Article pubs.acs.org/JAFC
Yellow Pigment Aurovertins Mediate Interactions between the Pathogenic Fungus Pochonia chlamydosporia and Its Nematode Host Yan-li Wang, Lin-fang Li, Dong-xian Li, Baile Wang, Keqin Zhang,* and Xuemei Niu* Laboratory for Conservation and Utilization of Bio-Resources & Key Laboratory for Microbial Resources of the Ministry of Education, Yunnan University, Kunming 650091, People’s Republic of China S Supporting Information *
ABSTRACT: Nematophagous fungi are globally distributed soil fungi and well-known natural predators of soil-dwelling nematodes. Pochonia chlamydosporia can be found in diverse nematode-suppressive soils as a parasite of nematode eggs and is one of the most studied potential biological control agents of nematodes. However, little is known about the functions of small molecules in the process of infection of nematodes by this parasitic fungus or about small-molecule-mediated interactions between the pathogenic fungus and its host. Our recent study demonstrated that a P. chlamydosporia strain isolated from root knots of tobacco infected by the root-knot nematode Meloidogyne incognita produced a class of yellow pigment metabolite aurovertins, which induced the death of the free-living nematode Panagrellus redivevus. Here we report that nematicidal P. chlamydosporia strains obtained from the nematode worms tended to yield a total yellow pigment aurovertin production exceeding the inhibitory concentration shown in nematicidal bioassays. Aurovertin D was abundant in the pigment metabolites of P. chlamydosporia strains. Aurovertin D showed strong toxicity toward the root-knot nematode M. incognita and exerted profound and detrimental effects on the viability of Caenorhabditis elegans even at a subinhibitory concentration. Evaluation of the nematode mutation in the β subunit of F1-ATPase, together with the application of RNA interference in screening each subunit of F1FO-ATPase in the nematode worms, demonstrated that the β subunit of F1-ATPase might not be the specific target for aurovertins in nematodes. The resistance of C. elegans daf-2(e1370) and the hypersensitivity of C. elegans daf-16(mu86) to aurovertin D indicated that DAF-16/FOXO transcription factor in nematodes was triggered in response to the aurovertin attack. These findings advance our understanding of the roles of aurovertin production in the interactions between nematodes and the pathogen fungus P. chlamydosporia. KEYWORDS: nematophagous fungi, Pochonia chlamydosporia, aurovertins, root-knot nematode, Caenorhabditis elegans
■
INTRODUCTION Nematophagous fungi are natural enemies of nematodes in the soil. They use different strategies to attack their hosts. There are three main groups of nematophagous fungi: the nematodetrapping fungi, the endoparasitic fungi, and the egg- and cystparasitic fungi.1,2 It has been widely assumed that nematophagous fungi apply specialized predatory devices (adhesive or nonadhesive traps or differentiated appressoria) and hydrolytic enzymes to capture, kill, and consume nematodes, whereas toxic fungi secrete nematode-toxic secondary metabolites to attack nematodes.3 Although an early study reported that the nematophagous fungus Arthrobotrys oligospora could secrete a chemical substance which paralyzed or killed nematodes after they were caught by its adhesive trapping organs,4 the chemical structure of this nematotoxin remains unknown. Information on the functions of secondary metabolites in the infection process of nematodes by nematophagous fungi is scarce.4 The nematophagous fungus Pochonia chlamydosporia (syn. Verticillium chlamydosporium, teleomorph Metacordyceps chlamydosporia) is one of the most studied potential biological control agents of nematodes. In some agroecosystems, this fungus plays a key role in suppressing soil-dwelling nematodes, acting as a natural biological control agent.5 Once in contact with nematode cysts or egg masses, the egg-parasitic fungus shows great capacity to infect and destroy the eggs and kill females of economically important plant-parasitic nematodes by © 2015 American Chemical Society
secreting hydrolytic enzymes such as proteases for the penetration of egg-shell components and chitinases for breaching the nematode cuticle.6 P. chlamydosporia also produces a variety of secondary metabolites, such as radicicol (= monorden), tetrahydromonorden, pseurotin A, and pochonins A−P.7−10 Among these compounds, pochonins are resorcylic acid lactone polyketides derived from radicicol. Despite the potential of pochonins in biotechnology and pharmacology,11 whether the chemical constituents of P. chlamydosporia are involved in the interaction between pathogenic fungus and its host in nature remains elusive. The most recent genome sequencing analysis of this fungus revealed that the number of gene clusters presumably dedicated to secondary metabolites exceeds the number of known compounds.5 To date, 19 aurovertins (A−S) have been obtained and structurally elucidated from soil fungi including important insect- and nematode-associated fungi such as Metarhizium anisopliae and P. chlamydosporia.12−16 During the past three decades this class of yellow pigment metabolites has attracted much interest because aurovertin B binds to the β subunit of Received: Revised: Accepted: Published: 6577
May 25, 2015 June 29, 2015 July 7, 2015 July 7, 2015 DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry Table 1. Seventeen Isolates of Pochonia chlamydosporia and Results for Chemical Analysis and Nematicidal Activities aurovertinsa strain YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF YMF a
1.00107 1.00111 1.00113 1.00130 1.00603 1.00606 1.00613 1.00615 1.00617 1.00618 1.00619 1.00620 1.00804 1.00832 1.00901 1.00928 1.01301
source RKN RKN soil soil RKN RKN RKN RKN RKN RKN RKN RKN RKN RKN soil RKN RKN
b
egg female
egg female female female female female female female egg egg juvenile female
field
TLC
HPLC
Yuxi Xiangyun Tengchong Yuxi Xiangyun Jianshui Songming Jianshui Jianshui Jianshui Jianshui Jianshui Jianshui Mengzi Kunming Shilin Mengzi
− + − − − − + + − − − − − − − − −
− + − − − − + + − − − − − − − − −
mortality of Caenorhabditis elegans L1 at 24 h (%) 8.33 100 10.63 6.27 18.13 10.15 100 100 16.45 17.61 17.45 18.82 10.45 6.8 17.29 10.62 8.39
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
1.77 0.00 2.97 0.30 4.22 3.16 0.00 0.00 2.15 2.91 2.65 3.0 5 1.21 0.44 2.55 2.01 1.00
+, aurovertins were detected in the culture medium; −, no aurovertins were detected in the culture medium. bRNK, root-knot nematode. of China. The infected juveniles of M. incognita were collected from the roots using the Baermann funnel technique. Three hundred grams of galled roots with lengths of 3−5 cm was collected and placed on a Baermann funnel apparatus. A length of rubber tubing and a collecting tube were attached to the funnel and filled with water. In the funnel, the nematodes moved out of the root tissue and sank to the bottom of the funnel due to gravity. After 24 h, a pinch clamp was applied on the rubber tubing, allowing the collecting tubing containing infected nematodes to be removed. The nematode suspension was concentrated to 1 mL by centrifuge at 8000 rpm, and then 0.2 mL of the resulting suspension containing about 200 juveniles was poured onto each of five Petri dishes containing 2% (w/v) of agar in water. After incubation for 10−20 days at 28 °C, mycelial tips that emerged from naturally infected juveniles were transferred to fresh Petri dishes containing potato dextrose agar (PDA medium consisting of 20% peeled potato, 2% glucose, and 2% agar) and recultured at least three times to obtain genetically identical fungal cultures. Collection of P. chlamydosporia strains from nematode eggs was performed according to a procedure described previously.15 To identify these fungal isolates, the general fungal primers ITS4 (5′ TCCTCCGCTTATTGATATGC) and ITS5 (5′ GGAAGTAAAAGTCGTAACAAGG) were used for amplifying internal transcribed spacer (ITS) 1, 2, and 5.8s rDNA regions of all the strains. The PCR products were