Research Article www.acsami.org
Development of Biodegradable Poly(citrate)-Polyhedral Oligomeric Silsesquioxanes Hybrid Elastomers with High Mechanical Properties and Osteogenic Differentiation Activity Yuzhang Du,†,# Meng Yu,†,# Xiaofeng Chen,§ Peter X. Ma,‡,∥,⊥ and Bo Lei*,† †
Frontier Institute of Science and Technology, Xi’an Jiaotong University, Xi’an, Shaanxi 710054, China Department of Biologic and Materials Sciences, University of Michigan, Ann Arbor 48109-2009, Michigan, United States § National Engineering Research Center for Tissue Restoration and Reconstruction, Guangzhou 510000, Guangdong, China ∥ Department of Biomedical Engineering, University of Michigan, Ann Arbor 48109-2009, Michigan, United States ⊥ Macromolecular Science and Engineering Center, University of Michigan, Ann Arbor, Michigan 48109-2009, United States ‡
ABSTRACT: Biodegradable elastomeric biomaterials have attracted much attention in tissue engineering due to their biomimetic viscoelastic behavior and biocompatibility. However, the low mechanical stability at hydrated state, fast biodegradation in vivo, and poor osteogenic activity greatly limited bioelastomers applications in bone tissue regeneration. Herein, we develop a series of poly(octanediol citrate)polyhedral oligomeric silsesquioxanes (POC−POSS) hybrids with highly tunable elastomeric behavior (hydrated state) and biodegradation and osteoblasts biocompatibility through a facile one-pot thermal polymerization strategy. POC−POSS hybrids show significantly improved stiffness and ductility in either dry or hydrated conditions, as well as good antibiodegradation ability (20−50% weight loss in 3 months). POC−POSS hybrids exhibit significantly enhanced osteogenic differentiation through upregulating alkaline phosphatase (ALP) activity, calcium deposition, and expression of osteogenic markers (ALPL, BGLAP, and Runx2). The high mechanical stability at hydrated state and enhanced osteogenic activity make POC−POSS hybrid elastomers promising as scaffolds and nanoscale vehicles for bone tissue regeneration and drug delivery. This study may also provide a new strategy (controlling the stiffness under hydrated condition) to design advanced hybrid biomaterials with high mechanical properties under physiological condition for tissue regeneration applications. KEYWORDS: silica-based biomaterials, hybrid elastomers, mechanical properties, biodegradation, osteogenic differentiation
1. INTRODUCTION Native bone tissues usually possess good bioactivity and elastomeric mechanical behavior or viscoelastic property which make them easily self-healing and gives them a high antifatigue ability in in vivo physiological conditions.1 Most of the biomaterials can not mimic the physiological properties of native bone and usually suffer from the fast degradation and loss of mechanical properties in physiological conditions. Therefore, developing biomaterials with biomimetic physicochemical properties and high osteogenic activity plays an important role in efficient bone tissue regeneration.2,3 In addition, the hybrid composition and nanostructure (apatite nanocrystals and proteins) of native bone tissue endow them strong mechanical properties and osteogenic bioactivity. Thus, due to the biomimetic structure and controlled properties, polymer-based hybrid biomaterials have attracted much attention in successful bone tissue regeneration applications.4 Polymer matrix has a crucial effect on the structure and properties of hybrid biomaterials. In recent years, biodegradable artificial elastomeric polymers, including poly(1,3-trimethylene carbonate) (PTMC), poly(glycerol-co-diacid) (PGD), and © XXXX American Chemical Society
poly(octanediol-co-citric acid) (POC), have been extensively investigated for soft tissue engineering and drug delivery, probably because of their biomimetic viscoelastic mechanical behavior resembling those of the extracellular matrix (ECM).5−7 Specially, POC, a biodegradable elastomer, has been proposed for biomedical application due to the nontoxic monomers, controlled elastomeric behavior, easy fabrication, and low cost.8 Moreover, the retained carboxyl and hydroxyl on the citric acid provides many possibilities to tailor the physical and chemical properties of POC for wide biomedical applications. As a result, several elastomers with tunable mechanical properties and degradation rate based on POC polymers have been investigated for biomedical applications such as myocardial tissue, vascular graft, orthopedic applications, and drug delivery.9 However, the as-prepared POC elastomers after cross-linking usually showed the low mechanical properties especially at the hydrated condition Received: October 29, 2015 Accepted: January 14, 2016
