ZnAl-LDH aligned

Subscriber access provided by CARLETON UNIVERSITY

Biological and Medical Applications of Materials and Interfaces

Vitamin C loaded poly(urethane-urea)/ZnAl-LDH aligned scaffolds increase proliferation of corneal keratocytes and up-regulate Vimentin secretion Mojgan Moghanizadeh-Ashkezari, Parvin Shokrollahi, Mojgan Zandi, F. Shokrolahi, Morteza J. Daliri, Mozhgan K. Rezaei, and Sahar Balagholi ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b07556 • Publication Date (Web): 06 Sep 2019 Downloaded from pubs.acs.org on September 6, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Vitamin C loaded poly(urethane-urea)/ZnAl-LDH aligned scaffolds increase proliferation of corneal keratocytes and up-regulate Vimentin secretion Mojgan Moghanizadeh-Ashkezari1, Parvin Shokrollahi*,1, Mojgan Zandi1, Fatemeh Shokrolahi1, Morteza J. Daliri2, Mozhgan K. Rezaei 3, Sahar Balagholi4 1Department

of Biomaterials, Faculty of Science, Iran Polymer and Petrochemical Institute,

postal cod: 14977-13115, Tehran, Iran. 2Department

of Animal and Marine Biotechnology, National Institute of Genetic Engineering

and Biotechnology, postal cod: 14977-16316, Tehran, Iran. 3Ocular

Tissue Engineering Research Center, Shahid Beheshti University of Medical Sciences,

postal cod: 16666-63111, Tehran, Iran 4

Blood Transfusion Research Center, High Institute for Research and Education in Transfusion

Medicine, postal cod: 14665-1157, Tehran, Iran Correspondence to Parvin Shokrollahi, E-mail: [email protected] Abstract A novel Poly (urethane-urea) (PUU) based on poly(glycolide-co-ɛ-caprolactone) macro-diol with tunable mechanical properties and biodegradable behavior is reported for corneal stromal tissue regeneration. Zn-Al layered double hydroxide (LDH) nano-particles were synthesized and loaded with vitamin C (VC, VC-LDH) and dispersed in the PUU to control VC release in the cell culturing medium. To mimic the corneal stromal EC, scaffolds of the PUU and its nano-composites with VC-LDH (PUU-LDH and PUU-VC-LDH) were fabricated via electrospinning. Average diameters of the aligned nano-fibers were recorded as325±168, 343±171 and 414±275 nm for the PUU, PUULDH and PUU-VC-LDH scaffolds, respectively. Results of hydrophilicity and mechanical properties measurements showed increased hydrophobicity and reduced tensile strength and elongation at the break upon addition of nano-particles to the PUU scaffold. VC release studies represented that intercalation of the drug in Zn-Al-LDH controlled the burst release and extended the release period from a few hours to 5 days. Viability and proliferation of stromal keratocyte cells on the scaffolds were investigated via AlamarBlue assay. After 24h, the cells showed similar viability on the scaffolds and the control. After 1 week, the cells showed some degree of proliferation on the scaffolds, with the highest value recorded for PUU-VC-LDH. SEM images of 1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 55

the scaffolds after 24h and 1 week confirmed good penetration and attachment of keratocytes on all the scaffolds and the cells oriented with the direction of nano-fibers. After 1 week, the PUUVC-LDH scaffold was fully covered by the cells. Immunocytochemistry assay (ICC) was performed to investigate secretion of vimentin protein, ALDH3A1, and α-SMA by the cells. After 24h and 1 week, remarkably higher levels of vimentin and ALDH3A1 and lower level of α-SMA were secreted by keratocytes on PUU-VC-LDH compared to those on the PUU and PUU-LDH scaffolds and the control. Our results suggest that the aligned PUU-VC-LDH is a promising candidate for corneal stromal tissue engineering due to the presence of zinc and vitamin C. Keywords: Polyurethane-urea, Vitamin C, Layered Double Hydroxide, Electrospun Scaffold, Corneal Stromal Regeneration, Drug loaded LDH Introduction Corneal stroma, the thickest layer of the cornea, consists of an organized extracellular matrix (orthogonal and highly oriented collagen fibrils), secreted by the resident keratocytes1. This layer ensures transparency and mechanical strength of the cornea. Therefore, if the cell layer is lost due to illness or deep mechanical or chemical damages, the cornea will lose its transparency, which ultimately leads to blindness2. Regeneration of corneal stroma is challenging because of its complex structure, mechanical strength and transparency3. Currently, the only acceptable treatment for damaged cornea is corneal transplantation 4, however, shortage of suitable donate cornea compared to demand remains an issue. Therefore, remarkable efforts have been made to reconstruct corneal stroma by developing functional corneal stroma substrates. Recently, engineering corneal stroma tissue equivalents with structural and mechanical properties that mimic extracellular matrix (ECM) of the native tissue is considered as an alternative treatment method. Due to complexity of the corneal stroma ultrastructure, production of a functional ECM is highly challenging. Many research groups have investigated corneal tissue equivalent using different natural and synthetic polymers such as collagen5, silk fibroin1,