purified followed by sequence analysis. The obtained ITS data were compared to those in the NCBI using a BLAST search. The nucleotide sequences were aligned manually using ClustalX. Phylogenetic analyses were completed using MEGA (ver. 6.06) to construct the neighbor-joining tree (Figure S1). The stability of clades was evaluated using bootstrap tests with 1000 replications. On the basis of the phylogenetic analyses of internal transcribed spacer (ITS) sequences, as well as the macroscopic and microscopic characteristics,24 17 fungal strains, including 4 from nematode eggs, 3 from soils, and 10 from nematode worms, were identified as P. chlamydosporia and are listed in Table 1. All of the isolates were deposited in the strain collection of the Laboratory for Conservation and Utilization of BioResources & Key Laboratory for Microbial Resources of the Ministry of Education, Yunnan University, Kunming, People’s Republic of China. After the conidia had developed on PDA slants in test tubes at 25 °C, the strains were kept at −30 °C as stock cultures. The P. chlamydosporia strains were cultured on a PDA medium for a week and then inoculated into 500 mL flasks each containing 250 mL of medium potato dextrose broth (PDB) consisting of 20% peeled potato and 2%
the F1-ATPase found on the inner membrane of mitochondria, inhibiting the ATPase and thereby uncoupling oxidative phosphorylation in in vitro bioassays.17 Furthermore, aurovertin B strongly inhibits the proliferation of breast cancer cell lines and arrests cell cycles at the G0/G1 phase.18 However, despite these findings, information on the natural functions of aurovertins in fungi remains scarce. This study has four major goals: (1) to establish the role of fungal aurovertin metabolites in nematodes such as the root-knot nematode Meloidogyne incognita and the model species Caenorhabditis elegans; (2) to recognize the relationship between different ecological niches such as nematode eggs and worm bodies and the production of the class of fungal aurovertin metabolites; (3) to evaluate whether the aurovertins work on the β subunit of F1-ATPase in nematodes; and (4) to study the nematode response reaction to this class of fungal metabolites. Several studies provide evidence that the functions of the secondary metabolites produced by pathogenic fungi in the host may vary according to their concentrations.19−21 Considering the possibility that the production of aurovertins by P. chlamydosporia could lead to the generation of metabolite concentration gradients in the environment and thus potentially exposing nematodes to subinhibitory concentrations of fungal nematicidal aurovertins, we characterized the main effects of aurovertin at subinhibitory concentrations (SICs) on the nematode and tested several different end points including lethality, lifespan, brood size, overall development, and pharyngeal pumping rate. Increasing evidence suggests that frequent exposure to nonlethal (that is, subinhibitory) concentrations of antibiotics plays an important role in the evolution of antibiotic resistance.19 The well-established model organism C. elegans22 was used as an alternative system for the investigation of the mode of action of the aurovertins in nematodes and aurovertin-induced host responses.
■
MATERIALS AND METHODS
Fungal Strains and Fermentation. Isolation of P. chlamydosporia strains from nematode worms was performed according to the modified method.23 Tobacco roots infected by M. incognita were collected from different fields in Yunnan Province, People’s Republic 6578
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry glucose. The inoculated flasks were incubated at 28 °C for 12 days with shaking at 180 rpm. Standards and Reagents. Dimethyl sulfoxide (DMSO), juglone (Ju), and oligomycin A (OA) were purchased from Sigma-Aldrich China Inc. Water was obtained from a Milli-Q system (Millipore, Bedford, MA, USA). Acetonitrile (Merck KGaA, Darmstadt, Germany) and formic acid (Roe Scientific Inc., USA) were of HPLC grade. Methanol (Guangdong Xilong Chemical Co., Ltd., Guandong, People’s Republic of China) was analytical-reagent grade. Isolation of Aurovertin Standards. The aurovertins were isolated from P. chlamydosporia according to the modified method described in the literature.15 A 12-day-old fermentation broth of strain P. chlamydosporia YMF 1.00613 was filtered to separate the mycelia from the culture. The culture filtrate was concentrated in vacuo and partitioned with acetyl acetate, and the organic part was evaporated to dryness to give an oily residue. The residue was dissolved in CHCl3/ MeOH and subjected to a Sephadex LH-20 column, developing with CHCl3/MeOH (1:1, v/v) to give five fractions. Fractions were monitored by TLC, and spots were visualized by spraying with 10% H2SO4 in EtOH. Fraction 2 was chromatographed with a silica gel column, eluting with CHCl3/MeOH (7:1, v/v, 1 L) to afford six subfractions. Subfraction 2 was repeatedly subjected to a silica gel column eluting with CHCl3/MeOH (50:1) to yield aurovertin D. Subfraction 4 was rechromatographed over a silica gel column eluting with CHCl3/MeOH (30:1, v/v) to give aurovertin F. Subfraction 3 was repeatedly chromatographed over a silica gel column washing with CHCl3/MeOH (40:1) to obtain aurovertins E and I. All of the purified aurovertins were elucidated and confirmed with 1H NMR data.17 TLC Analysis. To determine the presence of aurovertins in the fermentation broths of P. chlamydosporia strains, 17 P. chlamydosporia strains were cultivated in PD broth medium for 12 days and then filtered to separate the mycelia from the culture. The culture filtrates were dried in vacuo and then were extracted with 10 mL of acetone three times. The extracts were combined and concentrated to 1 mL. About 5 μL of each extract was spotted onto a 10 × 5 cm silica gel 60 F254 layer, and the developing solvent CHCl3/MeOH (13:1, v/v) was used. After treatment with 10% H2SO4 in ethanol followed by heating at 120 °C, purple color spots were visualized. HPLC Analysis. To confirm the presence of aurovertins and determine the contents of aurovertins in the fermentation broths of P. chlamydosporia strains, 17 P. chlamydosporia strains were cultivated in PDB medium, and then 1 mL of the broths was filtered to separate the mycelia from the culture. The culture filtrate (300 μL) was filtered through a 0.22 μm hydrophilic PVDF membrane (Millipore) for HPLC analysis. HPLC analysis was carried out using an HP 1200 (Agilent, Waldbronn, Germany) unit, employing the following instrumental conditions: column, CAPCELL PAK C18, 5 μm; 4.6 × 250 mm (Shiseido); flow rate, 1 mL/min; mobile phase A, 0.1% formic acid in water; mobile phase B, 0.1% formic acid in acetonitrile. The column temperature was maintained at 40 °C, and the injection volume for the culture filtrates was 25 μL. The HPLC conditions were manually optimized on the basis of separation patterns of the aurovertins and were as follows: gradient program of B (gradient, 0 min, 25% B; 2 min, 25% B; 29 min, 40% B; 31 min, 95% B; 34 min, 95% B; 35 min, 25% B; 45 min, 25% B). Detection was performed at 365 nm. The parameters of the regression equations and the limits of detection (LOD) and quantification (LOQ) were obtained with standard aurovertins D, E, F, and I. All of the aurovertins showed good linearity over the concentration range studied and five points of each calibration curve (R2 ≥ 0.9992). LOD and LOQ were determined to evaluate the sensitivity of the method. Worm Strains and Maintenance Conditions. Root-knot nematode M. incognita (race 3) was reared on tomato for about 2 months in a glasshouse at 25 ± 2 °C. Batches of mature egg masses (averaging 4000 eggs/batch) were obtained from infected tomato roots. Batches were collected on 2 cm diameter sieves (74 μm mesh) and placed on a 6 cm diameter sterile Petri dish, and then 15 mL of distilled water was added to promote hatching. Batches were then incubated at 28 °C in the dark. Emerging juveniles J2 (24 h) were removed and collected for the acute toxicity experiments.
