Colorimetric Logic Gates Based on Ion-Dependent DNAzymes - The

May 20, 2013 - In the future, this logic system can be developed into portable test kits or strips, which allow fast metal-ion detection at ambient te...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/JPCC

Colorimetric Logic Gates Based on Ion-Dependent DNAzymes Li Zhang, Yun-Mei Zhang, Ru-Ping Liang, and Jian-Ding Qiu* Department of Chemistry, Nanchang University, Nanchang 330031, China ABSTRACT: Two kinds of ion-dependent DNAzymes and tailored substrates enable the design of the logic gates (OR, AND, INHIBIT) using Pb2+ and Cu2+ as inputs; then, a three-input AND logic gate is developed utilizing the unique feature that Hg2+ ions interact with the thymine− thymine (T−T). At first, the substrates are blocked by ion-dependent DNAzymes that include the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The released product strands then self-assemble into the hemin/G-quadruplex-HRP-mimicking DNAzyme that biocatalyze the formation of a colored product and provide an output signal for the different logic gates. We are able to recognize the logic output signals effortlessly by our naked eyes. It is a simple, economic, and safe approach for the design of a complex multiple-input DNA logic molecular device.

■

INTRODUCTION Molecular computer or information processing on the molecular scale is a promising substitute of the traditional silicon-based computer technologies.1,2 Design and construction of efficient and economic logic components is of great importance for the development of this research area. Along this line, considerable research efforts have been dedicated to chemical and biological systems that are capable of performing Boolean logic on the molecular level to identify ideal candidates that satisfy logic operations. In particular, the use of DNA as functional biomaterials for information processing and programmed mechanical activities shows great promise in the fields of bioengineering, bioanalysis, and nanomedicine.3 However, most of the DNA-based logic gates are driven by the input of oligonucleotide or metal ions to generate the fluorescent output signals.4−12 In an alternative approach, homogeneous colorimetric detection methods based on G-quadruplex that intercalates hemin and acts as the horseradish peroxidase (HRP)-mimicking DNAzyme to catalyze the H2O2 oxidation of 3,3′,5,5′-tetrazmethylbenzidine sulfate (TMB) or 2,2′-azino-bis(3-ethylbenzthiazoline6-sulfonic acid disodium salt) (ABTS2−) are attracting growing interest as biocatalysts for the development of amplified biosensors,13 the activation of DNA machines,14 and the logic gate operations.15−21 These methods may minimize or even eliminate complex analysis procedures that involve expensive instrumentation and hold great promise for low-cost, low-volume, and rapid readout of the analyte and more convenient management for on-site detection. Heavy-metal contamination is one of the most serious concerns to human health because the presence of these ions in biological or environmental systems is either quite harmful or toxic to human health. For example, of particular interest has been the detection of lead ions due to its neurotoxic effects on health at low-level exposure, especially in children. Besides, lead is nondegradable and persists in plants and animals.22 Copper (Cu) is biologically essential and required by some organisms, but it can lead to toxicity at higher concentrations.23,24 Thus, the rapid and sensitive analysis of different ions in water or food resources is important. In recent years, a new category of © XXXX American Chemical Society

DNAzymes that are highly specific and sensitive for metal ions such as Pb(II), Cu(II), and Zn(II) has increasingly been used as metal sensors.25−28 In the presence of target metal ions, the substrate cleaves into two fragments. Because of the melting temperature differences between the completely hybridized DNAzyme−substrate strand and the cleaved products, the products dissociate from the enzyme strand. The cofactordependent activity of catalytic nucleic acids has enabled them to act as reporter molecules for biosensing applications, and several such biosensors have been reported for the analysis of different metal ions and thereby for the construction of logic gates. For example, Zhang and coworkers designed a system of colorimetric logic gates (OR, AND, and INHIBIT) utilizing Pb2+ and Mg2+ ions as the DNAzyme cofactors for the activation of the respective scission DNAzymes.29 These design strategies based on DNA-functionalized gold nanoparticles have received considerable attention. However, the use of labeled oligonucleotides is an expensive and potentially complex process. Willner and coworkers have recently designed a simple strategy to construct fluorescent logic gates using a library of catalytic nucleic acids (DNAzymes) and their substrates, for the input-guided dynamic assembly of a universal set of logic gates and a half-adder/halfsubtractor system.30 However, most of the reported fluorescent logic gates need two or more fluorophore and quencher labels to produce an efficient fluorescence switch for detection. By contrast, label-free methods are cheaper and easier to operate and have no influence on the activity of DNAzymes, thus providing good choices for the design of the logic gate. Here we report the use of ion-dependent DNAzymes as functional nucleic acids for the construction of a series of DNA logic gates (OR, AND, INHIBIT) based entirely on colorimetric outputs. The system is obtained by using two kinds of ion-dependent DNAzyme for the construction of the logic gates in which the DNAzyme cofactors, Pb2+ and Cu2+ ions, are used as inputs for the activation of the respective scission DNAzymes, and the substrates that yield HRP-mimicking Received: March 21, 2013 Revised: May 18, 2013

