Caged siRNAs with Single cRGD Modification for Photoregulation of

Subscriber access provided by Monroe Library | Loyola University New Orleans

Article

Caged siRNAs with single cRGD modification for photo-regulation of exogenous and endogenous gene expression in cells and mice Lijia Yu, Duanwei Liang, Changmai Chen, and XinJing Tang Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.8b00159 • Publication Date (Web): 04 May 2018 Downloaded from http://pubs.acs.org on May 6, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Caged siRNAs with single cRGD modification for photo-regulation of exogenous and endogenous gene expression in cells and mice Lijia Yu, Duanwei Liang, Changmai Chen, and Xinjing Tang* State key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences and Center for Noncoding RNA Medicine, Peking University, No. 38, Xueyuan Rd, Beijing 100191, China. KEYWORDS: photoregulation, caged oligonucleotides, siRNAs, gene expression, cRGD modification

ABSTRACT: RNA interference (RNAi) mediated gene silencing holds significant promise in gene therapy. It is very important to manually regulate the activity of small interference RNAs (siRNAs) in the controllable mode. Here, we designed and synthesized a series of caged siRNAs through bioconjugation of cyclo(Arg-Gly-Asp-DPhe-Lys) (cRGD) peptide to the 5' end of siRNA through a photolabile linker. These cRGD modified caged siRNAs allowed for precise light-regulation of gene expression of two exogenous reporter genes (firefly luciferase and green fluorescent protein, GFP) and an endogenous gene (the mitosis motor protein, Eg5) in the integrin αvβ3 positive cells. This kind of bioconjugate further enabled photochemical activation of siRNA activity, and the target gene silencing was successfully achieved in tumor-bearing mice

ACS Paragon Plus Environment

1

Biomacromolecules 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 31

by intratumoral injection. This study also suggested that photomodulation of target gene expression using single cRGD caged siRNA at 5' end of antisense strand RNA inhibited siRNA activity probably due to three factors: 1) trapping of cRGD modified siRNA in endosome and lysosome, 2) the steric hindrance of cRGD, 3) the binding of cRGD to its corresponding receptor.

Introduction Small interfering RNA (siRNA) is a powerful tool for repressing the synthesis of a particular protein in vitro and vivo by RNA interference (RNAi)1. Since RNAi harnesses a natural pathway that can turn off gene expression at the post-transcriptional level even before protein translation occurs, siRNA induced down-regulation of gene expression has a tremendous impact on the basic and applied researches. Chemical modifications of siRNAs and their delivery systems have been suggested for the improvement of intracellular siRNA delivery and pharmacokinetic properties, including the assembly of siRNA with liposomes, lipids, polymers, peptides, virusbase vectors and the conjugation of targeting molecules, such as cholesterol, folic acid and cell growth factors2-8. These siRNA bioconjugates significantly enhance their delivery efficiency to the target cells and/or tissues. However, the covalent conjugation might significantly affect gene silencing of siRNA activity depending on different structures of labeling moieties9,10. In order to solve this problem, various methods were developed, to regulate the siRNA activity by introduction of stimulus response groups, such as light, pH, enzyme.11 Light irradiation attracts more attentions due to its easy modification and precise manipulation. Now this shortcoming could be used to achieve the possible manual regulation of siRNA activities through light


2

Page 3 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

activation, which could be realized by inserting a photolabile linker between target moieties and the cargo oligonucleotides. The photocaging strategies have been developed to achieve the photochemical control of many cellular processes12-24. The siRNA activity can be temporarily masked by caging group, and can be restored upon light activation. There exist different caging strategies for photoregulation of siRNAs activity, including caging nucleobases or phosphate backbones to block Dicer/siRNA binding or processing. However, the heavily caged siRNAs might be accompanied with the incomplete restoration of siRNA activity25. Previous works have shown that modification at 5' end antisense oligonucleotide of siRNA played an important role in the photoregulation of gene expression26, 27. Large bulky steric group inserted at two ends could enhance inhibition of siRNA activity due to blocking Dicer or nuclease processing. We aimed to construct a simple caging siRNA strategy to realize the photoregulation of gene expression. Herein, we designed and synthesized caged siRNAs modified with a targeting ligand, cyclic cyclo(Arg-Gly-Asp-D-Phe-Lys) (cRGD) peptide, in order to precisely photoregulate RNAi therapy. The cRGD could specifically bind to integrin αvβ3 receptor, which is an important biomarker overexpressed on the surface of angiogenic endothelium and malignant glioma cells2830

. cRGD itself not only has relatively large steric hindrance, but also can bind to its integrin αvβ3

receptor to further enhance the blocking effect on siRNA activity and inactivate RNA-induced silencing machinery. Upon a brief UV irradiation, photolabile linker, together with the linked cRGD, were removed from modified siRNAs, activating the siRNA activity and resulting in the silencing of gene expression. cRGD modified caged siRNAs were successfully achieved to photocontrol gene expression of two exogenous reporter genes (firefly luciferase and GFP) and an endogenous target gene of Eg5. Moreover, the photoregulation of gene silencing in vivo was


3


Page 4 of 31

also achieved in tumor-bearing mice through intratumoral injection of cRGD-caged siRNAs. Thus, caged siRNAs with a single cRGD modification was successfully developed for efficient photoregulation of gene silencing both in vitro and vivo. Experimental section Synthesis of phosphoramidites of photolabile linker, alkyl linkers, and cRGD modified RNA oligonucleotides The phosphoramidites of photolabile linker PL-1 and two alkyl linkers were synthesized (in supporting information) and were coupled to 5' end of RNAs through solid phase oligonucleotide synthesis, respectively. RNA synthesis was performed using an Applied Biosystems Model 394 automated DNA/RNA Synthesizer using standard β-cyanoethyl phosphoramidite chemistry. The photolabile linker PL-1 and linker 1 were inserted to 5' end of RNA strands. The linker 1 with carboxyl terminus was further conjugated with the amino group of cRGD through amide formation in DMF solution for 24 h. Then cRGD modified caged RNAs on solid support were obtained. Linker 2 with longer alkyl group was inserted between the photolabile linker and liner 1 according to the same coupling condition. The cleavage and deprotection of all these native and modified RNA oligonucleotides were performed using AMA solution (1:1 mixture (v/v) of aqueous ammonium hydroxide (28%) and aqueous methylamine (40%)). Then the solutions were concentrated. The residues were fully dissolved in anhydrous 50 µL DMSO, and 50 µL triethylamine trihydrofluoride was then added. The mixture was shaken at 65oC for 2 h in order to remove the silyl protecting groups of 2'-hydroxyl group. The oligonucleotide solutions were cooled and precipitated via butanol and NaOAc (3M). All these native RNAs were then purified using Waters 2695 HPLC under the reversed-phase conditions: A, 0.05 M, triethylammonium