Live specimens of the model nematode C. elegans Bristol N2 (wild type) were obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. Strains CF1308 daf-16(mu86) I, CB1370 daf-2(e1370) III, VC2255 atp-2(ok3002) III/hT2 [bli4(e937) let-?(q782) qIs48] (I;III), and TJ356 zls356[daf-16p::daf-16a/ b::gf p; rol-6] IV were obtained from the Caenorhabditis Genetics Center at the University of Minnesota (Minneapolis, MN, USA). All strains were routinely propagated at 20 °C with 42% relative humidity in the dark on nematode growth medium (NGM) plates using Escherichia coli strain OP50 as a food source. Synchronization of worm culture was achieved by treating gravid hermaphrodites with hypochlorite bleaching. The hatched L1 arrested worms were agesynchronous and were transferred onto NGM plates with E. coli OP50 containing either one of a range of different concentrations of aurovertin D (25, 50, and 100 μg/mL) or DMSO until they reached the desired stages.25 An Olympus CX31 microscope was used to observe nematodes. Acute Toxicity Assay. An acute toxicity test was performed according to a procedure described previously.15 About 300 agesynchronous C. elegans wild type N2 L1 were dispensed into 3.5 cm plates containing 1 mL of fungal culture broth. PDB medium was used as a negative control. About 300 age-synchronous root-knot nematode M. incognita juveniles J2, model species C. elegans wild type N2 L1, C. elegans mutant daf-16(mu86) L1, C. elegans mutant daf-2(e1370) L1, and C. elegans mutant atp-2(ok3002)/hT2[bli-4(e937) let-?(q782) qIs48] L1 were dispensed into 3.5 cm plates containing 1 mL of M9 buffer with variable amounts of aurovertin D (dissolved in DMSO) per plate (0, 12.5, 25, 50, and 100 μg/mL). Control groups were prepared with the same volume of DMSO (0.5% DMSO, v/v). Worms were exposed for 24 h at 20 °C, and the number of dead or live worms was determined by the absence/presence of touch-provoked movement when probed with a platinum wire. The median lethal concentration (LC50) value was calculated using the probit method. All treatments were conducted in triplicate. Development Assay. Synchronized L1 nematodes [wild type N2, daf-16(mu86), and daf-2(e1370)] treated with or without aurovertin D were cultured for 60 h. Then the numbers of nematodes in each stage including L1, L2, L3, L4, and adult were counted at 40× magnification. The development of 50 worms was assessed for each treatment. All treatments were conducted in triplicate. Pharyngeal Pumping, Lifespan, and Brood Size Assay. Synchronized L4 worms of wild type N2, daf-16(mu86), and daf2(e1370) treated with or without aurovertin D were manually assessed for the pharyngeal pumping rates. The pharyngeal pumping experiments were carried out in triplicate. For lifespan assay, these worms were counted and scored as live or dead, and live worms were transferred to fresh plates every day until no new progeny was generated in a 24-h period and no live worms remained.26 The brood sizes of nematodes were counted 2 days after the removal of the parents, and the progeny of at least 30 parental nematodes was counted. The lifespan and brood size experiments were carried out in quadruplicate. Reactive Oxygen Species (ROS) Assay. Cellular ROS levels were quantified by the dihydroethidium (DHE) assay using fluorescence microscopy.27 Synchronized L2 larvae of wild type N2 were incubated for 24 h at 20 °C in M9 buffer containing DMSO, aurovertin D (100 μg/mL), or juglone (3483 μg/mL, 20 mM). Worms were then allowed to recuperate on NGM plates with E. coli OP50 for about 20 h before their viability was determined by touch-provoked movement. After recovery, worms were washed with M9 buffer and then incubated in M9 buffer containing 3 μM DHE for 30 min in the dark. DHE is a fluorogenic probe that is highly selective for superoxide anion radical detection. DHE is cell-permeable and reacts with intracellular ROS to form ethidium, which, in turn, intercalates with DNA, thereby exhibiting a red fluorescence. Recording of the DHE fluorescence intensity was used as an index of the individual intracellular levels of ROS in individual worms. Fluorescence from worms exposed to DMSO as negative control and juglone as positive control was also measured. Three independent experiments were performed per treatment, and in each experiment ROS measurement 6579
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry
Figure 1. (A) Structures of aurovertins D, E, F, and I. (B) HPLC-DAD profiles of aurovertins in fermentation broths of Pochonia chlamydosporia strains YMF 1.00111, YMF 1.00613, and YMF 1.00615, and standard aurovertins. (C) Contents of aurovertins in the fermentation broth of aurovertin-producing P. chlamydosporia strain YMF 1.00613 in 15 days. (D) Effects of aurovertin D (AD) on the mortality of Meloidogyne incognita J2 and Caenorhabditis elegans N2 L1 nematodes in the acute toxicity assay. was made in at least 36 worms. A Zeiss Axioskop 2 plus microscope was used for the imaging of the red fluorescence of worms. These images were analyzed using Axiovision V4.5 (Zeiss) line tool to determine the mean relative fluorescence intensity of the nematodes. All treatments were conducted in triplicate. RNA Interference (RNAi). RNAi was administered by feeding worms strains of E. coli engineered to transcribe double-stranded RNA homologous to a target gene.28 Bacteria (HT115) with empty plasmid pPD129.36 were used as a negative control for nonspecific RNAi effects, whereas bacteria expressing fasn-1 dsRNA were utilized as positive control. Approximately 300 synchronized wild type N2 L1 worms were plated onto 6 cm NGM plates supplemented with 1 mM IPTG and 100 μg/mL ampicillin. The plates were seeded with different RNAi bacteria targeting each subunit of F1FO-ATPase, including asb-1, asb-2, atp-5, R04F11.2, R53.4, asg-1, asg-2, atp-3, H28O16.1, T26E3.7, atp-2, F58F12.1, hpo-18, R05D3.6, and ZC262.5, or with bacteria containing control vectors. Worms matured into adults in 3 days at 20 °C. Following a synchronization of the knockdown adult worms, the growth of L1 worms on NGM plates containing 100 μg/mL aurovertin D or DMSO for 60 h was monitored. Three independent RNAi experiments were performed for each gene tested. All treatments were done in triplicate. DAF-16::GFP Nuclear Localization. Synchronized L1 worms of the transgenic strain TJ356, which expresses a DAF-16::GFP fusion protein, were fed on NGM plates with or without 50 or 100 μg/mL aurovertin D for 60 h. DAF-16::GFP localization was monitored using a Zeiss M2BIO stereo dissecting microscope fitted with an Axiocam
MRC DAGE-MTI CCD-100 camera. Images were acquired at 100× and 400× magnifications in compound mode. Statistical Analyses. All experiments were performed in either triplicate or quadruplicate. Replicated trials had similar outcomes. Data were analyzed using the software SPSS (SPSS Inc., Chicago, IL, USA), and the results were presented as the mean ± SD. The LC50 was calculated using the probit analysis. Statistical significance was determined by Student’s t test for comparison between the means of two groups or by a one-way analysis of variance (ANOVA) followed by Tukey’s honest significant difference tests for equal variances and Dunnett’s T3 tests for unequal variances at the α = 0.05 level of significance among multiple groups. Differences were considered as significant when P < 0.05. Lifespan survival curve data were compared by the log-rank test of the Kaplan−Meier survival function. The relative average/maximal lifespan of worms was calculated according to the following formula: rel av (max) lifespan =
av (max) lifespan of worms treated with aurovertins av (max) lifespan of worms treated without aurovertins
■
RESULTS Non-nematicidal Activity of Most P. chlamydosporia Strains. Seventeen P. chlamydosporia strains collected from three different ecological niches, including nematode worms and eggs, and soil, were evaluated for the nematicidal activity of 6580
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry
Figure 2. Toxicity effects of aurovertin D on the viability of Caenorhabditis elegans wild type N2: (A) effects of aurovertin D (AD) (0, 12.5, 50, and 100 μg/mL) on the mortality of different-staged larvae; (B) effects of aurovertin D (AD) (0, 25, 50, and 100 μg/mL) and oligomycin A (OA) (100 μg/mL) on the developments of L1 nematodes; (C) effects of 100 μg/mL aurovertin D (AD) on brood size of nematodes; (D) effects of 100 μg/ mL aurovertin D (AD) on pumping rates of nematodes; (E) effects of aurovertin D (AD) (50 and 100 μg/mL) on the average lifespan of nematodes. (∗) P < 0.05; (∗∗) P < 0.01; (∗∗∗) P < 0.001.