A

dx.doi.org/10.1021/jp4027892 | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

■

DNAzyme in the presence of appropriate inputs serve as output and readout signals. At first, the G-rich sequence is locked tightly into the double-stranded DNA, preventing the formation of the G-quadruplex. Upon cleavage, the G-quadruplex formation is achieved by the separated nucleic acids sequences, which can intercalates hemin to catalyze the H2O2 oxidation of TMB.

Article

RESULTS AND DISCUSSION

We first use Pb2+ and Cu2+ as inputs for the activation of the respective scission DNAzymes to construct an OR logic gate. As shown in Figure 1A, the Pb2+-dependent DNAzyme (2) and

■

EXPERIMENT SECTION Materials and Reagents. All DNA were purchased from Takara Biotech. (Dalian, China), and their sequences are listed in Table 1. Triton X-100, TMB, hemin, lead nitrate (Pb(NO3)2), Table 1. DNA Sequences Used to Construct the Logic Gates no.

sequence (5′ to 3′)

1 2 3 4 5 6 7 8 9 10 11 12 13 14

ACTCACTATrAGGAAGGGTAGGGCGGGTTGGG CTACCCTTCTCCGAGCCGGTCGAAATAGTGAGT AGCTTCTTTCTAATACGGCTGGGTTGGGCGGGATGGG ACCCAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC ACTCACTATrAGGAATGGGACGGG GTCCCATTCTCCGAGCCGGTCGAAATAGTGAGT AGCTTCTTTCTAATACGGCCTTAGTGGAGGG CTAAGGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC AGCTTCTTTCTAATACGGCCCAACCCGCCCTAC GGGTTGGGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC ACTCACTATrAGGATTGGGACGGG GTCCCAATCTCCGAGCCGGTCGAAATAGTGAGT AGCTTCTTTCTAATACGGCCTTTGTGGAGGG CAAAGGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC

Figure 1. “OR” logic gate system consisting of ion-dependent DNAzymes that are activated by the inputs Pb2+ and Cu2+. (A) Schematic presentation of the logic gate. (B) UV−vis curves for different combinations of the two inputs. (C) Bar diagram showing absorbance intensity for different combinations of inputs, derived from panel B. (D) Photos and truth table of OR logic gate.