A
DOI: 10.1021/acsami.5b10378 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX
Research Article
ACS Applied Materials & Interfaces which is much less than that of bone tissues.10 In addition, due to the low molecular weight of thermal polymerization-derived POC polymers, POC-based elastomers usually exhibited fast degradation which may result in the mechanical properties loss and structure failure under a physiological environment.11 Third, the low osteoconductivity and osteoinductivity of POCbased polymers also hinder their successful applications in bone tissue repair and regeneration. Many efforts have been carried out to enhance the mechanical properties and antidegradation ability of crosslinked POC elastomers. For example, various inorganic fillers such as apatite and silicate have been incorporated into POC matrix to improve their mechanical properties.12,13 However, inorganic fillers reinforced elastomers did not show the improvement in both elastomeric behavior and stiffness due to such a physical mixing mechanism. Moreover, the poor physical interactions between inorganics and polymer make these composites also have fast biodegradation under physiological conditions. To improve the interactions of inorganic−organic phase, chemically covalent strategies are usually employed to prepare polymer nanocomposites. In a previous report, our group first prepared the silica-grafted POC hybrids elastomers (SPOC) using a thermal cross-linking method and showed their general cellular biocompatibility.14 The covalent silica phase significantly enhanced the elastomeric behavior and stiffness simultaneously of POC elastomers. Unfortunately, silica-grafted POC hybrids elastomers still suffer from fast degradation and a decrease of elastomeric behavior in hydrated condition. On the other hand, silica-based biomaterials have shown high clinical success and promising potential for bone tissue repair and regeneration, due to their high osteoconductivity, osteoinductivity, biocompatibility.15−17 Therefore, it is necessary to fabricate the silica-based POC hybrids elastomers with both slow biodegradation (high elastomeric behavior in hydrated conditions) and high osteogenic bioactivity. In this study, we aim to reinforce both the mechanical behavior under physiological condition and osteogenic bioactivity of the POC elastomers, through the hydrophobic silica-based compounds covalent strategy. Polyhedral oligomeric silsesquioxanes (POSS) is considered as a biocompatible hybrid monomer with a diameter of 1.5 nm and a threedimensional (3D) cage-shaped structure consisting of a rigid inorganic silica core with a 0.53 nm side length surrounded by eight organic corner groups.18 The addition of POSS into synthetic polymer has been considered an excellent approach to fabricate inorganic/organic hybrid materials with special functions for biomedical applications.19 A number of novel biodegradable POSS-based hybrid biomaterials have been developed by copolymerizing molecular-level POSS into polymer matrix. For instance, POSS reinforced poly(methyl methacrylate) (PMMA), polyurethane (PU), and poly(propylene fumarate) (PPF) hybrids have been developed and their properties were also studied.20−23 However, POSS reinforced polymeric hybrid bioelastomers with controlled biodegradation and elastomeric mechanical behavior (under dry and physiological conditions) and high osteoblast bioactivity have not yet been reported. Here, a series of novel inorganic−organic hybrid bioelastomers were developed through covalently grafting aminopropyl-isobutyl POSS into POC network (POC−POSS) and further chemical cross-linking by isocyanate. Pure POC elastomers showed high hydration ability and fast biodegrada-
tion due to their hydrophilic feature (residual carboxyls and hydroxyls). As a highly hydrophobic monomer, the grafted aminopropyl-isobutyl POSS could hinder the invasion of water molecules and may postpone the biodegradation and improve the elastomeric behavior under physiological conditions. Thus, in this study, we investigate the effect of POSS incorporation on the nanostructure, thermal stability, mechanical properties, elastomeric behavior, biodegradation, and osteoblast biocompatibility (proliferation, differentiation, ECM mineralization, and gene expression) of hybrids bioelastomers.