metabolite in the aurovertin-producing P. chlamydosporia strains grown for ≥5 days (Figure 1C). Stronger Toxicity of Aurovertin D toward Root-Knot Nematodes than Free-Living Nematodes. The effects of aurovertin D on the plant-parasitic nematode M. incognita J2 and the model species C. elegans were evaluated. A dose− response relationship was established. Within 24 h, aurovertin D caused significant death of M. incognita J2 with an LC50 value of 16.45 μg/mL and inhibited C. elegans with an LC50 value of 33.50 μg/mL, indicating a stronger inhibitory activity toward root-knot nematodes than free-living nematodes (P < 0.01, Figure 1D). Profound Effects of Aurovertin D on the Viability of Model Species C. elegans at a Subinhibitory Concentration. Dose−response curves were generated for differentstaged larvae in the acute toxicity assay. The percentage of dead worms was defined as the mortality rate. Aurovertin D was most toxic to the earliest larval stage L1 (Figure 2A). The percentages of different-staged worms indicated that the development of wild type N2 L1 worms treated with various concentrations of aurovertin D was altered in a dose-dependent manner (Figure 2B). When exposed to aurovertin D at concentrations of 50 or 100 μg/mL, none of the worms reached adult stage, and only 5.4% of the worms treated with 100 μg/mL aurovertin D grew into L4 larval stage, whereas 92.6% of the worms in the negative control group grew into adult stage in 60 h (Figure 2B). This indicated that 100 μg/mL aurovertin D significantly inhibited the development of worms (P < 0.05). Additionally, aurovertin D displayed stronger inhibitory activity than the positive control oligomycin A (an FO-ATPase inhibitor, OA) toward larval development because 47.8% of worms exposed to 100 μg/mL oligomycin A grew into
their culture broths toward larval nematodes (Table 1). Among them, three strains, YMF 1.00111, YMF 1.00613, and YMF 1.00615, yielded distinctive luminous yellow in their fermentation broths. Nematicidal bioassays displayed that only these three strains showed 100% inhibitory rates toward the free-living nematode C. elegans L1 larvae nematodes, whereas those strains without yellow pigments exhibited no more than 19% inhibitory rates (Table 1). Aurovertins in the Nematicidal P. chlamydosporia Strains. All 17 P. chlamydosporia strains were examined for aurovertin production (Table 1; Figure 1A). Analysis with TLC and HPLC revealed that the aurovertins were abundant in the luminous yellow culture broths of the three bioactive strains YMF 1.00111, YMF 1.00613, and YMF 1.00615 (Table 1; Figure 1B). HPLC analysis of the three aurovertin-producing P. chlamydosporia strains indicated that these strains grown for ≥4 days yielded a total aurovertin production with contents ranging from 500 to 900 μg/mL (Figure 1C), exceeding the inhibitory concentration of aurovertins during nematicidal bioassays (Figure 1D). Aurovertin D as the Major Component in the Yellow Pigment Metabolite Profiles of Nematicidal P. chlamydosporia. Four major pigment metabolites, aurovertins D (348 μg/mL), E (144.5 μg/mL), F (314.2 μg/mL), and I (54.6 μg/ mL), were isolated from the 15-day yellow culture broths of the P. chlamydosporia strains and identified with 1H NMR data and confirmed using comparisons with the retention times of the aurovertin standards. HPLC analysis of the aurovertin compositions of all three P. chlamydosporia strains YMF 1.00111, YMF 1.00613, and YMF 1.00615 grown between 1 and 15 days revealed that aurovertin D was the major pigment 6581
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry
Figure 3. (A) Effects of aurovertin D on the mortality of Caenorhabditis elegans wild type N2 and mutant VC2255 (atp-2/hT2) L1 nematodes. (B) Effects of 100 μg/mL aurovertin D (AD100) on the development of L1 nematodes fed different RNAi bacteria targeting each subunit of F1FOATPase, including asb-1, asb-2, atp-5, R04F11.2, R53.4, asg-1, asg-2, atp-3, H28O16.1, T26E3.7, atp-2, F58F12.1, hpo-18, R05D3.6, and ZC262.5. HT115 was used as negative control, and fasn-1(RNAi) was used as positive control for RNAi experiments. The percentages of L4 nematodes fed RNAi bacteria targeting each subunit of F1FO-ATPase were compared with that fed control vector (HT115) using a one-way ANOVA with Tukey’s honest significant difference test for equal variances and Dunnett’s T3 tests for unequal variances post-test following 100 μg/mL aurovertin D treatment. (∗∗∗) P < 0.001. (C) Intracellular ROS levels of wild type N2 nematodes treated with 100 μg/mL aurovertin D (AD100) or 3483 μg/mL (20 mM) juglone (Ju3483) at L2 stage for 24 h.
17.53 μg/mL (P < 0.05), respectively. The results suggested that β subunit-deficient nematode mutant did not display significant resistance to aurovertin D. Toxicity of Aurovertin D to Nematode Mutants by RNAi Silencing of Each Subunit of F1FO-ATPase. RNAi studies were performed to determine whether aurovertin D exerted its effects in C. elegans by interfering with the functions of each subunit of F1FO-ATPase. Animals in the positive control group with fasn-1 RNAi were arrested in either the L2 or L3 larval stage and could not reach the L4 stage, indicating the efficiency of this RNAi experiment.29 Animals treated with strain HT115 with the empty vector were used as negative control. The right-hand panel in Figure 3B displays the developmental stages of each RNAi nematode exposed to 100 μg/mL aurovertin D treatment, and the left-hand panel demonstrates that of each RNAi nematode without aurovertin D. The results indicated that RNAi silencing of the β subunit did not significantly increase the percentage of L4 worms compared to the negative control (P > 0.05, Figure 3B). Overall, none of the RNAi worms displayed significant improvement in larval development, and the R53.4 and hpo18 nematodes even displayed significant delays (sensitivity, P < 0.001) in larval development compared with those in negative control. The results suggested that RNAi silencing of each subunit of F1FO-ATPase of nematode did not result in
adult stage. In measuring brood size, L4 worms treated with aurovertin D had a significantly decreased brood size of 51.8% less than those of worms without aurovertin D treatment (P < 0.01, Figure 2C). Pharyngeal pumping rates of worms treated with 100 μg/mL aurovertin D were significantly decreased with 17.6% less than those in the negative control (P < 0.01, Figure 2D). The relative average lifespan of wild type N2 worms exposed to aurovertin D at a concentration of 100 μg/mL was significantly shortened by 21.5% less than that of the negative control (P < 0.01, Figure 2E). Toxicity of Aurovertin D to β Subunit-Deficient Nematode Mutant. Aurovertin B was regarded as a potent inhibitor of ATP synthesis and ATP hydrolysis catalyzed by mitochondria1 enzyme systems, because it could bind to and inhibit mitochondrial ATPase, thereby uncoupling oxidative phosphorylation.17 To check if the β subunit of F1-ATPase was involved in the mode of action of aurovertin D in vivo, we tested the mortality of loss-of-function mutant atp-2(ok3002) by exposing the worms to aurovertin D. C. elegans atp-2 encodes the active site of the β subunit in the F1FO-ATPase in C. elegans. Unexpectedly, all L1 worms of β subunit-deficient mutant atp-2/hT2 died when exposed to 100 μg/mL of aurovertin D (Figure 3A). Moreover, the mortality of atp-2/ hT2 was even higher than that of wild type N2, and LC50 values of aurovertin D for wild type N2 and atp-2/hT2 were 33.50 and 6582
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry
Figure 4. Effects of aurovertin D on the mortality, larval development, and lifespan of Caenorhabditis elegans wild type N2, daf-2(e1370), and daf16(mu86): (A) Effects of aurovertin D (AD) (0, 12.5, 25, 50, and 100 μg/mL) on the mortality of L1 nematodes of wild type N2, daf-2(e1370), and daf-16(mu86) L1 nematodes; (B) effects of aurovertin D (AD) (0, 25, 50, and 100 μg/mL) on the development of wild type N2, daf-2(e1370), and daf-16(mu86) L1 nematodes [(∗∗) P < 0.01; (∗∗∗) P < 0.001]; (C) effects of aurovertin D (AD) (0, 50, and 100 μg/mL) on the lifespans of wild type N2, daf-2(e1370), and daf-16(mu86) [(∗∗) P < 0.01]; (D) effects of aurovertin D (AD) (0, 50, and 100 μg/mL) on the relative average lifespans (% of control) of wild type N2, daf-2(e1370), and daf-16(mu86) nematodes [(∗∗) P < 0.01]; (E) effects of aurovertin D (AD) (0, 50, and 100 μg/mL) on the relative maximal lifespans (% of control) of wild type N2, daf-2(e1370), and daf-16(mu86). A one-way ANOVA followed by Tukey’s honest significant tests for equal variances and Dunnett’s T3 Tests for unequal variances were used to compare the relative average/maximal lifespans between mutants and wild type N2.