and cupric chloride (CuCl2) were purchased from Sigma-Aldrich (USA). Disodium ethylenediaminetetraacetate dehydrate (EDTA-2Na) was obtained from the Sinopharm Chemical Reagent (Shanghai, PRC). Mercury(II) perchlorate trihydrate (HgClO4·3H2O) and sodium perchlorate (NaClO4) were obtained from Alfa-Aesar (USA). Other chemicals were reagent grade and were used without further purification. UV−vis absorption spectra were recorded on a Shimadzu UV-2450 spectrophotometer (Tokyo, Japan). A QL-901 vortex mixer (Haimen, China) was used to blend the solution. Hybridization of DNA and Preparation of DNAzyme. To form the two DNAzyme, a total of 1 μM enzyme (Pb2+-Enz or Cu2+-Enz) and 1 μM corresponding substrate (Pb2+-Sub or Cu2+-Sub) was annealed in 50 mM tris-HClO4 buffer pH 7.0 with 100 mM NaClO4 in a 90 °C water bath for 10 min and subsequently slowly cooled to room temperature. When it was cooled to the room temperature, 25 μL of 50 mM Cu2+ or Pb2+ was added and incubated at 37 °C for 3 h. Afterward, 100 mM EDTA was added to mask Cu2+ or Pb2+ for stopping the reaction. Finally, an equal volume of 2 μM hemin dissolved in the TrisHClO4 buffer (50 mM Tris-HClO4, pH 8.0, 40 mM KCl, 400 mM NaCl, 0.1% (w/v) Triton X-100, 2% (v/v) DMSO) was added to the DNA solution. The mixtures were kept at room temperature for 1 h, allowing the G-quadruplex to bind hemin properly. Oxidation Reaction of TMB Catalyzed by G-Quadruplex DNAzyme. In the catalytic reaction, 10 μL of the final DNA-hemin mixture was added to 490 μL of TMB−H2O2 substrate solution, which was constituted of 470 μL of 0.2% (w/v) TMB and 20 μL of 30% (w/v) H2O2. An equal volume of 2 M H2SO4 was added after 4 min to the solution to stop this reaction. UV−vis spectra were collected, and the photo was taken.

the Cu2+-dependent DNAzyme (4) hybridize with the substrate (1) and (3), respectively. The substrates consist of specific sequences that each include a ribonucleobase allowing the specific cleavage by the Pb2+- or Cu2+-dependent DNAzymes. Simultaneously, the substrates include two domains with the characteristic sequence of the HRP-mimicking DNAzyme and regions that are complementary to the ion-dependent DNAzymes. Thus, hybridization of the two ion-dependent DNAzymes with the substrates prohibits the self-assembly of the HRP-mimicking DNAyzme to form the hemin/G-quadruplex structure. Treatment of the system with either Pb2+ or Cu2+ results in the cleavage of the substrate at the respective ribonucleobases. The scission processes yield to nucleic acid fragments that lack further synergistic stabilization and thus are released from the complex. The released fragments (orange and red parts) consisting of the HRP-mimicking DNAzyme sequences can self-assemble to the biocatalytic DNAzyme in the presence of hemin that could catalyze TMB to generate the colored radical TMB+. Thus, the DNAzyme is formed when the system is subjected to any of the ion inputs or when the system is activated by the two ion-inputs. As can be seen from the experimental results in Figure 1B, in the absence of any input ions, little TMB+ is formed with low absorbance intensity (output 0), and activation of the system with either Pb2+ or Cu2+ ions yields high absorbance value of TMB+ with a visible color change (output 1) (see optimization results in Figures 2 and 3). Also, when the system is subjected to both inputs, a “true” output, reflected by the high absorbance value and the remarkable yellow color of TMB+, is observed. The “OR” gate operations of the B

dx.doi.org/10.1021/jp4027892 | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

Figure 2. (A) Pb2+ concentration-dependent change of the UV−vis absorption spectra. The concentrations of Pb2+ were (from curves a−k, μM): 0, 1.1, 5.5, 11, 22, 33, 44, 55, 82.5, 110, and 165. (B) Pb2+ concentration-dependent change of the absorbance at 450 nm.

Figure 3. (A) Cu2+ concentration-dependent change of the UV−vis absorption spectra. The concentrations of Cu2+ were (from curves a−k, μM): 0, 1.1, 5.5, 11, 22, 33, 44, 55, 82.5, 110, and 165. (B) Cu2+ concentration-dependent change of the absorbance at 450 nm.

system are depicted in Figure 1C,D in the form of absorbance bars and a truth table, respectively. Furthermore, we employ the unique property of OR gate to achieve selective detection of Pb2+ and Cu2+ ions, respectively. It is observed that the system shows appreciable signal in response to Pb2+ and Cu2+ ions. Inspired by the above OR logic gate, an additional “AND” logic gate is constructed based on the ion-dependent DNAzyme (Figure 4A). The construction of the “AND” system is similar to that described for the “OR” system, except for the sequences constituting of the substrates (5) and (7). In a similar manner, the two DNAzymes sequences (6) and (8) are hybridized with the substrates (5) and (7). Each of the substrates includes the half sequence of the HRP-mimicking DNAzyme. Thus, upon the activation of the system by either input Pb2+ or Cu2+ and the subsequent release of DNAzyme halves, respectively, the HRP-mimicking DNAzyme cannot be formed. Treatment of the system with both inputs results in the release of both fragments (pink and azure parts), and these self-assemble into the intermolecular G-quadruplex structure that yields the HRP-mimicking DNAzyme in the presence of hemin. In this case, nucleic acid fragments can only form complexes that yield catalytically active DNAzyme structures when Pb2+ and Cu2+ coexist. Figure 4B,C shows the absorbance changes upon treatment of the system with four input modes. It is evident that upon treatment of the system with the two inputs the effective generation of the HRPmimicking DNAzyme is achieved, which could be further proved by photos with a clear yellow color (Figure 4D). We further extend the study by constructing an “INHIBIT” gate using the DNAzyme system combining the two inputs