4

Page 5 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

bicarbonate buffer (TEAB, pH 8.5); B, acetonitrile (ACN), 0-15% in 20 min. All these cRGDmodified RNAs were purified using same HPLC column (C18) purification under the conditions: A, 0.05 M TEAB; B ACN, 0-25% in 25 min. All mass spectra were obtained using electrospray ionization (ESI). PAGE gel shift assay The 20% native PAGE gel was prepared to study the mobility of single- or double- stranded caged RNA oligonucleotides. The siRNA duplex was formed by mixing two complementary RNAs, hybridized with their complementary sense strand RNAs. All these modified siRNA and native siRNA were loaded to 20% native PAGE gels for analysis before and after UV irradiation. All PAGE gels were performed at 200 V for 1 h and imaged using the ChemiDoc XRS after staining with SYBR Gold nucleic acid gel stain (Invitrogen). The serum stability assay was carried out in 50% (v/v) fetal bovine serum (FBS). Native siRNAs or cRGD modified caged siRNAs were incubated at 37°C in 50% FBS solution to make a final concentration of 2.5 µM (45 µL). 5 µL of solution was aliquoted at different time points, and was immediately frozen in liquid nitrogen and then stored at -80°C before assaying. All samples were than analyzed using PAGE gels. Cell culture The U87MG (human glioblastoma cell) cell line was generously donated by Prof. Demin Zhou, from Peking University Health Science Center. The U87MG cells stably expressing enhanced green fluorescence protein (U87MG-GFP) were kindly provided by Prof. Shengrong Guo from the School of pharmacy, Shanghai Jiao Tong University. U87MG cells and U87-GFP


5


Page 6 of 31

cells were cultured in DMEM supplemented with 10% v/v FBS and 1% v/v penicillinstreptomycin at 37oC with 5% CO2, respectively. Luciferase assay for cRGD caged siRNAs Exogenous reporter gene (firefly luciferase with renilla luciferase as internal control) was firstly chosen to evaluate gene silencing activity of native and caged siRNAs. The reporter plasmids and corresponding siRNAs were cotransfected into cells using Lipofectamine 2000 (lipo 2000) in the optiMEM medium. After 4 h incubation, cells were divided to two groups. One group was kept in dark, the other one was irradiated with UV light (365 nm, 7 mW/cm2 for 3min) to activate photolabile siRNAs. Two groups were then washed by 1×PBS buffer twice, followed by the addition of fresh DMEM. The cells were then incubated for additional 24 h. After the media was removed, a dual-luciferase assay (Promega) was performed. Luminescence intensity of firefly luciferase was normalized to that of renilla luciferase. All experiments were performed in triplicate, and the error bars represent the standard deviation in three independent experiments. GFP assay for cRGD modified caged siRNA In the case of U87MG-GFP cells, the corresponding siRNAs (10 nM AG/SG, 10 nM RpAG/SG and 10 nM RAG/SG) were co-transfected to cells using RNAi MAX in the optiMEM medium. After cotransfection for 6 h, cells in 6 wells were divided to two groups. One group was kept in the dark, and the other one was irradiated (3 min, 365 nm). The medium was replaced, and the cells were incubated for 48 h. Cells were then imaged by fluorescence microscopy (Olympus, IX83). GFP gene silencing was then quantified by flow cytometry. Analysis was


6

Page 7 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

performed on software CytExpert. All experiments were performed in triplicate, and the error bars represented the standard deviation in three independent experiments. Confocal laser scanning microscopy The intracellular distribution of cRGD modified caged siRNA in living cells was examined using a laser scanning confocal microscope. Cy3-labeled sense strand RNA (Cy3-SL) was hybridized with native antisense strand (AL) or cRGD caged antisense strand (RpAL) to form Cy3-labeled native siRNA (Cy3-SL/AL) or cRGD caged siRNA conjugates (Cy3-SL/RpAL). Under the same conditions, Cy3-labeled siRNAs (50 nM) were transfected to the cells using lipo 2000. After 4 h incubation, the medium was replaced with fresh DMEM medium. After treatment for additional 2 h or 12 h, Hoechst 33342 and lysotracker green were added to stain nucleus and lysosomes, respectively. Colocalization of Cy3-SL/AL or Cy3-SL/RpAL with lysotracker green was accomplished via confocal microscopy, respectively. In addition, colocalization with FITC-labeled SL/RpAL (50 nM) with Alexa594-labled cholera toxin B (12 µg/mL, as markers for lipid rafts) was also accomplished via confocal microscopy. Uptake pathway experiments The cellular uptake mechanism of cRGD modified caged siRNA in the U87MG cells was examined by flow cytometry. Prior to the siRNA transfection, different endocytosis inhibitors diluted in optiMEM medium were added to U87MG cells for 2 h or 4oC for 1 h. Then, Cy3labeled SL/RpAL was cotransfected to cells with lipo 2000 for 4 h, and the cells were washed and replaced with fresh DMEM. After additional 2 h incubation, U87MG cells were trypsinized, harvested by centrifugation, and resuspended in PBS buffer. Cells were analyzed on


7


Page 8 of 31

FACSCalibur flow cytometer for the mean fluorescence value to evaluate cellular uptake of Cy3 labeled siRNA in the presence of different endocytosis inhibitors. Phenotypic Eg5 inhibition assay Cells were passaged to 6 well chamber slides (1×105 cells/well) and grown to 70-80% confluence within 24 h. The corresponding control and cRGD caged siRNAs with lipo 2000 (1 µL/well) were cotransfected to cells. After 4 h incubation at 37℃, cells in 6 wells were divided to two groups. One group was kept in the dark, and the other was irradiated (3 min, 365 nm). The medium was replaced, and the cells were incubated for 48 h. Then the cells were fixed with formaldehyde (4%) and stained with Hoechst 33342 (Invitrogen). And the cells were then imaged using laser scanning confocal microscope. Real time-qPCR U87MG cells were passaged to 12-well plates (1 mL per well, ~1.0×105 cells/well) and grown to 70-80% confluence with 24 h. The cells were transfected with 1 nM corresponding control and cRGD caged siRNAs with lipo 2000 for 4 h. The treated cells were divided to two groups. One group was kept in the dark, and the other was irradiated for 3 min. After additional 48 h incubation, the cells were collected and total RNAs were isolated with TRIZOL reagent (Invitrogen). Eg5 cDNAs were then synthesized with Superscript Reverse Transcriptase II (Invitrogen) and then real time-polymerase chain reactions (RT-PCRs) were performed using SsoFast EvaGreen Supermix (Bio-Rad). The following primer sequences were used: Eg5 forward

primer

5'