6, 7,

hydroxylpropyl

chitosan8, gelatin/poly (lactic acid) blend9, poly(glycolic acid)10, poly(ɛ-caprolactone)/poly (glycerol sebacate) blend11and poly (ester urethane) urea12, 13. Various techniques were employed to produce oriented substrates, including magnetic field14, 15 and electrospinning9, 11. Builles, et al.15, produced a collagen based substrate of orthogonal arrangement applying a magnetic field. They have shown that the corneal stroma cells aligned themselves with the collagen fibrils in the scaffold and secreted new ECM of collagenous fibrils. Also, Yan, et al.9 have investigated 2 ACS Paragon Plus Environment

Page 3 of 55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


keratocytes behavior on a highly aligned electrospun scaffold. They have reported that the cells aligned themselves with direction of the fibers and secreted an organized ECM that mimic native corneal stroma. Signaling molecules have an important impact on regulating cell biological events. Various types of metal ions are present in ocular tissues and are involved in a variety of functions. Zinc is the second most prevalent ion in corneal epithelium and posterior stroma16. This metal ion is a catalytic and structural co-factor, and a regulator for 3000 proteins. According to Ugarte et al.17 in corneal stroma, zinc involves in binding collagen fibrils and matrix proteins such as proteoglycan that influence collagen fibrils diameter and spacing. Vitamin C (ascorbic acid) is another signaling molecule that stimulates the cells to synthesize the ECM collagen. Vitamin C promotes the triplehelical conformation of the molecule, a requirement for the formation of collagen by procollagen. Grobe, et al.18 have reported on effect of vitamin C on formation of cell sheets of human corneal stromal keratocytes. They demonstrated that secretion of type I collagen increased as a result of vitamin C supplementation. Also, addition of vitamin C to the culture medium had a pronounced effect on orientation of the collagen fibrils secreted by keratocytes. Recently, Luo et al.19 developed cryogels based on gelatin and different amounts of ascorbic acid and applied them as keratocyte carriers, both in vitro and in vivo. They have indicated that incorporation of vitamin C at low-to-moderate concentration (3 and 30 mg) resulted in good biocompatibility and enhanced tissue matrix construction. However, when loading of vitamin C was further increased (600 mg), the carrier turned toxic. Despite a relatively rich literature on the effect of Zn or vitamin C on the response of stromal keratocytes, to the best of our knowledge, there is no report on the synergic effect of zinc and vitamin C on keratocyte cells growth and proliferation. The goal of this study is designing a suitable polymeric substrate for regeneration of corneal stroma tissue. In our previous work 20, two series of segmented polyurethanes based on poly(glycolideco-ɛ-caprolactone) macro-diols with different ratio of glycolide to ɛ-caprolactone (50:50 and 30:70) were developed. The polyurethane based on random macro-diol including 50% glycolide (PU) showed appropriate biodegradability for corneal stroma tissue engineering. However, mechanical properties of the polymer did not match those required for soft tissues. So, in this present submission synthesis of a poly (urethane-urea) (PUU) based on the same macro-diol of our previous publication20, is reported, for which physiochemical and mechanical properties, as well as in vitro and in vivo biodegradation behavior are reported in comparison with its PU counterpart. 3 ACS Paragon Plus Environment


To mimic a native corneal ECM, the PUU was electrospun into a scaffold to which zinc and vitamin C were added in a specially designed structure. In fact, Zn-Al layered double hydroxides with and without vitamin C (LDH and VC-LDH, respectively) were synthesized. Next, aligned nano-fibrous scaffolds were fabricated from the PUU and its nano-composites (PUU-LDH and PUU-VC-LDH). Biocompatibility and viability of corneal keratocytes were investigated on the scaffolds via AlamarBlue assay and ICC assay. Materials and Methods 2.1.

