoter. Science 2002, 296 (5567), 548–550. (65) Lee, D.; Ezhkova, E.; Li, B.; Pattenden, S. G.; Tansey, W. P.; Workman, J. L. The proteasome regulatory particle alters the SAGA coactivator to enhance its interactions with transcriptional activators. Cell 2005, 123 (3), 423–436. (66) Lee, M. C.; Miller, E. A. Molecular mechanisms of COPII vesicle formation. Semin. Cell. Dev. Biol. 2007, 18 (4), 424–434. (67) Marzioch, M.; Henthorn, D;C.; Herrmann, J;M.; Wilson, R.; Thomas, D. Y.; Bergeron, J. J.; Solari, R. C.; Rowley, A. Erp1p and Erp2p, partners for Emp24p and Erv25p in a yeast p24 complex. Mol. Biol. Cell 1999 10, (6), 1923–1938. (68) Sato, K.; Nakano, A. Emp47p and its close homolog Emp46p have a tyrosine-containing endoplasmic reticulum exit signal and function in glycoprotein secretion in Saccharomyces cerevisiae. Mol. Biol. Cell 2002, 13 (7), 2518–2532.
(69) Otte, S.; Belden, W. J.; Heidtman, M.; Liu, J.; Jensen, O. N.; Barlowe, C. Erv41p and Erv46p: new components of COPII vesicles involved in transport between the ER and Golgi complex. J. Cell Biol. 2001, 152 (3), 503–518. (70) Sztul, E.; Lupashin, V. Role of vesicle tethering factors in the ERGolgi membrane traffic. FEBS Lett. 2009, 583 (23), 3770–3783. (71) Ferreira de Oliveira, J. M.; van Passel, M. W.; Schaap, P. J.; de Graaff, L. H. Shotgun proteomics of Aspergillus niger microsomes upon D-xylose induction. Appl. Environ. Microbiol. 2010, 76, 4421–4429. (72) Zimmermann, R.; Mu ¨ller, L.; Wullich, B. Protein transport into the endoplasmic reticulum: mechanisms and pathologies. Trends Mol. Med. 2006, 12 (12), 567–573. (73) Kincaid, M. M.; Cooper, A. A. Misfolded proteins traffic from the endoplasmic reticulum (ER) due to ER export signals. Mol. Biol. Cell 2007, 18 (2), 455–463. (74) Sha, Z.; Brill, L. M.; Cabrera, R.; Kleifeld, O.; Scheliga, J. S.; Glickman, M. H.; Chang, E. C.; Wolf, D. A. The eIF3 interactome reveals the translasome, a supercomplex linking protein synthesis and degradation machineries. Mol. Cell 2009, 36 (1), 141–152.
PR100340P
Journal of Proteome Research • Vol. 9, No. 12, 2010 6179