Figure 4. “AND” logic gate system consisting of ion-dependent DNAzymes that are activated by the inputs Pb2+ and Cu2+. (A) Schematic presentation of the logic gate. (B) UV−vis curves for different combinations of the two inputs. (C) Bar diagram showing absorbance intensity for different combinations of inputs derived from panel B. (D) Photos and truth table of AND logic gate. C

dx.doi.org/10.1021/jp4027892 | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

Pb2+ and Cu2+ (Figure 5A). Similarly, the Pb2+-dependent DNAzyme sequence (2) is hybridized with the substrate (1) that includes the HRP-mimicking DNAzyme sequence as the sequence used in “OR” logic gate. The Cu2+-dependent DNAzyme sequence (10) is hybridized with a new substrate (9), which includes complementary domains that can prevent the formation of the hemin-G quadruplex DNAzyme upon hybridization with the sequence released from substrate (1). At first, the sequences (1) and (9) are blocked by partial hybridization with DNAzyme sequences (2) and (10) and thus the DNAzyme units are not activated. When the input of Pb2+ is added, the biocatalytic cleavage of (2) at the ribonucleobase fragments the substrate into two parts. The separated nucleic acids (orange part) then self-assemble to the energetically favored G-quadruplex that intercalates hemin and acts as the HRP-mimicking DNAzyme, whereas in the present Cu2+, no HRP-mimicking DNAzyme is

formed, owing to no G-rich existence (claret-red part) upon cleavage. The introduction of both inputs leads to the formation of the duplex by two fragments (orange part and claret-red part) that cancels the DNAzyme properties induced by Pb2+. Figure 5B,C shows the absorbance changes of the system. It is found that activating the system by input Pb2+ leads to the release of the HRPmimicking DNAzymes and to the catalyzed oxidation of TMB to colored radical TMB+ (Figure 5D), whereas initiation of the system activity with both Pb2+ and Cu2+ input leads to the weak absorbance, which is comparable to that in the presence of single Cu2+. These results demonstrate that the system indeed performs the “INHIBIT” gate operation with a characteristic truth table, as shown in Figure 5D. On the basis of a previous study, we can see that if there are T−T mismatches instead of G−C base pairs in the double-helix region, then the resulting quadruplex/duplex DNA structure will no longer exhibit the DNAzyme function. Upon incubation with Hg2+ (see optimization results in Figure 6), however, quadruplex/duplex displays modest DNAzyme activity, which is mainly attributed to the formation of T−Hg2+−T base pairs.31 Utilizing these features, we develop another AND logic gate based on the former AND logic gate by employing Pb2+, Cu2+, and Hg2+ as inputs. As shown in Figure 7A, the ions-specific DNA-cleaving DNAzymes ((11) and (12)) are hybridized with their substrates, respectively, but unlike the former AND logic gate described above, T−T mismatches are introduced into the double-helix region between the resulting quadruplex/duplex DNA structure formed by the nucleic acid fragments released from the two ion-depended DNAzymes. In the presence of Cu2+ and Pb2+, the released fragments (dark-purple and skyblue parts) consisting of half sequence of the HRP-mimicking DNAzyme sequences cannot self-assemble to the biocatalytic DNAzyme in the presence of hemin and thus exhibit no DNAzyme activity. While in the simultaneous presence of Pb2+, Cu2+ and Hg2+ ions, the resulting duplex structure stabilizes the formation of the hemin/G-quadruplex owing to the formation of T-Hg2+-T base pairs and subsequently the assembled DNAzyme structure. Figure 7B,D shows the absorbances as well as the color changes of the system. The results confirm that the system performs a three-input “AND” logic gate operation, and the output signal (the HRP-mimicking DNAzyme) is generated (true value “1”) only if the system is subjected to the three inputs together. Selectivity of the Logic System. To test the selectivity of this sensing system, we have studied the selectivity of the logic

