1300
Langmuir 2007, 23, 1300-1302
Adsorption and Covalent Coupling of ATP-Binding DNA Aptamers onto Cellulose Shunxing Su,† Razvan Nutiu,‡ Carlos D. M. Filipe,† Yingfu Li,‡ and Robert Pelton*,† Departments Chemical Engineering, Biochemistry and Biomedical Sciences, and Chemistry, McMaster UniVersity, 1280 Main Street West, Hamilton, Ontario L8S 4L7, Canada
Downloaded via DURHAM UNIV on July 5, 2018 at 12:17:53 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
ReceiVed April 9, 2006 With the long-term goal of developing paper surfaces that will detect pathogens, we have investigated physical adsorption and covalent coupling as strategies for treating cellulose surfaces with a DNA aptamer that binds ATP. Physical adsorption was reversible and the isotherms fitted the Langmuir equation with an adsorption maximum of 0.105 mg/m2 at high ionic strength (300 mM NaCl, 25 mM Tris-HCl) and only 0.024 mg/m2 in lower ionic strength buffer (25 mM Tris-HCl). Covalent coupling of amine-terminated aptamer with oxidized cellulose film (Schiff base + reduction) gave 25% coupling efficiency while maintaining the aptamer activity which was illustrated by using a known fluorescent aptamer that is capable of ATP detection. Therefore, covalent coupling, without spacer molecules, is a promising approach for supporting biosensing aptamers on cellulose.
Introduction Paper is extensively used as a barrier for protection from pathogens in applications such as medical face masks and protective clothing, reflecting the fact that paper is inexpensive, disposable, and autoclavable and can have well-defined porosity. Nevertheless, in most protective applications, paper functions simply as a passive barrier or filter. Recognizing that the there is an opportunity to improve the functionality of paper, a network of Canadian academic researchers has embarked on a research program to develop “bioactive paper” which we define as paper which can detect, repel, or deactivate waterborne and airborne pathogens. A key requirement for bioactive paper is the presence of biorecognition molecules, coupled to a signaling mechanism on paper surfaces. Antibody fragments and enzymes are the most common biorecognition agents; however, these molecules are usually very fragile and would deteriorate when dried out on a paper surface. By contrast, DNA aptamers are far more robust and thus hold promise as paper-supported biosensing agents. DNA aptamers are short DNA oligonucleotides that can undergo structural rearrangement when in the presence of a specific target, resulting in the capture of the target. DNA aptamers have demonstrated the same high specificities as antibodies1,2 with pM range affinities. Furthermore, aptamers for a rapidly growing number of targets, including proteins, metals, and small molecules, have been obtained by in vitro selection, or SELEX3,4 (systematic evolution of ligands by exponential enrichment). This paper is an account of our initial attempts to deposit DNA aptamers onto cellulose surfaces in high yields while maintaining recognition activity. We employed an aptamer that specifically binds to ATP.5 The activity was measured using an anti-ATP structure-switching signaling aptamer developed by
* Corresponding author. E-mail:
[email protected]. Phone: (905)525-9140 ext. 27045. Fax: (905)528-5114. † Department of Chemical Engineering. ‡ Department of Biochemistry and Biomedical Sciences and Department of Chemistry. (1) Famulok, M.; Mayer, G.; Blind, M. Acc. Chem. Res. 2000, 33, 591-599. (2) Jayasena, S. D. Clin. Chem. 1999, 45, 1628-1650. (3) Tuerk, C.; Gold, L. Science 1990, 249, 505-510. (4) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-828. (5) Nutiu, R.; Li, Y. J. Am. Chem. Soc. 2003, 125, 4771-4778.
Figure 1. Principle of the ATP-binding structure-switching signaling aptamer: A duplex is formed between a fluorescently labeled DNA (FDNA) that contains a motif for ATP recognition and a short DNA molecule that is 3′ labeled with a quencher (QDNA) so that the quencher and the fluorophore are in close proximity. In the presence of ATP, the FDNA strand switches its configuration due to its high affinity for ATP, the QDNA strand leaves the duplex, and a fluorescence signal can now be detected. Figure adapted from Nutiu and Li.6
Nutiu and Li.5,6 In this approach, illustrated in Figure 1, a duplex is made from an aptamer sequence with a fluorescent terminus and an antisense oligonucleotide for the aptamer endcapped with a fluorescent quencher. The duplex does not fluoresce, whereas upon binding to ATP the quencher is sufficiently isolated from the fluorescent aptamer to permit a fluorescence signal. Described herein are results of both physical adsorption of aptamer onto cellulose and covalent coupling. To the best of our knowledge, this is the first account of combining aptamers and cellulose. Experimental Section Materials. Microcrystalline cellulose (MCC) powder with an average particle size of 20 µm and a specific surface area of 8.62 m2/g (measured by N2 BET) was obtained from Sigma. For the physical absorption experiment, the following fluorophore-labeled ATP-binding DNA aptamer was used: Fluorescein-C6 - 5′TCACTGACCTGGGGGAGTATTGCGGAGGAAGGT). For the covalent coupling experiment, another fluorophore-labeled ATP-binding DNA aptamer was used: Fluorescein-C6 -5′TCACTGACCTGGGGGAGTATTGCGGAGGAAGGTTTT3′-C6-amine). The quenching strand (QDNA) was 3′ labeled with 4-(4-dimethylaminophenylazo) benzoic acid (DABCYL-3′GTGACTGGACCC). DNA oligonucleotides were purchased from Keck Biotechnology Resource Laboratory, Yale University, or Integrated DNA Technologies (Coralville, IA) and were purified by reverse phase HPLC as described in the (6) Nutiu, R.; Li, Y. Angew. Chem., Int. Ed. Engl. 2005, 44 (7), 1061-1065.