CAGCTGAAAAGGAAACAGCC,

ATGAACAATCCACACCAGCA, TGCACCACCAACTGCTTAGC,

GAPDH and

GAPDH

Eg5

reverse

forward reverse

primer

primer primer

5' 5' 5'


8

Page 9 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

GGCATGGACTGTGGTCATGAG. The threshold cycles (Ct) of each sample were normalized to the GAPDH housekeeping gene, and the inhibition of gene silencing is represented as the percent of Eg5 expression. Cell cycle analysis U87MG cells were treated according to previous experiments of real time-qPCR using 1 nM corresponding control and cRGD caged siRNAs. The two same groups were divided. One group was kept in the dark, and the other group was irradiated (3 min, 365 nm). After additional 48 h incubation, cells were washed by PBS, trypsinized, harvested by centrifugation. The cells were then fixed in 70% ice-cold ethanol and stored at 4℃ for 24 h. The cells were pelleted by centrifugation and washed with PBS twice, followed by incubation with RNase A and staining with propidium (0.1 mg/mL) in the staining buffer for 30 min in the dark. The DNA content was measured using flow cytometry, and the percentage of cells in each phase of the cell cycle was evaluated by the ModFit software. Xenograft tumor fluorescent assays BALB/c nude mice (6 weeks) were injected subcutaneously in the inner thighs with 6×105 U87MG-GFP cells in a volume of 60 µL. When the tumor volumes reached around 2-3 mm3, the mice were randomly divided into three groups for different treatments. The corresponding siRNAs were mixed with 20 µL transfection regents (Entranster-in vivo; Engreen, Beijing, China), then incubated for 15 min. The final volume was 60 µL. For the first group, tumors in the left thigh were injected with 3 nmol native siRNA and tumors in the right were injected with 1×PBS on the right. The second group was treated similarly as the first group but with light irradiation ( 365 nm, 15 mW/cm2). For the third group, tumors in both thighs were injected with


9


Page 10 of 31

3 nmol cRGD caged siRNA. Then, left side tumor was covered to avoid light activation and the right tumors were irradiated for 5 min (365 nm, 15 mW/cm2) after 3 h intratumoral injection. The progression of tumors in all mice was imaged and quantitatively measured at 0 h, 12 h, 24 h, 48 h and 72 h using the Maestro Automated in-vivo imaging. Statistical analysis Each value is expressed as mean ± SD. The significance of differences in the mean values of each group was evaluated by using analysis of GraphPad Prism 5, followed by t tests method for analysis of significance (at least 3 tumor data for each case). Differences were considered significant when the p-value was ≤ 0.05. Results and discussion Rational design, synthesis and characterization of caged siRNAs with single cRGD modification. cRGD caged siRNAs were synthesized by inserting the photolabile group between cRGD and 5' end of RNA strand through solid phase synthesis as shown in Scheme 1. The phosphoramidites of photolabile linker (PL-1) and two alkyl linkers (linker 1 and linker 2) were synthesized (supporting information). These linkers were then coupled at 5' end of RNA on solid support using standard solid synthesizer, respectively31. Two linkers with different length between caging moiety and cRGD were applied in order to evaluate the effects of ligand binding to their corresponding receptor on gene silencing activities of caged siRNA with single cRGD modification. As shown in Table 1, a total of 14 RNA oligonucleotides were synthesized for further investigation.


10

Page 11 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Scheme 1. Synthesis of cRGD modified RNA strands. PL-1: photolabile group. Linker 1: 3[[[bis

(1-methylethyl)amino](2-cyanoethoxy)phosphino]oxy]]-2,2-dimethyl-,

2,5-dioxo-1-

pyrrolidinyl ester. Linker 2: N, N-bis(1-methylethyl)-,6-[bis(4-methoxyphenyl) phenylmethoxy] hexyl 2-cyanoethyl ester. cRGD: cyclic arginine-glycine-aspartate (cRGD) peptide. Step a, c and d using the RNA standard solid synthesizer31. Step b and e, N,N-Diisopropylethylamine (DIPEA) in DMF. In order to demonstrate the photoactivation of cRGD modified caged oligonucleotides, single strands or double strands of cRGD modified caged RNAs were irradiated and analyzed via gel shift assay (Figure 1). The cRGD modified caged single-stranded RNA (lane 2, RpAL) and double-stranded RNA (lane 5, RpAL/SL) showed slightly reduced mobility compared to their corresponding native RNAs on PAGE gel. Upon UV irradiation (365 nm, 3 min), the cRGD


11


Page 12 of 31

modified caged RNAs could be activated, resulting in the generation of native single-stranded RNA (AL) and double-stranded RNA (AL/SL) (Figure S4, supporting information). After 3 min light irradiation, we found that cRGD with caging residue was released from caged RNA, and mass data of these uncaged oligonucleotides was restored to the native single stranded RNA with terminal phosphate group. This result further confirmed that the photorelease of cRGD modified caged siRNA could be achieved after irradiation. Table 1. List of unmodified RNA and cRGD modified RNA strands used in this study.