Materials

Glycolide and tin (II) 2-ethylhexanoate (Sn(Oct)2) were purchased from Sigma-Aldrich. εcaprolactone (>99%), ethylene glycol (EG), 1,6-hexamethylene diisocyanate (HDI), dimethyl sulfoxide (DMSO), benzoic acid, 1,2-dichroethane, methanol, hexafluoroisopropanol (HFIP), and n-hexane were obtained from Merck Chemicals. 1,2-dichroethane, n-hexane, DMSO, and benzoic acid were dried prior to use.

2.2.

Synthesis of PGC Macrodiols

Random poly (glycolide-co-ε-caprolactone) macrodiol(glycolide:ɛ-caprolactone ratio of 50-50, RPG50C), was synthesized according to our previous work20. Briefly, the PGC macrodiol was synthesized via ring-opening polymerization of glycolide and ε-caprolactone initiated by ethylene glycol in presence of stannous octoate at 130 °C under a flow of dry N2. After 4 h, the reaction mixture was cooled down to room temperature. In order to remove the catalyst and any residual monomers, the mixture was dissolved in 1,2-dichloroethane, and precipitated in n-hexane under cooling in an ice/NaCl bath. The resulting product was washed with n-hexane (twice), and dried to a constant weight under vacuum. 2.3.

Synthesis of Segmented Polyurethane Urea

Segmented polyester polyurethane urea(PUU) was synthesized taking a two-step polymerization strategy to Shokrolahi, et al.21 with slightly modification. In the first step, the PGC macrodiol was 4 ACS Paragon Plus Environment

Page 4 of 55

Page 5 of 55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dissolved in 1,2-dichroethane and heated at 55°C under dried N2. Then, HDI was added to the mixture and the reaction was continued for 2 hours. After formation of an isocyanate terminated prepolymer, benzoic acid was dissolved in DMSO and added to the prepolymer mixture. The reaction continued overnight. The final product was cooled down to room temperature, purified with methanol (twice) and dried under vacuum. Molar ratio of [PGC macrodiol]: [HDI]: [BA] were kept constant at 1:2:1. 2.4.

Synthesis of LDHs

Zn-Al LDH and Zn-Al-VC LDH were synthesized taking a conventional co-precipitation method. To synthesize Zn-Al-LDH (denoted as LDH), an aqueous solution of Zn(No3)2·6H2O and Al(NO3)39H2O was prepared at molar concentrations of 0.02 and 0.01, respectively. Then, this solution was added, drop-wise, to 70ml deionized water under N2 atmosphere with vigorous stirring at room temperature. pH of the suspension was maintained at 7.0-8.0 using NaOH solution (20%w/v). The resulting suspension was crystallized at room temperature for 24h. Then the precipitate was centrifuged, and washed successively with doubly distilled water to remove impurities. The separated solid particles (LDH) were freeze dried and stored for use. To synthesize the vitamin C intercalated LDH (named as VC-LDH here after), a solution of vitamin C in 100 ml deionized water was prepared. An aqueous solution of Zn(No3)2·6H2O and Al(NO3)3 9H2O, as above, was prepared and this solution was added drop-wise, to the base solution under N2 atmosphere. pH of the suspension was maintained at 7.0-8.0 using NaOH solution. The suspension was stirred vigorously at 15°C for 5 days, then filtered, washed and dried as described above. 2.5.

Scaffold Fabrication

Aligned fibers PUU scaffolds were prepared by electrospinning onto a rapidly rotating mandrel. In brief, a 20wt% solution of the PUU in HFIP was fed at 1.0mL/h by a syringe pump into a steel capillary (ID=0.43mm) suspended over an aluminum wheel collector (10cm wide and 5cm in diameter). A high voltage (16Kv), and 25 cm distance between tip to collector were adjusted to fabricate nano-fibers scaffolds (thickness, 150 µm). Scaffolds were collected at 2000rpm resulting in aligned fibers morphology. For preparation of nano-composite scaffolds, LDH and VC-LDH nano-particles (3%wt polymer) were added to a solution of PUU in HFIP (20wt%), and bath sonicated (30 minutes). 5 ACS Paragon Plus Environment


2.6.