subinhibitory concentration of 50 μg/mL was significantly increased with 26.7% compared to that of wild type N2 (P < 0.05) under the same treatment (Figure 4A). The larval growth rates of wild type N2 and the daf-16(mu86) mutant synchronized L1 worms exposed to various concentrations of aurovertin D are shown in Figure 4B. When exposed to aurovertin D at a concentration of 25 μg/mL, only 67.9% of daf-16(mu86) mutants developed into the L4 larval stage and no daf-16(mu86) mutants reached adult stage, whereas 63.6% of wild type N2 reached adult stage (Figure 4B), indicating that the development of daf-16(mu86) mutants was significantly inhibited compared to wild type N2 worms. For daf-16(mu86) mutant worms grown on medium with aurovertin D at concentrations of 0, 50, and 100 μg/mL, longevity including both average and maximum lifespans correlated with exposure doses (Figure 4C). Both the average lifespans and the
significant resistance of nematode mutants against aurovertin D. ROS Levels in Nematodes Treated with Aurovertin D. The levels of ROS with important roles in cell signaling and homeostasis in nematodes can increase dramatically under environmental stresses including xenobiotics.30 We tested whether aurovertin D could increase the ROS level in worms. However, aurovertin D did not alter ROS level in nemtaodes compared to negative control treatments (Figure 3C). Increased Sensitivity of daf-16 Nematode Mutant to Aurovertin D. DAF-16 is a C. elegans FOXO transcription factor and a key mediator involved in multiple stress responses.31 Experiments were carried out to test whether DAF-16 in nematodes is required for the aurovertin D-induced response. The acute toxicity assay showed that the mortality of daf-16(mu86) mutant treated with aurovertin D at a 6583
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry maximum lifespans of daf-16(mu86) mutant treated with aurovertin D at a concentration of 100 μg/mL were significantly reduced, with 19.4% (P < 0.05) and 23.5% (P < 0.01), respectively, less than those of the worms without aurovertin D treatment. However, the relative average lifespan and relative maximal lifespans of the treated daf-16(mu86) and wild type N2 worms were not significantly different (Figure 4D,E). Decreased Sensitivity of daf-2 Nematode Mutant to Aurovertin D. DAF-2 is the only insulin/IGF-1-like receptor in C. elegans, and insulin/IGF-1-like signaling is evolutionarily conserved across the animal kingdom, from single-celled organisms to mammals.32 To clarify the involvement of DAF2 in aurovertin D-induced toxicity, we tested the response of daf-2(e1370) mutants to aurovertin D exposure. The mortality percentages of daf-2(e1370) mutant L1 worms exposed to aurovertin D at concentrations of 50 and 100 μg/mL were significantly decreased at 44.4 and 26.3%, respectively, lower than those of wild type N2 (P < 0.05, Student’s t test) (Figure 4A). Because DAF-2 activity is required for larval developmental timing, maturation of daf-2(e1370) mutants to adulthood was delayed compared to wild type N2. In the bioassay, the larval growth development of N2 worms was evaluated at 60 h, whereas daf-2(e1370) mutant worms were assessed at 84 h after the synchronized L1 stage worms were exposed to aurovertin D at concentrations of 0, 25, 50, and 100 μg/mL. The result showed that the percentage of daf-2(e1370) mutants which reached adulthood was significantly increased at 23.4% higher than that of wild type N2 nematodes following 25 μg/mL aurovertin D treatment (P < 0.01, Figure 4B). After exposure to 100 μg/mL aurovertin D, the average lifespan of daf-2(e1370) mutant was 56.7% longer than that of the wild type N2, whereas the average lifespan of daf-2(e1370) mutant was 69% longer than that of the wild type N2 when exposed to DMSO. The average lifespan of daf-2(e1370) mutant treated with 100 μg/mL of aurovertin D was significantly decreased at 27.2% less than the worms without aurovertin D treatment (P < 0.01, Figure 4C). Meanwhile, the maximal lifespan of daf2(e1370) mutant was not significantly different when exposed to aurovertin D at concentrations of 50 and 100 μg/mL (Figure 4C). Exposed to aurovertin D treatment, the relative average lifespan of daf-2(e1370) mutant was significantly extended at 19.2% higher than that of wild type N2 (P < 0.01, Figure 4D). No significant difference was observed for the relative maximal lifespan between daf-2(e1370) mutants and wild type N2 upon aurovertin D exposure (Figure 4E). DAF-16 Nuclear Localization in Nematodes Induced by Aurovertin D. DAF-16 is activated by translocation from the cytoplasm to the nucleus.31 To determine the contribution of DAF-16/FOXO to the aurovertin D-induced host response, the influence of aurovertin D on the subcellular distribution of DAF-16 was examined using the transgenic strain TJ356. Worms of this strain carry a DAF-16::GFP fusion construct as a reporter gene, allowing the observation of the subcellular localization of DAF-16. The location of the transcription factor of DAF-16 in the cytosol, the nucleus, or an intermediate localization was observed after TJ356 L1 worms were treated with or without 50 and 100 μg/mL of aurovertin D for 60 h. Worms in the control group predominantly revealed a cytosolic localization (83 ± 5%) of DAF-16 (Figure 5A). Only a small fraction of the control worms showed a nuclear (12 ± 4%) or intermediate (5 ± 1%) localization phenotype (Figure 5A). A greater proportion of DAF-16::GFP was translocated to the
Figure 5. Effects of aurovertin D on nuclear localization of DAF16::GFP in TJ356: (A) expression of DAF-16::GFP in TJ356 grown on the NGM Petri dishes containing 0.5% DMSO as negative control; (B) expression of DAF-16::GFP in TJ356 grown on the NGM Petri dishes containing 50 μg/mL aurovertin D; (C) expression of DAF16::GFP in TJ356 grown on the NGM Petri dishes containing 100 μg/ mL aurovertin D. The development of TJ356 nematodes was inhibited and nuclear localization of DAF-16 was induced by aurovertin D. Three independent experiments with at least 20 nematodes per group were performed. White arrows indicate nuclear enrichment of DAF16::GFP. Scale bar = 50 μm.
nuclei in the intestine and other cells in the aurovertin Dtreated worms in comparison to the control population. The fraction of worms showing cytosolic localization decreased to 22 ± 3%, and the percentage of worms with nuclear localization increased to 77 ± 6% (Figure 5B,C). Thus, a translocation of DAF-16 from the cytosol to the nucleus was observed in nematodes in response to aurovertin D (Figure 5).