Name GFP

Firefly Luciferase

Eg5

AG SG RpAG RAG AL SL RAL RSL RpAL RpSL RpLAL SE AE RpAE

Sequence（5'-3'）

CUUGAAGAAGUCGUGCUGCTT GCAGCACGACUUCUUCAAGTT cRGD-L1-PL-CUUGAAGAAGUCGUGCUGCTT cRGD-L1-CUU GAA GAA GUC GUG CUG CTT GCGAAGAAGGAGAAUAGGGTT CCCUAUUCUCCUUCUUCGCTT cRGD-L1-PL- GCGAAGAAGGAGAAUAGG GTT cRGD-L1- CCC UAU UCU CCU UCU UCG CTT cRGD-L1-PL- GCGAAGAAGGAGAAUAGGGTT cRGD-L1-PL- CCC UAU UCU CCU UCU UCG CTT cRGD-L1-L2-PL- GCGAAGAAGGAGAAUAGGGTT CAA CAA GGA UGA AGU CUAUTT

AUA GAC UUCAUCCUUGUUGTT cRGD-L1-PL-AUAGACUUCAUCCUUGUUGTT

p or PL represents photolabile linker; R represents cRGD; L1 represents linker 1; L2 represents linker 2; AL: antisense strand of firefly luciferase; SL: sense strand of firefly luciferase; AG: antisense strand of GFP, SG: sense strand of GFP; SE: sense strand of Eg5; AE: antisense strand of Eg5.

.


12

Page 13 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 1. Gel shift assay of caged antisense strand RNA (RpAL) or its siRNA duplex (RpAL/SL) with cRGD modification at 5' end before and after UV irradiation (3 min, 365 nm). Lane 1: AL. Lane 2: RpAL (-UV). Lane 3: RpAL (+UV). Lane 4: AL/SL. Lane 5: RpAL/SL (UV). Lane 6: RpAL/SL (+UV).

Photoregulation of gene silencing of firefly luciferase and EGFP Light-activation of cRGD modified caged siRNA for targeting firefly luciferase. To show the effect of cRGD modified caged siRNA on target gene silencing, we firstly applied a dual reporter firefly/renilla luciferase assay with siQuant vectors. These cRGD conjugated caged siRNAs were evaluated in U87MG cells which are integrin αvβ3 positive cells32. As shown in Figure 2a, U87MG cells were transfected with siQuant vectors as well as NC (negative control), PC (positive control) and different concentrations of cRGD modified caged siRNA (RpAL/RpSL), respectively. After 4 h incubation in the dark, the cells were divided to two groups. One group was irradiated by light


13


Page 14 of 31

Figure 2. (a) Dose effect on photomodulation of firefly luciferase activity using caged cRGDsiRNA (RpAL/RpSL) in U87MG cells. The concentration of PC siRNA was fixed at 10 nM (n=3). (b) Photomodulation of firefly luciferase activity using caged siRNAs with different composition of cRGD modification and/or photolabile linker (n=3).

(3 min, 365nm) and the other group was kept in dark. After incubation for 24 h, cRGD modified caged siRNA showed almost no siRNA activity before light irradiation. However, upon light irradiation, the firefly luciferase expression was largely down-regulated in does-effect response,


14

Page 15 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

confirming that cRGD could be cleaved from cRGD modified caged siRNA to release the active siRNA and inhibit firefly luciferase gene expression. Single cRGD modification at the 5' end of caged antisense strands (RpAL/SL) also effectively blocked siRNA activity until light activation and exhibited the dose-effect response after UV irradiation (Figure S6, supporting information). These results confirmed that our design of cRGD modified caged siRNA could successfully achieve the photoregulation of the targeting firefly luciferase gene expression. Different modifications at 5′ end of siRNAs were also investigated using siQuant vectors. As shown in Figure 2b, siRNA modified with cRGD at 5' end of antisense strands without photolabile group (RAL/SL, RAL/RpSL and RAL/RSL) showed no gene silencing effect before and after UV irradiation. And there was no photomodulaton of siRNA activity in the case of cRGD modification on sense strand RNA (AL/RpSL and AL/RSL). These data indicated that modification at 5' end of antisense strand of siRNA with caging moiety and cRGD played very important roles in photo-regulation of gene expression. Light-activation of cRGD modified caged siRNAs for targeting EGFP. In order to confirm the generality of gene silencing with our caged cRGD-siRNAs, U87MG-GFP cells stably expressing enhanced green fluorescence protein33 was used to investigate reporter GFP gene knockdown before and after light irradiation. As shown in Figure 3, cRGD modified caged siRNAs (RpAG/SG) or native siRNAs (AG/SG) were transfected to U87MG-GFP cells for 6 h. After 48 h incubation, the cells were imaged by fluorescence microscopy and quantified by flow cytometry. Figure 3a indicated that the mean value of the green fluorescence intensity from U87MG-GFP cells was obviously reduced after cells were treated with native siRNA (positive control) and showed about 40% down-regulation of GFP expression. In the presence of RAG/SG


15


Page 16 of 31

without the photolabile group, there was also no difference on gene silencing before and after light irradiation.

Figure 3. Photomodulation of GFP expression using cRGD modified caged siRNAs and their corresponding control siRNA in U87MG-GFP cells. (a) Fluorescent images of GFP expression under different conditions, the scale bars is 100 µm (n=3). (b) GFP fluorescence quantitative analysis before and after light irradiation (365 nm, 3 min) using flow cytometry (n=3).

However, in the presence of RpAG/SG, about 90% of GFP expression in cells was still observed prior to light irradiation, indicating that cRGD modified caged siRNA was nearly inactive. Light


16

Page 17 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

irradiation removed the cRGD blocking group together with photolabile linker, and restored siRNA activity for GFP gene silencing. The expressed GFP level in U87MG-GFP cells was significantly reduced. As shown in Figure 3b, gene silencing caused by uncaged RpAG/SG was 33% in comparison to the negative control after UV irradiation, which was close to native siRNA (40%). Light-activation of cRGD modified caged siRNAs for targeting endogenous Eg5. To demonstrate applicability of light-activation approach for endogenous gene, cRGD caged siRNA (RpAE/SE) targeting the endogenous Eg5 gene was developed. Eg5 is a member of the kinesin-5 family and is an essential gene involved in the regulation of the cell cycle, specifically for bipolar spindle formation. Inhibition of Eg5 results in the arrest of a multitude of cellular functions, including spindle formation, mitosis, and cell proliferation18, 34, 35. After 4 h transfection of cRGD caged siRNA (RpAE/SE) in the dark, U87MG cells were divided to two groups. One group was irradiated by light (3 min, 365 nm) and the other group was kept in the dark. After additional 48 h incubation, cells were fixed, stained with Hoechst 33342 to label cell nuclei and imaged using confocal microscope. The negative control cells displayed no obvious change in the phenotype of cell nuclei in the presence or absence of light irradiation (Figure 4a). As expected, the positive control cells with Eg5 siRNA transfection led to abnormal phenotypes with more cells showing 2-3 nuclei due to Eg5 gene silencing and cell cycle arrest with mitosis18. Caged RpAE/SE transfection without light activation displayed the normal phenotype identical to that of the negative control, indicating that cRGD caged Eg5 siRNA are functionally inactive for Eg5 gene expression. After a brief irradiation, more cells were found to show abnormal phenotypes that were similar to the positive control cells treated with Eg5 siRNA. This


17


Page 18 of 31

observation indicated that we could successfully achieve photoregulation of Eg5 induced cell phenotypes using cRGD caged siRNA.