10.1021/la060961c CCC: $37.00 © 2007 American Chemical Society Published on Web 11/23/2006
ATP-Binding DNA Aptamers onto Cellulose
Figure 2. Adsorption isotherms of an ATP-binding DNA aptamer onto microcrystalline cellulose. Both curves were calculated from the Langmuir equation using a binding constant of 0.42. The corresponding adsorption maximum is shown in the figure.
Figure 3. Confocal images of microcrystalline cellulose particles with adsorbed fluorescein-labeled ATP-binding DNA aptamer before (A) and after (B) washing with buffer. Fluorescent green regions in the original images appear as whiter regions when reproduced in black and white. literature. Sodium periodate and sodium cyanoborohydride were from Sigma-Aldrich, Canada. Regenerated cellulose dialysis tubing was from Spectrum Laboratories, Inc. (Spectra/Por 2 product No: 132724, 3500 Da molecular weight cutoff). Adsorption Studies. To a series of Eppendorf centrifuge tube (1.5 mL) containing 0.3 mL buffer and a range of FDNA concentrations was added 50 µL of MCC suspension (20 mg/mL in deionized water). Two buffers were used for the adsorption experiments: Buffer A, which maintains the activity of the ATP aptamer: (300 mM NaCl, 5 mM MgCl2, 25 mM Tris-HCl, pH ) 8.3); buffer B, to assess the effect of lower ionic strengths on adsorption (25 mM Tris-HCl, pH ) 8.3). The mixtures were shaken continuously for 24 h at room temperature. The suspensions were
Langmuir, Vol. 23, No. 3, 2007 1301 centrifuged (16000g, 5 min) and the supernatants were removed to determine the residual fluorescence intensity using a Cary Eclipse Fluorescence Spectrophotometer (Varian), using an excitation wavelength of 490 nm and an emission wavelength of 520 nm. A calibration curve made with FDNA as the standard solution was used to calculate concentrations. The adsorption results were plotted as isotherms, which were fitted to the Langmuir isotherm using nonlinear regression (EXEL solver). To evaluate the strength of aptamer binding, aptamer-coated MCC particles were washed with buffer. Treated MCC suspensions, corresponding to the highest aptamer equilibrium concentration in Figure 2, were centrifuged (1.5 mL tube), the supernatant was decanted, and the MCC was re-suspended in fresh buffer. The procedure was repeated four times and the amount of aptamer in the combined supernatants was determined from the fluorescence intensity. The indirect measurements of aptamer adsorption and removal from MCC particles were verified by direct fluorescent imaging using a Zeiss LSM 510 laser scanning confocal microscope. A stack of images in the xy plane was taken through the z direction from which the projection images of the xy plane were generated. The number of images for each stack was adjusted to ensure that the spacing between each image was less than 2 µm in the z direction. The published images were combinations of the stack of images. Covalent Binding of the ATP Structure-Switching Signaling Aptamer to Cellulose. A sample consisting of 0.23 g of regenerated cellulose dialysis tubing cellulose membrane was boiled three times in Milli-Q water. The sample was then transferred to a vial containing 50 mL of 0.03 M NaIO4 and allowed to react at room temperature (in the dark) for 4 h. This oxidation reaction generated aldehyde groups on the surface of the membrane.7 After reaction, the membrane was washed thoroughly with Milli-Q water. For coupling with FDNA, a 3 mm diameter circle of the oxidized cellulose membrane was transferred to an Eppendorf centrifuge tube (1.5 mL) containing 0.1 mL of 200 mM NaCNBH3 and phosphate buffer (100 mM, pH 7.2), to which 2 µL of the FDNA aptamer (50 µM) was added. After soaking at room temperature for 10 h and in the dark, the membrane was washed three times with phosphate buffer (0.5 mL each time) and the fluorescence on the discarded supernatants was measured to quantify the coupling. To prepare FDNA-QDNA duplex, the FDNA containing cellulose membrane was placed in 90 µL of binding buffer (300 mM NaCl, 5 mM MgCl2, 25 mM Tris-HCl, pH ) 8.3) in an Eppendorf centrifuge tube (1.5 mL), and after 10 µL of QDNA (10 µM) was added, the suspension was incubated at room temperature for 1 h with stirring. To demonstrate switchability of the signaling aptamer, 2 µL of ATP (100 mM) was added and the suspension was incubated at room temperature for 1 h. To demonstrate that the specificity of the structure-switching aptamer was maintained, a similar experiment was done using 2 µL of GTP instead of ATP. Confocal laser microscopy was used to determine the fluorescence intensity of the cellulose membrane before addition of quencher DNA, after incubation with QDNA, and after incubation with either ATP or GTP. A control experiment, using cellulose membrane that did not contain FDNA, was done to ensure that changes of fluorescence were not associated with the membrane on its own. The fluorescence intensity analysis on the cellulose membrane was carried out with ImageJ image analysis software. The percentage change was calculated as (Intensity with ATP - Intensity with QDNA)/(Intensity with FDNA - Intensity with QDNA).