■
DISCUSSION P. chlamydosporia has a great capacity to infect and destroy the eggs and kill females of plant-parasitic nematodes. Increasing numbers of worldwide reports of P. chlamydosporia native isolates have been published.33 Our recent study demonstrated that a P. chlamydosporia strain collected from root-knot nematode could produce a class of yellow pigment metabolites that showed nematicidal activity toward the free-living nematode Panagrellus redivivus.15 This study hinted at the potential natural functions of fungal secondary metabolites in the pathosystem of nematode-parasitic fungi. Here we investigated 17 P. chlamydosporia isolates obtained from rootknot nematode worms, root-knot nematode eggs, or soils to 6584
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry evaluate the effects of the ecological niches on the fungal nematicidal activity and the production of nematicidal metabolites in P. redivevus strains. Among the 17 P. chlamydosporia strains, only three culture broths of the fungal strains showed strong inhibitory activities toward larval nematodes (Table 1), suggesting that only a small portion of the fungal strains might be nematicidal. One of the possible reasons might be the fact that the fungus P. chlamydosporia can survive as a saprophyte in the soil in the absence of both plant and nematode hosts, and many strains may thus survive in the soil despite not possessing toxic metabolites toward nematode worms.33 Interestingly, all three P. chlamydosporia strains with strong nematicidal activities yielded distinctive luminous yellow fermentation broths (Figure 1) and were obtained from the nematode female worms instead of nematode eggs (Table 1). Chemical investigation of the three P. chlamydosporia strains demonstrated that the yellow pigment metabolites consisted of polyketide metabolite aurovertins (Figure 1A,B). Among them, four aurovertins, D, E, F, and I, were identified from all three P. chlamydosporia strains with distinctive luminous yellow fermentation broths. Further HPLC-DAD analysis of the aurovertin metabolite profiles of the P. chlamydosporia strains indicated that aurovertin D became the main component among the yellow pigment metabolites of the aurovertinproducing P. chlamydosporia strains grown for ≥5 days. Together with our previous study that among these aurovertins, aurovertin D showed the strongest nematodetoxic activity, more than double that of the second strongest metabolite, aurovertin F, which lacked only one acetyl group compared with the aurovertin D structure,15 aurovertin D was chosen to be the representative of aurovertin-type metabolites to evaluate the effect of the aurovertins on nematodes and to study the nematode response reaction to this class of fungal metabolites. Bioassay results revealed that aurovertin D showed stronger toxicity toward root-knot nematode M. incognita than toward free-living nematode C. elegans. The LC50 value of aurovertin D for root-knot nematode M. incognita is 16.45 μg/mL, only half of the LC50 value for C. elegans. These results indicated that the class of aurovertins could be involved in the pathosystem of the nematode-parasitic fungus, and the major aurovertin played a key role in the nematode-killing process of the aurovertinproducing P. chlamydosporia strains. The P. chlamydosporia strains that colonized the nematode worms tended to produce the nematicidal yellow pigment aurovertins compared to the strains obtained from nematode eggs. This might be attributable to the fact that aurovertins did not affect the nematode egg hatch.15 From the above results, it could be deduced that some of nematode-parasitic P. chlamydosporia strains isolated from nematode body ecological niches instead of nematode eggs tended to produce a highly conserved class of nematicidal yellow metabolites to attack and kill the larval nematode. Our results demonstrated that exposure to aurovertin D at subinhibitory concentrations led to decreases in brood size, lifespan, and pharyngeal pumping rates and to a retardation in larval development of nematode C. elegans. In addition, aurovertin D was more toxic to the younger than to the older individuals. This could be attributed to the immaturity of detoxifying systems in L1 stage larvae of C. elegans,34 which might function better in the L4 larvae, as was observed for the antimicrotubule agent hemiasterlin.35
ATPase is a molecular target for various diseases and the regulation of energy metabolism.36 The enzyme comprises a soluble globular F1 (subunit composition α3β3γ1δ1ε1) catalytic sector and a membrane-bound FO proton-translocating sector.37 C. elegans atp-2 encodes the β subunit of the soluble catalytic F1 portion of ATP synthase and is required for nematode larval development, as well as for normal mobility, pharyngeal pumping, defecation, and growth rate.36,37 Aurovertins were found to inhibit both membrane-bound and soluble mitochondrial F1FO-ATPase of the protozoan Trypanosoma cruzi.38 An aurovertin-resistant mutant of Saccharomyces cerevisiae contained an altered nuclear gene that specifies the structure of the β subunit of F1 portion of ATP synthase.39 To evaluate whether aurovertin D exerts its toxicity by targeting the β subunit of F1-ATPase in nematodes, the resistance of nematode mutants deficient in the β subunit to aurovertins was assessed. However, no significant difference between these mutants and wild type N2 nematodes was observed after aurovertin D treatments. Because the catalytic β subunit of F1ATPase is required for mitochondrial ATP synthesis, the knockout of the entire β subunit is lethal to nematodes, so the mutants used in this part of study contained ok3002 allele that had a deletion of only about 500 bp in the third exon of the β subunit encoding gene atp-2.27 Previous study revealed that the change of one base G in the gene unc D in E. coli resulted in the change of the amino acid β-398Arg of the β subunit of F1ATPase and conferred resistance to aurovertins in bacteria.40,41 It is possible that the mutation in atp-2/ht2 in C. elegans might not occur at the gene fragment which encodes the amino acid target equivalent to that of β-398Arg of the β subunit of F1ATPase in E. coli. In addition, nematode mutant atp-2(ok3002) can develop only through two larval stages and arrest at the L3 stage due to the deficiency in the β subunit,42 which might lead to greater sensitivity of the impaired mutants to aurovertin D than that of the wild type N2 as shown in Figure 3A. Further RNAi experiments were performed to evaluate the responses of the mutants deficient in each subunit of F1FOATPase of C. elegans to aurovertin D. The silencing of the β subunit of F1-ATPase by RNAi did not significantly increase the resistance of worms to aurovertin D compared to the wild type N2. In fact, none of the RNAi worms showed a significant difference in larval development except for those nematodes grown on bacteria expressing double-stranded RNAs (dsRNA) R53.4 and hpo-18, respectively, which showed much greater sensitivity to aurovertin D than did the negative control. R53.4 encodes a mitochondrial ATP synthase subunit f homologue and is assumed to be required for the expression of antimicrobial peptides in response to infection,43 whereas hpo-18 encodes the C. elegans homologue of the oligomycin sensitivity-conferring protein (OSCP) subunit of mitochondrial ATP synthase (complex V), which is crucial for transmitting the energy of AGH+ to the catalytic sector.44 A previous study revealed that aurovertin inhibited ATPase considerably in the absence of FO and found that some protective action occurred in the presence of FO.45 Furthermore, the gene encoding OSCP is involved in controlling respiration and regulates growth rate and body size, aging, and rates of behaviors such as pharyngeal pumping, defecation, and locomotion. Our results that the RNAi mutants in R53.4 or hpo-18 caused the nematodes to be more sensitive to aurovertin D were consistent with previous reports. Previous studies reported that the ATPase inhibitor oligomycin could promote mitochondrial hyperpolarization, 6585