Figure 4. (a) Light-activation Eg5 gene using native siRNA (AE/SE) or cRGD caged siRNA (RpAE/SE) in U87MG cells. The cells were fixed and stained with Hoechst 33342 (blue); (b) DNA content of G2/M in the cell cycle of U87MG cells (n=3) after cells were treated with AS/SE or RpAE/SE before or after light activation; (c) Relative Eg5 mRNA in U87MG cells


18

Page 19 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(n=3) after cells were treated with AS/SE or RpAE/SE before or after light activation. GAPDH was used as internal control. The concentrations of siRNAs were 1 nM. Error bars represent standard deviations from three independent experiments. The photoregulation of gene expression using RpAE/SE was also illustrated in G2/M phase arrests. As shown in Figure 4b and Figure S7 (supporting information), the DNA content of the negative control in the G2/M was similar with or without light irradiation, which indicated little obvious influence of UV irradiation. The DNA content of positive control of Eg5 siRNA treatment was 10.8% before UV irradiation and little effect of light irradiation on G2/M phase arrests was observed. However, caged siRNA (RpAE/SE) fully lost its siRNA gene silencing activity with 3.3% DNA content observed similar to that of negative control. Upon light irradiation, caged RpAE/SE was activated and Eg5 siRNA activity was recovered with 9.5% DNA content detected. These data also suggested that the boosted G2/M phase arrest observed for irradiated RpAE/SE was also a result of the recovery of siRNA activity after light irradiation. To quantify the photoregulation of Eg5 gene expression at mRNA level with caged Eg5 siRNA, total RNAs were isolated from cells transfected with the corresponding siRNAs and were then subjected to real-time qPCR analysis36. Eg5 expression was normalized to endogenous housekeeping gene GAPDH was used as internal control and Eg5 mRNA levels were normalized to negative control experiment. As shown in Figure 4c, Eg5 positive control siRNA (AE/SE) silenced target gene expression with mRNA level down to 31% in comparison to negative control. Caged RpAE/SE completely inactivated the siRNA with almost no effect of Eg5 mRNA. However, light activation down-regulated mRNA level (~41%). These results confirmed that cRGD caged siRNA could be activated after UV irradiation, which further successfully photomodulated mRNA level of target Eg5 gene. Combined with cell nuclei phenotypes and


19


Page 20 of 31

G2/M phase arrests, it clearly indicated that our caging strategy for siRNA was promising for successful photomodulation of both exogenous and endogenous genes. Subcellular localization and uptake pathway. To understand cRGD caged siRNA conjugates for efficient photomodulation of gene silencing, we firstly traced the location and lysosomal escaping ability of native siRNA (SL/AL) and cRGD modified caged siRNA (SL/RpAL) with lipo 2000 using LysoTracker Green as a late endosome and lysosome marker by confocal laser scanning microscopy. A Cy3-labeled sense strand RNA analog was used for hybridization with AL or cRGD modified caged AL (RpAL). After co-transfection, the cells were washed and cultured for additional 4 h and 12 h, and were stained with lysotracker green. The cells were then imaged (Figure S8, supporting information). After 4 h, cells cotransfected with Cy3-SL/AL or Cy3-SL/RpAL contained bright red fluorescence spots of siRNA/lipo complexes and showed low overlapping with lysotracker green. After 12 h, a significant difference between Cy3-SL/AL and Cy3-SL/RpAL was observed. Since cells co-transfected with Cy3-SL/AL had a certain fluorescence red spots left and Pearson correlation coefficient with lysotracker green was nearly no changes. However, for cells cotransfected with Cy3-SL/RpAL, colocalization of Cy3-SL/RpAL with lysotracker green increased over time, suggesting that Cy3-SL/RpAL could be gradually trapped in late endosomes and lysosomes. We further compared the distribution of Cy3-SL/RpAL before and after UV irradiation (Figure S9, supporting information). After UV irradiation, we found that low overlapping of siRNA with lysotracker green was observed. This result was consistent with the native siRNA, suggesting that the cRGD modification of siRNA changed the distribution in the cell. The observation was consistent with the previous reports which indicated that integrinmediated endocytosis firstly delivered siRNA to early endosomes with clathrin- or caveolin-


20

Page 21 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

dependent mechanisms37. Thus, cRGD modified siRNA might be more easily entrapped in the lysosomes that would inhibit siRNA escape from liposomes. Thus, our results suggested that caged siRNA trapping in late endosomes or liposomes might be one of factors that cRGD caged siRNA could block siRNA activity and light activation could enhance siRNA escaping from endosomes or liposomes. To further clarify the uptake pathway of cRGD modified caged siRNA, we investigated the uptake pathway using a series of endocytosis inhibitors, such as chlorpromazine (clathrindependent endocytosis), genistein (cavelin-mediated endocytosis), amiloride (mocropinocytosis) and methyl-β-cyclodextrin (lipid raft-dependent endocytosis)38. The endocytosis of αvβ3 integrin mediation can go through by both clathrin-dependent and caveolar endocytosis. Here, the cRGD caged siRNA was incubated in U87MG cells in the presence of nontoxic concentrations of selected inhibitors, and results are summarized in Figure S10 (supporting information). Only chlorpromazine could greatly reduce the uptake of cRGD caged siRNA/lipo complex, suggesting that the uptake mainly occurred through clathrin-mediated endocytosis. The low temperature displayed clear blocking of cRGD-siRNA entrance, showing the energy dependent uptake of cRGD-caged siRNA/lipo complex. We further used Alexa594 (red)-labeled markers for well-known endocytic pathway of internalization of integrin αvβ3 receptor to confirm the uptake pathway, which is known to be uptaken via the caveolar pathway or other lipid raft-dependent pathways. After 18 h incubation, there was virtually no overlap of Alexa 594-labeled for cholera toxin B and FITC-labeled caged cRGD modified siRNA (Figure S11, supporting information); this result was further confirmed that the internalization of cRGD caged siRNA/lipo complex was not mediated by the caveolar