Results and Discussion The ATP-binding DNA aptamer was mixed with microcrystalline cellulose (MCC) suspension in buffer and the adsorption isotherm was measured at two ionic strengths. The results are shown in Figure 2. The solid lines were fits to the Langmuir isotherm using the same binding constant for both data sets, (7) Kim, U. J.; Kuga, S.; Wada, M.; Okano, T.; Kondo, T. Biomacromolecules 2000, 1, 488-492.
1302 Langmuir, Vol. 23, No. 3, 2007
Su et al.
Figure 4. Confocal images of cellulose film surfaces demonstrating the functionality and specificity of the ATP-binding structure-switching signaling aptamer: cellulose membrane before coupling FDNA (A), after coupling FDNA (B), after addition of QDNA (C), and after addition of either ATP (D) or GTP (E). The white distance bars correspond to 50 µm.
suggesting that both adsorption and desorption rate constants had similar ionic strength dependencies. The maximum adsorption values were 0.105 mg/m2 for buffer A (higher ionic strength buffer) and 0.024 mg/m2 for buffer B (lower ionic strength buffer). Under these conditions the MCC was slightly negatively charged (electrophoretic mobilities of -0.29 ( 0.19 × 10-8 m2/V‚s and -0.73 ( 0.04 × 10-8 m2/V‚s in buffers A and B, respectively). Thus, electrostatic interactions opposed adsorption of anionic oligonucleotide, and the amount of adsorption increased with ionic strength. The strength of the aptamer-cellulose interaction was probed by washing experiments. Aptamer-treated MCC was washed five times (0.3 mL each) with buffer using a centrifuge. Fluorescent analysis of the supernatant confirmed that the bound aptamer was completely removed. We also performed confocal fluorescence microscopic imaging to obtain visual confirmation of the removal of the ATP-binding aptamer from the surface of the MCC powder during washing. Figures 3A and 3B reveal that all the fluorescence initially present in the sample is lost after washing. Physical adsorption is too weak to be a useful strategy for attaching short oligonucleotides to cellulose. Covalent coupling was evaluated as an alternative. Cellulose membrane (dialysis tubing) was oxidized to give surface aldehyde groups. The FDNA strand (fluorescein labeled at the 5′-end) of an ATP-binding aptamer was coupled via the terminal amino group at 3′ using a Schiff Base reaction plus reduction. The coupling efficiency of the FDNA strand to the membrane was found to be approximately 25%, determined by measuring the fluorescence in the supernatant before and after coupling. Figure 4A shows that the level of membrane fluorescence before coupling the FDNA was very low, but increased dramatically after coupling the FDNA to the membrane (Figure 4B). Functionality of the cellulose-supported structure-switching aptamer was demonstrated by three observations: 1. Exposure of the FDNA-treated cellulose surface to QDNA,
the quencher-terminated antisense oligonucleotide, resulted in a loss of fluorescence because of the formation of a duplex in which the quencher was in close proximity to the fluorophore. Comparison of Figure 4B with Figure 4C shows the effect of adding 1 × 10-10 mol of QDNA. 2. Addition of ATP to the surface-coupled FDNA/QDNA duplex resulted in the displacement of the QDNA strands, giving a large increase in fluorescence. Comparison of Figure 4D with Figure 4C shows that the addition of 2 × 10-7 mol of ATP resulted in about a 30% increase of fluorescence. 3. Addition of GTP instead of ATP did not give a change in fluorescence, shown by comparing Figure 4E (GTP added) to Figure 4C (FDNA/QDNA duplex intact). Thus, the covalently coupled aptamer maintained its specificity for ATP.
Conclusions In this paper, we show that the physical adsorption of an ATPbinding DNA aptamer onto microcrystalline cellulose is weak and fully reversible. Thus, physical adsorption is not a suitable strategy for imparting biological specificity to cellulose surfaces using aptamers. On the other hand, we demonstrated that the activity and specificity of an ATP-binding structure-switching signaling aptamer is maintained after covalently coupling it to the cellulose surface with no spacers. Apparently the amorphous hydrophilic nature of regenerated cellulose is particularly suited for maintaining DNA aptamer activity. Preliminary work with paper surfaces has shown that aptamer activity can be maintained after drying when the paper is re-wetted with buffer. Acknowledgment. The authors thank the Natural Sciences and Engineering Research Council of Canada (NSERC) for funding this work through a network grant - SENTINEL Canadian Network for the Development and Use of Bioactive Paper. Buckman Laboratories is also thanked for financial support of this work. R.P. and Y.L. are holders of Canada Research Chairs. LA060961C