2. MATERIALS AND METHODS 2.1. Materials. Citric acid (CA, Sigma, 99%), 1,8-octanediol (OD, Sigma-Aldrich, 98%), aminopropyl-isobutyl POSS (POSS, Hybrids Plastics), anhydrous tetrahydrofuran (THF, Sigma), thionyl chloride (Sigma), dimethylformamide (DMF), 1,6-hexamethyl diisocyanate (HDI, Sigma), and stannous octoate were used as received without further purification unless otherwise noted. 2.2. Synthesis of POC Prepolymer and POC Chloride (POC− Cl). The poly(1,8-octanediol-co-critic acid) (POC) prepolymers were synthesized through the thermal polymerization method according to our previous report.14 To improve the activity of carboxyl on the POC, the acyl chloride process was carried out first. Specially, POC prepolymer (1.6 g) was dissolved in 16 mL of THF, and the solution was kept in a 50 mL round-bottom flask with stirring under a flow of pure nitrogen. Then, thionyl chloride solution in THF (10 mL) was added dropwise into the POC solution and stirred for another 30 min at 0 °C, followed by reflux at 70 °C for another 2 h. The POC−Cl prepolymer was obtained after solvent evaporation at 40 °C under vacuum, washing by deionized water for three times, and further drying under a high vacuum (2 Pa) overnight. 2.3. Preparation of POSS Grafted POC (POC−POSS) Prepolymer. The POC−POSS prepolymer was synthesized by grafting the aminopropyl-isobutyl POSS on the POC−Cl. Briefly, aminopropyl-isobutyl POSS (0.86 g) was dissolved in absolute THF and distilled triethylamine in a 50 mL round-bottom flask with stirring under a flow of pure nitrogen, followed by adding POC−Cl (0.4 g) and keeping the reaction for about 40 min at 0 °C and then heating (70 °C) at reflux for another 2 h. The final POC−POSS prepolymer was obtained according to a similar procedure with that of POC−Cl prepolymer. 2.4. Fabrication of POC−POSS Hybrids Elastomers. The various POC−POSS hybrids films were fabricated by mixing different amounts of POC and POC−POSS prepolymers, followed by crosslinked using 1,6-hexamethyl diisocyanate (HDI). The nomenclature of preprepared POC−POSS hybrid elastomers was based on POC− POSS prepolymer/POC prepolymer mass ratio and was represented as POC−POSS(x), where “x = 0, 5, 15, 30, 40, 50” represents the mass ratio of POC−POSS prepolymer within prepolymer mixture, and POC−POSS(0) was the pure POC elastomer. Briefly, the mixture of prepolymers (1.2 g) was dissolved in dimethyl sulfoxide (DMSO) (10 wt %) and then reacted with 1,6-hexamethyl diisocyanate (HDI) (the molar ratio of HDI to the remaining hydroxyl of CA was 0.5) at 55 °C for 2 h under constant stirring, using stannous octoate as catalyst (0.1 wt %). The mixture was cast into a Teflon mold and allowed to dry in a chemical hood equipped with a laminar airflow until all the solvents had been evaporated at room temperature. The resulted POC−POSS hybrid film was moved into an oven to postpolycondensation at 80 °C for 2 days. 2.5. Physicochemical Structure Characterizations of POC− POSS Hybrids. 1H NMR spectra of samples were obtained on a NMR instrument (Ascend 400 MHz, Bruker, Germany) using dimethyl sulfoxide-d6 (DMSO-d6) as solvent. The chemical shifts (ppm) for 1H NMR spectra were referenced relative to tetramethylsilane (TMS, 0.00 ppm) as the internal reference. 1H NMR (pre-POC) (400 MHz, CDCl3) δ/ppm: 1.33 (16H, s, −CH2CH2−), 1.60 (8H, d, −CH2CH2O−), 2.74−3.04 (7H, m, −OCOCH2−), 4.00−4.26 (8H, m, −CH2CH2O−). 1H NMR (POC-co-POSS) (400 MHz, CDCl3) δ/ ppm: 0.60 (16H, s, −CH2CH(CH3)2), 0.95 (42H, d, −CH2CHB
DOI: 10.1021/acsami.5b10378 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX
Research Article
ACS Applied Materials & Interfaces (CH3)2), 1.31 (8H, s, −CH2CH2−), 1.60 (4H, d, −CH2CH2O−), 1.85 (9H, q, −CH2CH(CH3)2), 2.75−3.00 (3H, m, −OCOCH2−), 4.00−4.30 (4H, t, −CH2CH2O−), 6.93 (1H, s, −CONH−). The average molecular weight of prepolymers was determined by gel permeation chromatography (GPC) (Waters 1525, Waters, USA), using THF as the solvent and linear polystyrene as calibrated standards. Attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectra were obtained at room temperature (Nicolet 6700 FTS40, Thermal Sci. USA). The spectra were obtained in the range of 4000−600 cm−1 with the average of 32 scans at a resolution of 4 cm−1. The surface morphology and nanostructure of POC−POSS was determined by high-resolution transmission electron microscopy (HRTEM) (Tecnai G2 20, FEI, HK) and field emission scanning electron microscope (FE-SEM) (JSM-6330, JEOL, Japan). 