Characterization

FTIR spectra of all the samples were acquired on a Bruker IFS 48 instrument at room temperature. The 1H-NMR spectra in deuterated dimethyl sulfoxide (DMSO-d6) were recorded on a Bruker BioSpin spectrometer operating at 500 MHz with tetramethylsilane internal reference. Thermal properties of the PUU were investigated using DSC 1 instrument (METTLER TOLEDO, Switzerland). In order to ensure complete removal of any thermal history, cyclic DSC was performed. In the first heating run, the PUU was heated from –90 to 200 °C, at 10 °C /min. The sample was then cooled down to –90 °C at 10 °C /min. At the end of each heating and cooling cycle an isothermal step was applied for two minutes. In the second cycle, the samples were heated from –90 to 200 ºC at 10 ºC/min. Glass transition temperatures (Tg), the melting enthalpies (ΔHm), and melting temperatures (Tm), were determined from the second heating cycle. Thermogravimetric analyses (TGA)of PUU, LDH and VC-LDH nano-particles were performed at a heating rate of 10 °C/min in the range of 25 to 800 °C under nitrogen on a TGA/DSC1 Instrument (METTLER TOLEDO, Switzerland). Dynamic mechanical thermal analysis (DMTA) was carried out on a DMA1-METTLER TOLEDO instrument (STARE SYSTEM MODEL, Switzerland) in tensile mode between -80 and 150°C at a heating rate of 4 °C.min-1 and frequency of 1 Hz. Samples of20×7×0.2 mm3 were used for the test. Values of storage/loss moduli and tan δ verses temperature were recorded for each sample. Densities of the polymers were measured according to the Archimedes principle which is expressed as: 𝑑=

𝑚1 ― 𝑚2 𝑚1

Where 𝑚1 and 𝑚2 are the weight of the dry film and wet PU film, respectively. For each sample, the average of three measurements is reported, ±SD. Mechanical properties including Young’s modulus, tensile strength, and elongation at break were determined from stress-strain curves recorded on a universal testing machine, (STM 20, SANTAM, Iran), in tensile mode. For all samples, a 60 N load cell was used at a crosshead speed 6 ACS Paragon Plus Environment

Page 6 of 55

Page 7 of 55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of 5 mm/min. The measurements were performed at room temperature on the PUU film and scaffolds (100×10×0.2 mm3) according to ASTM D882-01. The presented data are average of five different measurements, ±SD. Kruss G10 contact angle measuring system (Germany) was used for measurement of water contact angle on surface of the PUU film as well as the scaffolds. The presented data are average of four measurements, ±SD. Water absorption analysis was carried out in line with ASTM D 570- 98. PUU film and scaffolds in triplicate were weighed and placed into PBS pH 7.4 for 24 h at 37 °C then re-weighed saturated to determine the water uptake percentage using the following equation. 𝑊𝑎𝑡𝑒𝑟 𝑢𝑝𝑡𝑎𝑘𝑒 (%) =

𝑚𝑤 ― 𝑚0 𝑚0

× 100

Where 𝑚𝑤 and 𝑚0 are the wet and the dry weight of the sample. In vitro degradation of the PUU polymer was studied in PBS, pH 7.4. To do so, the PUU film was cut into pieces of 50 mm2 and weighed. Then the samples were placed in 5 ml vials with 2 ml degradation medium (PBS, pH 7.4), which was refreshed weekly. All experiments were performed in a shaking incubator (16 weeks, 37 °C and 50 rpm). The weight loss values were calculated from the weight ratios of the samples before and after incubation. Scanning Electron Microscopy (SEM, VEGA 3SBH/TeSCAN Brno, Czech Republic) was used to observe surface changes of the PUU film before and after immersion in PBS at four different time points. The PBS incubated samples were dried, and subjected to sputter coating with gold prior to SEM observation. Also, this technique was used to investigate morphology and particle size of the electrospun scaffolds and the layered double hydroxides (LDH) nano-particles, respectively. Porosities of the scaffolds were determined through gravimetric method using bulk and true densities of the materials by the following equations.