21


Page 22 of 31

pathway or other lipid raft-dependent pathways. All these data proved that caged cRGD modified siRNA/lipo complex was internalized by the clathrin-mediated endocytosis. HeLa cells, the integrin αvβ3 negative cells39, were then applied for evaluating siRNA activity using cRGD modified caged siRNA to clarify the key factor of blocking siRNA activity before light irradiation. Prior to UV irradiation, RpAL/SL was not fully inactive and 30% to 45% downregulation of firefly luciferase activity was still observed in comparison to the data in U87MG cells. Upon UV irradiation, the siRNA activity was recovered in dose-dependent effect (Figure S12, supporting information). This data suggested that cRGD blocking effect on siRNA gene silencing ability decreased in integrin αvβ3 negative HeLa cells compared to U87MG cells and the binding of cRGD of RpAL/SL to its integrin αvβ3 receptor did have effect on the blocking effect of siRNA activity before light irradiation. We further inserted a longer linker between photolabile moiety and cRGD (RpLAL/SL) to test the photomodulation of gene silencing in U87MG cells (Figure S13, supporting information). RpLAL/SL did show obvious siRNA activity before UV irradiation, and there is no obvious difference of gene silencing ability before and after light irradiation. All these data suggested that the blocking siRNA activity from cRGD modification might come from three factors: 1) easy trapping in endosomes and lysosomes for cRGD modified siRNAs, 2) cRGD steric hindrance itself, and 3) the binding to receptor protein of cRGD. Photo-regulation of gene knockdown with cRGD modified caged siRNA in living mice. Photoregulation of RNAi effect of RpAG/SG (cRGD caged siRNA) in vivo was then investigated. Caged RpAG/SG were intratumorally injected into tumors bearing U87MG-GFP cells in nude mice. The mice were then randomly divided into three groups. First group was


22

Page 23 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

injected with 3 nmol native siRNA in left tumor and 1 × PBS in right tumor. The second group was the same as the first one but with light irradiation. The third group was injected with 3 nmol RpAG/SG in tumors on both sides, left side tumor was covered to avoid light irradiation, the

Figure 5. Effect of photoregulation of cRGD modified caged siRNA on GFP expression in tumor in vivo. (a) PBS on the right and 3 nM linear siRNAs on the left, separately. (b) PBS on the right and 3 nM linear siRNAs on the left, separately after UV irradiation (5 min). (c) 3 nM RpAG/SG on the both side, the right side was irradiated by UV light, the left side was kept in the dark. Mice from each test group were imaged (Xenogen IVIS system) at different time points (0 h, 12 h, 24 h, 48 h and 72 h) based on GFP emission (d) For each group of animals, the relative


23


Page 24 of 31

intensity of GFP signal coming from engrafted tumors was quantitatively measured (Xenogen IVIS system) on different days (normalized to the intensity of GFP fluorescence at 0 h for the same tumor of each mice) (n=3). right one was irradiated for 5 min (365 nm, 15 mW/cm2) at 3 h after intratumoral injection. The progression of tumors was then imaged and quantitatively measured at 0 h, 12 h, 24 h, 48 h and 72 h using the Maestro Automated in-vivo imaging. In Figure 5, the GFP signals of tumors in each group were normalized to the initial GFP intensity at 0 h for the same tumor of the same mice. The GFP signal from each tumor of PBS treated mice progressively increased from 0 h to 72 h with or without light irradiation for negative control group. The mice in positive control group with native siRNA (AG/SG) injection showed the decrease of GFP signal at 12 h with or without light irradiation, confirming that the native siRNA inhibited GFP expression in mice after intratumoral injection. However, the inhibition effect decreased vs time due to the loss of native siRNA. As shown in Figure 5c, two tumors in one nude mice were injected with cRGD caged siRNA (RpAG/SG). The GFP signal of left tumor without light activation gradually increased as negative control. However, after light irradiation, uncaged RpAG/SG in right tumor of the same mice greatly down-regulated GFP signal at 12 h, indicating that cRGD caged siRNA was activated and the active siRNA was released to inhibit the GFP expression in tumor. The recovery of GFP signal in tumors with activated RpAG/SG was even slower than that of positive control (PC) of AG/SG. Even in 48 h, the GFP signal still did not reach the original level with single siRNA injection, which was probably due to the factor that more cRGD caged siRNA could be uptaken by U87MG cells in tumor and was then activated. After isolation and fluorescence analysis of both tumors with cRGD-caged siRNA, light activation could achieve obvious downregulation of GFP signal in


24

Page 25 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

tumors, as indicated that GFP signal in most part of tumor disappeared for irradiated tumor with injection of cRGD-caged siRNA in comparison to that of non-irradiated tumor (Figure S14). All these data provide a clue of releasing nucleic acid drug at fixed time point and position for treatment of diseases. Conclusion In summary, terminal caging strategy was successfully achieved by designing caged siRNAs with a single targeting cRGD modification at the 5' end of antisense strand RNAs. These cRGD modified caged siRNAs were developed for precise optochemical control of siRNA functions in mammalian cells and solid tumors in mice. The photolabile group and two alkyl linkers were synthesized and successfully inserted into RNA strands using standard automated solid phase oligonucleotide synthesis. The synthesized RNAs were further conjugated with the cRGD at 5' end of antisense RNA. The activity and light-regulation of the cRGD caged siRNAs were assayed with two reporter genes (Firefly luciferase and GFP) and an endogenous gene, Eg5. The cRGD caged siRNAs, were nearly inactive until light irradiation cleaved the photolabile linker and cRGD moiety was removed from 5' end of antisense strand of siRNA. Photomodulation of gene silencing of both exogenous reporter genes and endogenous gene were successfully achieved using these cRGD caged siRNAs. In addition, we also demonstrated that photoregulation of GFP gene expression in tumor-bearing mice was also possible. By uptake pathway studies and tracking distribution of the cRGD-siRNA/lipo complexes in cells, we found that the loss of RNAi activity using cRGD caged siRNA might be due to three factors: 1) bulky cRGD moiety to block formation/processing of RISC, 2) binding ability of targeting protein to further enhance the blocking effect, and 3) trapping of cRGD caged siRNA in endosomes and


25


Page 26 of 31

lysosomes to inhibit siRNA escape. This caging strategy was promising to develop many useful tools for target gene regulation with many targeting moieties and photolabile siRNAs. ASSOCIATED CONTENT Supporting Information. The following files are available free of charge. The synthesis and characterization of linker compounds, synthesis of RNA modified cRGD on solid support, PAGE assay of cRGD modified caged siRNA, flow cytometry analysis of cell cycle using cRGD caged siRNA, the distribution of cRGD caged siRNA and naked siRNA at 4 h and 24 h, the photoregulation of gene expression of firefly luciferase activity with RpAL/SL in U87MG cells, upake inhibition of cRGD modified siRNA by different inhibitors, subcellular localization of Cy3 labeled-cRGD modified siRNA with Alexa 594-lableled cholera toxin in U87MG cells, the photoregulation of gene expression of firefly luciferase with RpAL/SL in HeLa cells, the photoregulation of gene expression of firefly luciferase with RpLAL/SL in U87MG cells ( PDF).