2.6. Thermal Properties Evaluation of POC−POSS Hybrids. Differential scanning calorimetry (DSC) (Q20, TA, USA) was used to confirm the thermal properties including crystallization (Tm), glass transition temperature (Tg), and melting temperature (Tm) of POC− POSS hybrid elastomers. For DSC measurements, samples were first equilibrated at 40 °C and scanned up to 200 °C with a heating rate of 10 °C/min under nitrogen purge (50 mL/min), and the thermal history of polymers was removed by a 3 min equilibrium at 200 °C, thereafter cooled with a cooling rate of −10 °C/min to −30 °C (cooling scan), and reheated to 350 °C with rate of 10 °C (heating scan). 2.7. Mechanical Properties Assessments of POC−POSS Hybrids. Tensile mechanical tests including tensile strength and elongation at break and tensile modulus in dry and hydrated state (physiological condition), as well as fatigue test were conducted at room temperature using uniaxial tensile test on a mechanical test machine (Criterion Model 43, MTS, MN) equipped with 50 N load cell and software (TestWorks4, MTS, MN). Briefly, the POC−POSS films with a size of 60 × 6 mm (length × width) were pulled at a rate of 50 mm/min until the sample broke. The stress−strain curves were recorded from the software; the Young’s modulus was determined from a slope of stress−strain curve at 5% of strain, and elongation at break was calculated. To evaluate the mechanical properties of samples in the hydrated state, all the specimens were immersed in phosphate buffered saline (PBS) solution for 1 and 14 d at 37 °C before testing, and the PBS was changed every 2 days. Then, the tensile behavior was tested immediately once by removing from PBS. The mechanical parameters were obtained according to a similar procedure with those in the dry condition. The fatigue mechanical tests were conducted by elongation continuously up to 30% strain with the rate of 50 mm/min and releasing for four cycles, and the stress-stain curves were recorded. At least four species per sample were measured to get the average and standard deviation (SD). 2.8. Hydrophilicity and Biodegradation Evaluations of POC−POSS Hybrids. The hydrophilicity was studied by testing the water contact angle using the sessile drop method at room temperature through a goniometer and imaging system (SL200 KB, Kino, USA). Specially, the water contact angle was calculated by dropping 2 μL of water onto the different positions of sample films after a predetermined time point (0, 1, 2 min). At least five positions per sample were tested to get the statistical result. For biodegradation in vitro, band-shaped specimens (about 30 mm × 6 mm × 0.2 mm, length × width × thickness) weighted as W0 were placed in a tube containing 6 mL of PBS (pH = 7.40) and incubated at 37 °C for predetermined times, and the PBS was changed every 2 days. After incubation, samples were washed with deionized water for three times and freeze-dried for 24 h and then weighed again (W1). The mass remaining (WR) was calculated according WR = W1/W0 × 100%. At least three species for each sample were tested, and the results are presented as mean ± SD. 2.9. Osteoblasts Biocompatibility Investigations in Vitro. 2.9.1. Cell Culture and Seeding. The mouse preosteogenic (MC3T3E1) cells purchased from a cell bank (Chinese Academy of Sciences, Shanghai, China) between passages 3 and 5 were used to study the cellular responses stimulated by POC−POSS hybrids in vitro. The cell attachment, proliferation, and viability, alkaline phosphatase (ALP)
activity, ECM mineralization, and gene expression of osteogenic differentiation were investigated. All cells were cultured in Eagle’s Minimum Essential Medium (EMEM, Invitrogen, USA) supplemented with 10% (v/v) fetal bovine serum (FBS, Invitrogen, USA) and 1% penicillin−streptomycin (Invitrogen, USA) at 37 °C in a 95% humidified atmosphere with 5% CO2. Before cell seeding, elastomer films with a diameter of 1.5 cm were sterilized by 75% ethanol (30 min) and UV light exposure (30 min). Cells with a determined density were seeded on the elastomeric films, and the pure POC−POSS(0) and commercial poly(D,L-lactide-co-glycolide) (PLGA75/25, Mw = 20 KDa, Hongjian, China) were used as controls. The fabrication of PLGA film was similar to that of POC−POSS films. 2.9.2. Cell Attachment and Proliferation Evaluation. For cell attachment and proliferation, osteoblasts with a density of 3000 cells/ well were seeded onto samples and put into a 24 well tissue culture plate (TCP). The cell attachment was determined by live/dead double staining (Invitrogen, USA). Briefly, after being cultured for 1 and 5 days, samples were washed with PBS, incubated in 400 μL of live/dead solution (Calcein-AM and Ethidium Homodimer) for 45 min, and then rinsed three times by PBS. The fluorescent images of stained live and dead cells were obtained using a fluorescent microscope (CX41, Olympus, Japan). Cell proliferation and viability was determined using the alamar blue assay (Invitrogen, USA) at the predetermined time. Briefly, after being incubated for 1, 3, and 5 days, the culture medium was replaced by 400 μL of alamar blue (10% v/v) solution and continued to incubate for 4 h. After that, 100 μL of the medium was transferred to a 96-well plate for measurement; the live cells fluorescent intensity was tested by a microreader at 530/600 nm (SpectraMax, Molecular Devices, USA), and the medium supplemented with 10% v/v alamar blue without cells was used as blank control. Following the instruction of alamar blue assay, the calculation of cell proliferation and viability directly depends on the fluorescent intensity. At least four species were tested per sample. 