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Journal of Agricultural and Food Chemistry
■
which leads to variation of ROS.46 ROS not only plays important roles in apoptosis (programmed cell death) but also displays positive effects such as the induction of host defense.46 The toxicity of aurovertins in nematodes might be partially attributable to varied production of ROS in nematodes, so we checked the ROS levels in nematodes exposed to aurovertin D. However, no significant alteration of ROS levels in nematodes upon aurovertin D exposure was observed, indicating that the C. elegans response system might possess alternative mechanisms for dealing with this toxin. The C. elegans FOXO transcription factor DAF-16 represents the end point of several key signaling cascades controlling the stress response, the process of aging, and other important biological functions in C. elegans in parallel to FOXO transcription factors in mammals.31 As DAF-16 is thought to be the main target of the DAF-2 pathway and DAF-2 is negatively correlated with DAF-16 activity and longevity, the mutants daf-16(mu86) and daf-2(e1370) were used to investigate the signaling pathways involved in the aurovertin D-elicited stress response of nematodes. The higher sensitivity of mutant daf-16(mu86) deficient in daf-16 to aurovertin D indicated that DAF-16 was involved in protecting the nematodes from the effects of aurovertin D. We noted that mutant daf-16(mu86) was also significantly more sensitive than the wild type N2 to avermectin and oligomycin B, suggesting that daf-16 may be involved in a general resistance mechanism in nematodes exposed to outside toxins. At the same time, our results demonstrated decreased sensitivity of daf-2(e1370) mutants to aurovertin, just opposite that of daf-16(mu86). The reduced sensitivity of daf-2(e1370) to aurovertin D might be attributed to the activation of DAF-16 due to the reduced DAF-2 signal. Because DAF-16 in C. elegans is partially activated by nuclear translocation, the transgenic worm strain TJ356 with DAF16::GFP fusion reporter protein was utilized to further evaluate the involvement of DAF-16 proteins in aurovertin resistance. Our result revealed DAF-16 nuclear localization in aurovertintreated worms, confirming the activation of the transcription factor DAF-16/FOXO in nematodes by aurovertin D. A previous study indicated that the absence of food for >1 h resulted in nuclear translocation of DAF-16.36 It is likely that the aurovertin D-induced DAF-16 nuclear localization was triggered by starvation due to the reduced pharyngeal pumping rate caused by aurovertin D. In summary, some strains of the nematode-parasitic fungus P. chlamydosporia isolated from the worm bodies developed a highly conserved class of yellow chemical compounds capable of inducing the death of the host. The yellow pigment metabolites consisted of polyketide pigment aurovertins. The aurovertin-producing P. chlamydosporia strains, when cultured in broth for ≥5 days, yielded a total aurovertin production exceeding the inhibitory concentration of aurovertins. The major aurovertin produced in the broth is more toxic to rootknot nematode than to the model species C. elegans. Aurovertins play important roles in reducing the population of nematodes and delaying their growth. Investigation of the mode of action of the major aurovertin in the nematode model C. elegans revealed that the β subunit of F1-ATPase might not be the specific target in nematodes as previously reported. On the other hand, nematodes triggered the DAF-16/FOXO transcription factor to cope with the attack from fungal nematicidal aurovertin metabolites.
Article
ASSOCIATED CONTENT
S Supporting Information *
Figures S1 and S2. The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/ acs.jafc.5b02595.
■
AUTHOR INFORMATION
Corresponding Authors
*(K.Z.) Phone: 86-871-65032538. Fax: 86-871-65034838. Email:
[email protected]. *(X.N.) E-mail:
[email protected]. Funding
This work was sponsored by grants from the National Basic Research Program of China (973 Program) on Biological Control of Key Crop Pathogenic Nematodes (2013CB127505), the National High Technology Research and Development Program of China (2011AA10A205), the National Natural Science Foundation of China (U1036602 and 31070051), and the Yunnan University Program for Excellent Young Talents awarded to X.N. (XT412003). Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank Dr. Mei Ding (Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) for worms and Dr. Cheng-Gang Zou and Xiao-Wei Huang for helpful discussions and technical support.
■
REFERENCES
(1) Nordbring-Hertz, B.; Jansson, H.; Tunlid, A. Nematophagous fungi. In Encyclopedia of Life Sciences; Wiley: Chichester, UK, 2006; pp 1−11. (2) Schmidt, A.; Dörfelt, H.; Perrichot, V. Carnivorous fungi from Cretaceous amber. Science 2007, 318, 1743. (3) Li, G.; Zhang, K. Nematode-toxic fungi and their nematicidal metabolites. In Nematode-Trapping Fungi; Zhang, K., Hyde, K., Eds.; Springer: Dordrecht, The Netherlands, 2014; pp 313−375. (4) Olthof, T. H. A.; Estey, R. H. A nematotoxin produced by the nematophagous fungus Arthrobotrys oligospora Fresenius. Nature 1963, 197, 514−515. (5) Larriba, E.; Jaime, M. D.; Carbonell-Caballero, J.; Conesa, A.; Dopazo, J.; Nislow, C.; Martín-Nieto, J.; Lopez-Llorca, L. V. Sequencing and functional analysis of the genome of a nematode egg-parasitic fungus. Fungal Genet. Biol. 2014, 65, 69−80. (6) Lopez-Llorca, L. V.; Gómez-Vidal, S.; Monfort, E.; Larriba, E.; Casado-Vela, J.; Elortza, F.; Jansson, H. B.; Salinas, J.; Martín-Nieto, J. Expression of serine proteases in egg-parasitic nematophagous fungi during barley root colonization. Fungal Genet. Biol. 2010, 47, 342−351. (7) Hellwig, V.; Mayer-Bartschmid, A.; Muller, H.; Greif, G.; Kleymann, G.; Zitzmann, W.; Tichy, H. V.; Stadler, M. Pochonins A−F, new antiviral and antiparasitic resorcylic acid lactones from Pochonia chlamydosporia var. catenulata. J. Nat. Prod. 2003, 66, 829− 837. (8) Khambay, B. P. S.; Bourne, J. M.; Cameron, S.; Kerry, B. R.; Zaki, M. A nematicidal metabolite from Verticillium chlamydosporium. Pest Manage. Sci. 2000, 56, 1098−1099. (9) Shinonaga, H.; Kawamura, Y.; Ikeda, A.; Aoki, M.; Sakai, N.; Fujimoto, N.; Kawashima, A. Pochonins K−P: new radicicol analogues from Pochonia chlamydosporia var. chlamydosporia and their WNT-5A expression inhibitory activities. Tetrahedron 2009, 65, 3446−3453. (10) Shinonaga, H.; Kawamura, Y.; Ikeda, A.; Aoki, M.; Sakai, N.; Fujimoto, N.; Kawashima, A. The search for a hair-growth stimulant: new radicicol analogues as WNT-5A expression inhibitors from