7 ACS Paragon Plus Environment


𝑃𝑜𝑟𝑜𝑠𝑖𝑡𝑦 (%) = 1 ―

𝜌 × 100 𝜌0

Where 𝜌 and 𝜌0are densitiesof the scaffold and bulk polymer, respectively, and densities of the composites calculated using the rule of mixtures. Animal Experiment Animal experiments were performed to evaluate biocompatibility and biodegradability of the synthetic PUU, in vivo. The experiments were performed on male Wistar rats (250 ± 25 g). Animals were obtained from Iran Pasteur Institute-Tehran, Iran. All interventions were in accordance with the Declaration of Helsinki. The applied protocols were accepted by the Ethical Committee for the Protection of Animals in Scientific Research at the National Institute of Genetic Engineering and Biotechnology (NIGEB). Subcutaneous Implantation Prior to implantation, experimental animals were anesthetized with ketamine and xylazine (35–40 mg/ kg BW, 0.2 mg/ kg BW). Hair from dorsal region of the animal was cut, shaved and disinfected with 70% ethanol. With help of scalpel, incisions were made on both lateral side of the spinal cord. Small pockets were created between the dorsal fascia and the panniculus muscle using a blunt preparation. The PUU films were formed in square shapes (10 × 10 mm2). The samples were placed into the pockets. The samples were immobilized with two small sutures. The animals received no antibiotics. On days 30 and 60 post operation, animals were sacrificed with method of dislocation of neck. Samples with surrounding tissue were removed and processed for histopathological changes 1’/. Histopathology For histopathological analysis, the samples were fixed for 24 h in 5% formaldehyde (pH 7.4) and rinsed with water. The samples were decalcified with 0.3M TrisHCl, pH 7.4, and paraffin embedded before sectioned in 5 µm intervals. The sections were stained based on standard protocols with hematoxylin eosin. Keratocyte cells Culturing 8 ACS Paragon Plus Environment

Page 8 of 55

Page 9 of 55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Human corneal keratocytes in 3-5 passages were obtained from the Central Eye Bank of Iran. Research approval for use of human corneal keratocytes was obtained from the Institutional Review Board of the Central Eye Bank of Iran and the ethics committee of the Ophthalmic Research Center at Shahid Beheshti University of Medical Sciences (Tehran, Iran). The cells were cultured in T75 flasks (Nunc, Roskilde, Denmark) containing Dulbecco's modified Eagle's medium and Ham's F12 (DMEM/F12) medium (Sigma-Aldrich, Munich, Germany) supplemented with fetal bovine serum (FBS 20%) (GIBCO-BRL, Eggenstein, Germany) and incubated at 37°C with 5% CO2 and 85% humidity. Keratocyte Cells Proliferation Assessment (AlamarBlue Assay) This assay employs a fluorometric/colorimetric growth indicator that changes from an oxidized (non-fluorescent, blue) form to a reduced (fluorescent, red) form when reduced by mitochondrial respiration of the cells. In this assay, the percent reduction of AlamarBlue, which is determined by the ratio of the concentration of the reduced form to the total concentration of AlamarBlue, is proportional to number of cells. Keratocytes were plated in 96-well plates at a concentration of 5000 cells/cm2 using the serum-based medium. At predetermined time points, the medium was refreshed and cells were incubated with 10% AlamarBlue at 37°C with 5% CO2 for 4 h. A sample of 200 ml of AlamarBlue solution was then transferred into a 96-well plate for fluorescence reading. The absorbance was monitored at 570 nm and 600 nm using a fluorescence plate reader (Synergy 2, Biotek, Seattle, WA). Proliferation of keratocytes was determined by increase of AlamarBlue reduction at 24h and 1 week. This assay was performed in four independent experiments. Immunocytochemistry Cultivated human keratocytes, whether on scaffolds or without scaffold (control), at a density of 5 × 103 cells/well in a 24-well microplate were irrigated with PBS and fixed with ice-cold methyl alcohol (−10°C) (Merck, Darmstadt, Germany) 24 h and 1-week post cultivation. After blocking with a blocking solution containing 1% bovine serum albumin (Merck, Darmstadt, Germany) in 1% Triton X-100 in phosphate buffered saline (PBS; Sigma-Aldrich, Munich, Germany) for 20 min at room temperature, the cells were incubated in a diluted anti-vimentin antibody (1:200 rabbit polyclonal IgG; Santa Cruz Biotechnology Inc., Dallas, USA) overnight at 4°C. After washing 9 ACS Paragon Plus Environment