2.9.3. ALP Activity Analysis. Alkaline phosphatase (ALP) activity, which is regarded as an early marker of the osteogenic differentiation, was assessed at day 7 and 14. Briefly, cells with the density of 1.6 × 104 cells/well were seeded on the films and placed in a 12-well plate. After incubation for 3 h in an incubator, 2 mL of cell culture media was added. After culture for 24 h, the culture medium was changed to the osteogenic inducing medium including 100 nM dexamethasone (Sigma), 10 mM β-glycerophosphate (Sigma), and 0.05 mM ascorbic acid-2-phosphate (Sigma). Cell lysates were analyzed for ALP activity using a SensoLyte pNPP alkaline phosphatase assay kit (AnaSpec, USA), and the ALP activities were normalized to the total protein content tested by the Pierce BCA Protein Assay Kit (Thermo, USA) according to the manufacturer’s instructions. This colorimetric assay is based on the conversion of p-nirophenyl-phosphate (pNPP) into pnitrophenol (pNP) in the presence of ALP, where the rate of pNP production is proportional to the ALP activity. The level of pNP production was determined from the absorbance at 405 nm using a microreader. At least four species per sample were evaluated. 2.9.4. ECM Mineralization Evaluation. The calcium deposition assay which reports the ECM mineralization was carried out using a Von Kossa staining kit (Genmed, China); the cell culture method and process were similar to that of the ALP activity assay. The stained procedure with von Kossa staining kit was according to the manufacturer’s instructions. Briefly, after culture for 14 days, samples were gently rinsed twice with Reagent A, then fixed in Reagent B for 15−20 min, and washed with Reagent A twice. Finally, they were stained with Reagent C for 30 min in the dark and exposed to an incandescent lamp (100 W) for 30 min. The calcium deposition was stained as black and observed by fluorescent microscopy (IX53, Olympus, Japan). 2.9.5. Real-Time PCR Investigation of Osteogenic Differentiation Markers. The difference between groups on osteogenic differentiation ability in gene expression level was examined by quantitative real-time PCR (RT-PCR, Molecular Devices, USA). The mRNA expression of alkaline phosphatase (ALPL), osteocalcin (BGLAP), and runt-related transcription factor 2 (Runx2) were examined after being cultured for 7 and 14 days. Total RNA was harvested from the cells seeded on the C
DOI: 10.1021/acsami.5b10378 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX
Research Article
ACS Applied Materials & Interfaces Table 1. Real-Time Quantitative PCR Primers gene
forward (5′−3′)
reverse (5′−3′)
length
GAPDH ALPL BGLAP Runx2
AGGTCGGTGTGAACGGATTTG CCAACTCTTTTGTGCCAGAGA AACATAGTGTCGTCGTTTCTTTCTG GACTGTGGTTACCGTCATGGC
TGTAGACCATGTAGTTGAGGTCA GGCTACATTGGTGTTGAGCTTTT GGCGTGGCATCTGTGAGGT ACTTGGTTTTTCATAACAGCGGA
123 110 179 84
Figure 1. Synthesis of POC−POSS prepolymers. (A) Synthesis of poly(1,8-octanediol-co-critic acid) prepolymer (POC) and acyl-chlorination POC (POC−Cl) prepolymer. (B) Synthesis of aminopropyl-isobutyl POSS grafted POC prepolymers (POC−POSS prepolymer). The POSS could be grafted covalently on the side chain of POC successfully. films in Trizol (Life technologies, USA). RNA was extracted through the chloroform and isopropanol method. Reverse transcriptase (Roche Diagnostics, USA) was used to synthesis cDNA first strand. Primers used in real-time PCR are listed in Table1. The real-time quantitative PCR reactions were performed in the 7500 fast system (Applied Biosystems, USA), and the conditions were as follows: 2 min at 50 °C; 2 min in 95 °C; 40 cycles of 3 s of 95 °C and 30 s at 60 °C. The 2−ΔΔCT method was used to evaluate the gene expression level between samples and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the PLGA group with a value of one was set as the calibrator group. At least five species per sample were tested. 2.10. Statistical Analysis. All data were represented as mean ± SD. Statistical analysis was performed using the Statistical Program for Social Science (SPSS) for Windows. The results were made using student’s t test (two tail, unequal variance) and analysis of variance (ANOVA). A p-value of