6586
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
Article
Journal of Agricultural and Food Chemistry Pochonia chlamydosporia var. chlamydosporia. Tetrahedron Lett. 2009, 50, 108−110. (11) Zhou, H.; Qiao, K.; Gao, Z.; Vederas, J. C.; Tang, Y. Insights into radicicol biosynthesis via heterologous synthesis of intermediates and analogs. J. Biol. Chem. 2010, 285, 41412−41421. (12) Baldwin, C.; Weaver, L.; Brooker, R.; Jacobsen, T.; Osborne, C. J.; Nash, H. Biological and chemical properties of aurovertin, a metabolic product of Calcarisporium abuscula. Lloydia 1964, 27, 88− 95. (13) Wang, F.; Luo, D. Q.; Liu, J. K. Aurovertin E, a new polyene pyrone from the basidiomycete Albatrellus conf luens. J. Antibiot. 2005, 58, 412−415. (14) Azumi, M.; Ishidoh, K.; Kinoshita, H.; Nihira, T.; Ihara, F.; Fujita, T.; Igarashi, Y. Aurovertins F−H from the entomopathogenic fungus Metarhizium anisopliae. J. Nat. Prod. 2008, 71, 278−280. (15) Niu, X. M.; Wang, Y. L.; Chu, Y. S.; Xue, H. X.; Li, N.; Wei, L. X.; Mo, M. H.; Zhang, K. Q. Nematodetoxic aurovertin-type metabolites from a root-knot nematode parasitic fungus Pochonia chlamydosporia. J. Agric. Food Chem. 2010, 58, 828−834. (16) Guo, H.; Feng, T.; Li, Z. H.; Liu, J. K. Ten new aurovertins from cultures of the basidiomycete Albatrellus conf luens. Nat. Prod. Bioprospect. 2013, 3, 8−13. (17) van Raaij, M. J.; Abrahams, J. P.; Leslie, A. G.; Walker, J. E. The structure of bovine F1-ATPase complexed with the antibiotic inhibitor aurovertin B. Proc. Natl. Acad. Sci. U. S. A. 1996, 93, 6913−6917. (18) Huang, T. C.; Chang, H. Y.; Hsu, C. H.; Kuo, W. H.; Chang, K. J.; Juan, H. F. Targeting therapy for breast carcinoma by ATP synthase inhibitor aurovertin B. J. Proteome Res. 2008, 7, 1433−1444. (19) Andersson, D. I.; Hughes, D. Microbiological effects of sublethal levels of antibiotics. Nat. Rev. Microbiol. 2014, 12, 465−478. (20) Wu, D. K.; Zhang, C. P.; Zhu, C. Y.; Wang, Y. L.; Guo, L. L.; Zhang, K. Q.; Niu, X. M. Metabolites from carnivorous fungus Arthrobotrys entomopaga and their functional roles in fungal predatory ability. J. Agric. Food Chem. 2013, 61, 4108−4113. (21) Wu, H. Y.; Wang, Y. L.; Tan, J. L.; Zhu, C. Y.; Li, D. X.; Huang, R.; Zhang, K. Q.; Niu, X. M. Regulation of the growth of cotton bollworms by metabolites from an entomopathogenic fungus Paecilomyces cateniobliquus. J. Agric. Food Chem. 2012, 60, 5604−5608. (22) Hulme, S. E.; Whitesides, G. M. Chemistry and the worm: Caenorhabditis elegans as a platform for integrating chemical and biological research. Angew. Chem., Int. Ed. 2011, 50, 4774−4807. (23) Mauchline, T. H.; Kerry, B. R.; Hirsch, P. R. Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating. Appl. Environ. Microbiol. 2002, 68, 1846−1853. (24) White, T. J.; Bruns, T; Lee, S. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp 315−322. (25) Stiernagle, T. Maintenance of Caenorhabditis elegans. WormBook 2006, 1−11. (26) Chen, W.; Müller, D.; Richling, E.; Wink, M. Anthocyanin-rich purple wheat prolongs the life span of Caenorhabditis elegans probably by activating the DAF-16/FOXO transcription factor. J. Agric. Food Chem. 2013, 61, 3047−3053. (27) Lee, S. J.; Hwang, A. B.; Kenyon, C. Inhibition of respiration extends C. elegans’ life span via reactive oxygen species that increase HIF-1 activity. Curr. Biol. 2010, 20, 2131−2316. (28) Timmons, L.; Court, D. L.; Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 2001, 263, 103−112. (29) Greer, E. R.; Perez, C. L.; Van Gilst, M. R.; Lee, B. H.; Ashrafi, K. Neural and molecular dissection of a Caenorhabditis elegans sensory circuit that regulates fat and feeding. Cell Metab. 2008, 8, 118−131. (30) Martorell, P.; Forment, J. V.; de Llanos, R.; Montón, F.; Llopis, S.; González, N.; Genovés, S.; Cienfuegos, E.; Monzó, H.; Ramón, D. Use of Saccharomyces cerevisiae and Caenorhabditis elegans as model
organisms to study the effect of cocoa polyphenols in the resistance to oxidative stress. J. Agric. Food Chem. 2011, 59, 2077−2085. (31) Henderson, S. T.; Johnson, T. E. daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Curr. Biol. 2001, 11, 1975−1980. (32) Lee, R. Y.; Hench, J.; Ruvkun, G. Regulation of C. elegans DAF16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr. Biol. 2001, 11, 1950−1957. (33) Manzanilla-López, R. H.; Esteves, I.; Finetti-Sialer, M. M.; Hirsch, P. R.; Ward, E.; Devonshire, J.; Hidalgo-Díaz, L. Pochonia chlamydosporia: advances and challenges to improve its performance as a biological control agent of sedentary endo-parasitic nematodes. J. Nematol. 2013, 45, 1−7. (34) Lindblom, T. H.; Dodd, A. K. Xenobiotic detoxification in the nematode Caenorhabditis elegans. J. Exp. Zool. A: Comp. Exp. Biol. 2006, 305, 720−730. (35) Zubovych, I.; Doundoulakis, T.; Harran, P. G.; Roth, M. G. A missense mutation in Caenorhabditis elegans prohibitin 2 confers an atypical multidrug resistance. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 15523−15528. (36) Berger, K.; Sivars, U.; Winzell, M. S.; Johansson, P.; Hellman, U.; Rippe, C.; Erlanson-Albertsson, C. Mitochondrial ATP synthase-a possible target protein in the regulation of energy metabolism in vitro and in vivo. Nutr. Neurosci. 2002, 5, 201−210. (37) Pedersen, P. L.; Ko, Y. H.; Hong, S. ATP synthases in the year 2000: evolving views about the structures of these remarkable enzyme complexes. J. Bioenerg. Biomembr. 2000, 32, 325−332. (38) Cataldi de Flombaum, M. A.; Stoppani, A. O. Influence of efrapeptin, aurovertin and citreoviridin on the mitochondrial adenosine triphosphatase from Trypanosoma cruzi. Mol. Biochem. Parasitol. 1981, 3, 143−155. (39) Douglas, M. G.; Koh, Y.; Ebner, E.; Agsteribbe, E.; Schatz, G. A nuclear mutation conferring aurovertin resistance to yeast mitochondrial adenosine triphosphatase. J. Biol. Chem. 1979, 254, 1135−1139. (40) Lee, R. S.; Pagan, J.; Satre, M.; Vignais, P. V.; Senior, A. E. Identification of a mutation in Escherichia coli F1-ATPase beta-subunit conferring resistance to aurovertin. FEBS Lett. 1989, 253, 269−272. (41) Lee, R. S.; Pagan, J.; Wilke-Mounts, S.; Senior, A. E. Characterization of Escherichia coli ATP synthase beta-subunit mutations using a chromosomal deletion strain. Biochemistry 1991, 30, 6842−6847. (42) Tsang, W. Y.; Lemire, B. D. The role of mitochondria in the life of the nematode. Biochim. Biophys. Acta, Mol. Basis Dis. 2003, 1638, 91−105. (43) Couillault, C.; Pujol, N.; Reboul, J.; Sabatier, L.; Guichou, J. F.; Kohara, Y.; Ewbank, J. J. TLR-independent control of innate immunity in Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an ortholog of human SARM. Nat. Immunol. 2004, 5, 488−494. (44) Weber, J. ATP synthase: subunit-subunit interactions in the stator stalk. Biochim. Biophys. Acta, Bioenerg. 2006, 1757, 1162−1170. (45) Johnson, K. M.; Swenson, L.; Opipari, A. W., Jr.; Reuter, R.; Zarrabi, N.; Fierke, C. A.; Borsch, M.; Glick, G. D. Mechanistic basis for differential inhibition of the F1FO-ATPase by aurovertin. Biopolymers 2009, 91, 830−840. (46) Formentini, L.; Sanchez-Aragó, M.; Sánchez-Cenizo, L.; Cuezva, J. M. The mitochondrial ATPase inhibitory factor 1 triggers a ROSmediated retrograde prosurvival and proliferative response. Mol. Cell 2012, 45, 731−742.
6587
DOI: 10.1021/acs.jafc.5b02595 J. Agric. Food Chem. 2015, 63, 6577−6587