AUTHOR INFORMATION Corresponding Author *Tel: +86-010-82805635. E-mail: [email protected] Present Addresses State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University, No. 38, Xueyuan Rd, Beijing 100191, China. Author Contributions


26

Page 27 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Dr. Lijia Yu and Mr. Changmai Chen carried out the synthesis of compounds and modified siRNA and the cellular experiments. Mr. Duanwei Liang carried animal experiments. Prof. Xinjing Tang designed and directed the experiments. Both Dr. Lijia Yu and Prof. Xinjing Tang wrote this manuscript. Funding Sources This work was supported by National Major Scientific and Technological Special Project for “Significant New Drugs Development” (Grant No. 2017ZX09303013), and the National Science Foundation of China (grant No. 21422201, 21372018 and 21672015). Notes The authors declare no competing financial interest. ACKNOWLEDGMENT The U87MG (human glioblastoma cell) cell line was generously donated by Prof. Demin Zhou, from Peking University Health Science center. The U87MG cells stably expressing enhanced green fluorescence protein (U87MG-GFP) were kindly provided by Prof. Shengrong Guo from the School of pharmacy, Shanghai Jiao Tong University. We also thank the Medical and Health Analytical Center, Peking University Health Science Center for the mouse studies.

REFERENCES (1) Elbashir, S. M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001, 411, 494-498.


27


Page 28 of 31

(2) Roberts, T. C.; Ezzat, K.; EL Andaloussi, S.; Weinberg, M. S. Synthetic SiRNA Delivery: Progress and Prospects. In SiRNA Delivery Methods: Methods and Protocols; Shum, K., Rossi, J., Eds.; Springer New York: New York, NY, 2016; p 291. (3) Davis, M. E.; Zuckerman, J. E.; Choi, C. H. J.; Seligson, D.; Tolcher, A.; Alabi, C. A.; Yen, Y.; Heidel, J. D.; Ribas, A. Evidence of RNAi in humans from systemically administered siRNA via targeted nanoparticles. Nature 2010, 464, 1067-1070. (4) Willibald, J.; Harder, J.; Sparrer, K.; Conzelmann, K. K.; Carell, T. Click-modified anandamide siRNA enables delivery and gene silencing in neuronal and immune cells. J. Am. Chem. Soc. 2012, 134, 12330-12333. (5) Soutschek, J.; Akinc, A.; Bramlage, B.; Charisse, K.; Constien, R.; Donoghue, M.; Elbashir, S.; Geick, A.; Hadwiger, P.; Harborth, J.; John, M.; Kesavan, V.; Lavine, G.; Pandey, R. K.; Racie, T.; Rajeev, K. G.; Rohl, I.; Toudjarska, I.; Wang, G.; Wuschko, S.; Bumcrot, D.; Koteliansky, V.; Limmer, S.; Manoharan, M.; Vornlocher, H.-P. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 2004, 432, 173-178. (6) Yamamoto, S.; Kato, A.; Sakurai, Y.; Hada, T.; Harashima, H. Modality of tumor endothelial VEGFR2 silencing-mediated improvement in intratumoral distribution of lipid nanoparticles. J. Control. Release 2017, 251, 1-10. (7) Jiang, Y.; Huo, S.; Hardie, J.; Liang, X.-J.; Rotello, V. M. Progress and perspective of inorganic nanoparticles based siRNA delivery system. Expert Opin. Drug Del. 2016, 13, 547559. (8) Chen, C.; Yang, Z.; Tang, X. Chemical modifications of nucleic acid drugs and their delivery systems for gene-based therapy. Med. Res. Rev. 2018, 38. 829-869. (9) Thomas, M.; Kularatne, S. A.; Qi, L.; Kleindl, P.; Leamon, C. P.; Hansen, M. J.; Low, P. S. Ligand-targeted delivery of small interfering RNAs to malignant cells and tissues. Ann. N.Y. Acad. Sci. 2009, 1175, 32-39. (10) Dohmen, C.; Frohlich, T.; Lachelt, U.; Rohl, I.; Vornlocher, H. P.; Hadwiger, P.; Wagner, E. Defined folate-PEG-siRNA conjugates for receptor-specific gene silencing. Mol. Ther. - Nucl. Acid 2012, 1, e7. (11)

Debart, F.; Dupouy, C.; Vasseur, J.-J.: Stimuli-responsive oligonucleotides in prodrug-

based approaches for gene silencing. Beilstein J. Org. Chem. 2018, 14, 436-469.


28

Page 29 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(12) Shah, S.; Jain, P. K.; Kala, A.; Karunakaran, D.; Friedman, S. H.: Light-activated RNA interference using double-stranded