with PBS, fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (1:100; Santa Cruz Biotechnology Inc., Dallas, USA) was applied for 45 min at dark and room temperature. After staining with 4’, 6-diamidino-2-phenylindole (DAPI) (1 mg/ml, Santa Cruz, Carlsbad, CA, USA) for 5 min, the cells were examined under inverted microscope (Axiophot, Zeiss, Germany) equipped with a 460 nm filter for DAPI and a 520 nm filter. A double immunostaining method was considered for investigating immune reactivity of the cells for aldehyde dehydrogenase 3A1 (ALDH) and alpha smooth muscle actin (α-SMA). Briefly, after fixation of the cells for 10 minutes in chilled methanol on ice and permeabilization with 0.5% Triton X-100 in PBS at room temperature for 5 min, the cells were blocked in 1% bovine serum albumin and incubated in a diluted anti-ALDH3A1 antibody (1:200 mouse monoclonal IgG; Santa Cruz Biotechnology Inc., Dallas, USA) and anti- α-SMA antibody (1:200 mouse polyclonal IgG; Santa Cruz Biotechnology Inc., Dallas, USA) for overnight at 4°C. After decanting the antibody solution and washing the cells with PBS, phycoerythrin (PE)-conjugated goat anti-mouse IgG (1:100; Santa Cruz Biotechnology Inc., Dallas, USA) and fluorescein isothiocyanate (FITC)conjugated rabbit anti-mouse IgG (1:100; Santa Cruz Biotechnology Inc., Dallas, USA) were added to the samples incubated with ALDH and α-SMA, respectively. The immune stained cells were then counterstained with 4,6-diamidino-2-phenylindole (DAPI) (1 mg/ml; Santa Cruz Biotechnology Inc., Dallas, USA) for 5 min. All the immune stained samples were then visualized using an inverted microscope (Olympus IX71; Tokyo, Japan) equipped with appropriate excitation and emission filters and photographed with a digital camera (Olympus UTV0.63XC; Tokyo, Japan). Blue and red filters were used to capture the FITC- and PE-stained cells, respectively. All the experiments were performed in triplicate. The percentages of expression of ALDH and α-SMA proteins were calculated by using ImageJ software (ImageJ, http://imagej.nih.gov/ij/; provided in the public domain by the National Institutes of Health, Bethesda, MD, USA). RNA extraction and gene expression analyses Human keratocytes cultured on PUU, PUU-LDH and PUU-VC-LDH scaffolds as well as control keratocytes (no scaffold) were subjected to molecular analyses 24 h and 1 week after cultivation. Total RNA isolation was initiated with cell lysis using TRIzol reagent (Life Technologies Corporation; Carlsbad, CA, USA) according to the manufacturer’s instructions. After addition of chloroform to the TRIzol reagent to separate total RNA, isopropanol was added to precipitate the 10 ACS Paragon Plus Environment

Page 10 of 55

Page 11 of 55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RNA, followed by dissolution in Rnase and Dnase free distilled water (Invitrogen, Carlsbad, USA). A NanoDrop spectrophotometer (Thermo Fisher Scientific; Wilmington, DE, USA) was used to measure the concentration and purity of the isolated RNA, and RNA integrity was confirmed by agarose gel electrophoresis. To synthesize complementary DNA from the RNA, a SuperScript reverse transcriptase kit (Promega, USA) was implemented. Quantitative real-time polymerase chain reaction (RT-PCR) was performed by using an EvaGreen QPCR master mix (Solis BioDyne, Estonia) and with the following PCR criteria: initial denaturation (one cycle at 95°C for 15 min); denaturation, amplification, and quantification for 40 cycles at 95°C for 15 s, 56–64°C for 17 s, and 72°C for 25 s; melting curve at 65°C, with the temperature being gradually increased to 95°C. Expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as housekeeping gene was used to normalize mRNA expression and the changes were analyzed according to the standard curve and efficiency (E) for each primer. Primer sequences used for RTPCR are listed in table 1-PCR. Samples in each group were run in triplicate.

Table 1. Primer Sequences.

Sequence definition

Sense primer

Anti-sense primer

ALDH3A1

GAGACTTTCTCTCACCGCCG

TCAGTGCTGGGTCATCTTGG

Vimentin

TGCAGGAGGAGATGCTTCAG

AAGGTCAAGACGTGCCAGAG

ACTA2

CCGGGACTAAGACGGGAATC

ACAGAGCCCAGAGCCATTG

GAPDH

GAAGGTGAAGGTCGGAGTC

GAAGATGGTGATGGGATTTC

Statistical analyses Statistical analyses were carried out with one-way non-parametric ANOVA (Kruskal-Wallis test) in SPSS. Values considered significant (p

ZnAl-LDH aligned

Recommend Documents