siRNA precursors modified

using a remarkable

regiospecificity of diazo-based photolabile groups. Nucleic Acids Res. 2009, 37, 4508-4517. (13) Tang, X.; Swaminathan, J.; Gewirtz, A. M.; Dmochowski, I. J.: Regulating gene expression in human leukemia cells using light-activated oligodeoxynucleotides. Nucleic Acids Res. 2008, 36, 559-569. (14) Ankenbruck, N.; Courtney, T.; Naro, Y.; Deiters, A. Optochemical control of biological processes in cells and animals. Angew. Chem. Int. Ed. 2018, 57, 2768-2798. (15) Shah, L.; Laughlin, S. T.; Carrico, I. S. Light-activated Staudinger–Bertozzi ligation within living animals. J. Am. Chem. Soc. 2016, 138, 5186-5189. (16) Ruble, B. K.; Yeldell, S. B.; Dmochowski, I. J. Caged oligonucleotides for studying biological systems. J. Inorg. Biochem. 2015, 150, 182-188. (17) Kramer, R. H.; Mourot, A.; Adesnik, H. Optogenetic pharmacology for control of native neuronal signaling proteins. Nat. Neurosci. 2013, 16, 816-823. (18) Govan, J. M.; Young, D. D.; Lusic, H.; Liu, Q.; Lively, M. O.; Deiters, A. Optochemical control of RNA interference in mammalian cells. Nucleic Acids Res. 2013, 41, 10518-10528. (19) Connelly, C. M.; Uprety, R.; Hemphill, J.; Deiters, A. Spatiotemporal control of microRNA function using light-activated antagomirs. Mol. BioSys. 2012, 8, 2987-2993. (20) Govan, J. M.; Uprety, R.; Thomas, M.; Lusic, H.; Lively, M. O.; Deiters, A. Cellular Delivery and photochemical activation of antisense agents through a nucleobase caging strategy. ACS Chem. Biol. 2013, 8, 2272-2282. (21) Hansen, M. J.; Velema, W. A.; Lerch, M. M.; Szymanski, W.; Feringa, B. L. Wavelengthselective cleavage of photoprotecting groups: strategies and applications in dynamic systems. Chem. Soc. Rev. 2015, 44, 3358-3377. (22) Jain, P. K.; Ramanan, V.; Schepers, A. G.; Dalvie, N. S.; Panda, A.; Fleming, H. E.; Bhatia, S. N. Development of Light-Activated CRISPR using guide RNAs with photocleavable protectors. Angew. Chem. Int. Ed. 2016, 55, 12440-12444. (23) Zhou, W.; Deiters, A. Conditional control of CRISPR/Cas9 function. Angew. Chem. Int. Ed. 2016, 55, 5394-5399.


29


Page 30 of 31

(24 ) Lucas, T.; Schäfer, F.; Müller, P.; Eming, S. A.; Heckel, A.; Dimmeler, S.: Light-inducible antimiR-92a as a therapeutic strategy to promote skin repair in healing-impaired diabetic mice. Nat. Commun. 2017, 8, 15162. (25) Shah, S.; Rangarajan, S.; Friedman, S. H. Light-Activated RNA Interference. Angew. Chem. Int. Ed. 2005, 44, 1328-1332. (26) Ji, Y.; Yang, J.; Wu, L.; Yu, L.; Tang, X. Photochemical regulation of gene expression using caged siRNAs with single terminal vitamin E modification. Angew. Chem. Int. Ed. 2016, 55, 2152-2156. (27) Jain, P. K.; Shah, S.; Friedman, S. H. Patterning of gene expression using new photolabile groups applied to light activated RNAi. J. Am. Chem. Soc. 2011, 133, 440-446. (28) Yi, Y.; Kim, H. J.; Mi, P.; Zheng, M.; Takemoto, H.; Toh, K.; Kim, B. S.; Hayashi, K.; Naito, M.; Matsumoto, Y.; Miyata, K.; Kataoka, K. Targeted systemic delivery of siRNA to cervical cancer model using cyclic RGD-installed unimer polyion complex-assembled gold nanoparticles. J. Control. Release 2016, 244, Part B, 247-256. (29) Schottelius, M.; Laufer, B.; Kessler, H.; Wester, H.-J. Ligands for mapping αvβ3-integrin expression in vivo. Accounts Chem. Res. 2009, 42, 969-980. (30) Alam, M. R.; Ming, X.; Fisher, M.; Lackey, J. G.; Rajeev, K. G.; Manoharan, M.; Juliano, R. L. Multivalent cyclic RGD conjugates for targeted delivery of small interfering RNA. Bioconjugate Chem. 2011, 22, 1673-1681. (31) Damha, M. J.; Ogilvie, K. K. Oligoribonucleotide synthesis. In protocols for oligonucleotides and analogs: synthesis and properties; Agrawal, S., Ed.; Humana Press: Totowa, NJ, 1993; p 81. (32) Hou, J.; Diao, Y.; Li, W.; Yang, Z.; Zhang, L.; Chen, Z.; Wu, Y. RGD peptide conjugation results in enhanced antitumor activity of PD0325901 against glioblastoma by both tumortargeting delivery and combination therapy. Int. J. Pharm. 2016, 505, 329-340. (33) Wang, F.; Zhang, W.; Shen, Y.; Huang, Q.; Zhou, D.; Guo, S. Efficient RNA delivery by integrin-targeted glutathione responsive polyethyleneimine capped gold nanorods. Acta Biomater. 2015, 23, 136-146. (34) Kapoor, T. M.; Mitchison, T. J. Eg5 is static in bipolar spindles relative to tubulin: evidence for a static spindle matrix. J. Cell Biol. 2001, 154, 1125-1133.


30

Page 31 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(35) Judge, A. D.; Robbins, M.; Tavakoli, I.; Levi, J.; Hu, L.; Fronda, A.; Ambegia, E.; McClintock, K.; MacLachlan, I. Confirming the RNAi-mediated mechanism of action of siRNAbased cancer therapeutics in mice. J. Clin. Invest. 2009, 119, 661-673. (36) Zhu, C.; Zhao, J.; Bibikova, M.; Leverson, J. D.; Bossy-Wetzel, E.; Fan, J.-B.; Abraham, R. T.; Jiang, W. Functional analysis of human microtubule-based motor proteins, the kinesins and dyneins, in mitosis/cytokinesis using RNA interference. Mol. Biol. Cell 2005, 16, 3187-3199. (37) Caswell, P. T.; Vadrevu, S.; Norman, J. C. Integrins: masters and slaves of endocytic transport. Nat. Rev. Mol. Cell Bio. 2009, 10, 843-853. (38) Khalil, I. A.; Kogure, K.; Akita, H.; Harashima, H. Uptake pathways and subsequent intracellular trafficking in nonviral gene delivery. Pharmacol. Rev. 2006, 58, 32-45. (39) Capasso, D.; de Paola, I.; Liguoro, A.; Del Gatto, A.; Di Gaetano, S.; Guarnieri, D.; Saviano, M.; Zaccaro, L. RGDechi-hCit: αvβ3 selective pro-apoptotic peptide as potential carrier for drug delivery into melanoma metastatic cells. Plos ONE 2014, 9, e106441.

Table of Contents.


31

Caged siRNAs with Single cRGD Modification for Photoregulation of

Recommend Documents