Figure 5. “INHIBIT” logic gate system consisting of ion-dependent DNAzymes that are activated by the inputs Pb2+ and Cu2+. (A) Schematic presentation of the logic gate. (B) UV−vis curves for different combinations of the two inputs. (C) Bar diagram showing absorbance intensity for different combinations of inputs, derived from panel B. (D) Photos and truth table of INHIBIT logic gate.

Figure 6. (A) Hg2+ concentration-dependent change of the UV−vis absorption spectra. The concentrations of Hg2+ were (from curves a−h, μM): 0, 0.0625, 0.125, 0.625, 1.25, 1.5, 2.5, and 5. (B)Hg2+ concentration-dependent change of the absorbance at 450 nm. D

dx.doi.org/10.1021/jp4027892 | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

DNAyzme that amplifies the gate function. In comparison with protein peroxidases, the G-quadruplex-based DNAzyme can be facilely tethered to DNA sequences or other targets, serving as a novel kind of catalytic label or beacon regarding logic gate ouput. In contrast with previous logic gates based on gel electrophoresis or fluorescence detection, no labeled oligonucleotide is used and no expensive equipment is required, and thus the logic gates hold great promise for low-cost, lowvolume, and rapid readout of the analyte and more convenient management for on-site detection. In the future, this logic system can be developed into portable test kits or strips, which allow fast metal-ion detection at ambient temperature and therefore pave the way for the development of multiplexed point-of-care sensing devices for metal ions.

■

AUTHOR INFORMATION

Corresponding Author

*Tel/Fax: +86-791-3969518. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by Program for New Century Excellent Talents in University (NCET-11-1002), the National Natural Science Foundation of China (21163014, 21105044 and 21265017), and the Program for Young Scientists of Jiangxi Province (20112BCB23001).

Figure 7. Three-input “AND” logic gate system consisting of iondependent DNAzymes that are activated by the inputs Pb2+, Cu2+, and Hg2+. (A) Schematic presentation of the logic gate. (B) UV−vis curves for different combinations of the three inputs. (C) Truth table of the three inputs AND logic gate. (D) Photos of the three-input AND logic gate.

■

gates to different metal ions. Different metal ions (such as Co2+, Cr3+, Mn2+, Ni2+, Mg2+, and Zn2+) are used instead of Cu2+and Pb2+. Figure 8 depicts the OR system activated with interference

REFERENCES

(1) Adelman, L. M. Molecular Computation of Solutions to Combinatorial Problems. Science 1994, 266, 1021−1024. (2) Szacilowski, K. Digital Information Processing in Molecular Systems. Chem. Rev. 2008, 108, 3481−3548. (3) Stojanovic, M. N.; Stefanovic, D. Deoxyribozyme-Based HalfAdder. J. Am. Chem. Soc. 2003, 125, 6673−6676. (4) Lake, A.; Shang, S.; Kolpashchikov, D. M. Molecular Logic Gates Connected through DNA Four-Way Junctions. Angew. Chem., Int. Ed. 2010, 49, 4459−4462. (5) Freeman, R.; Finder, T.; Willner, I. Multiplexed Analysis of Hg2+ and Ag+ Ions by Nucleic Acid Functionalized CdSe/ZnS Quantum Dots and Their Use for Logic Gate Operations. Angew. Chem., Int. Ed. 2009, 48, 7818−7821. (6) Guo, J. H.; Kong, D. M.; Shen, H. X. Design of a Fluorescent DNA IMPLICATION Logic Gate and Detection of Ag+ and Cysteine with Triphenylmethane Dye/G-Quadruplex Complexes. Biosens. Bioelectron. 2010, 26, 327−332. (7) Wang, L.; Zhu, J.; Han, L.; Jin, L.; Zhu, C.; Wang, E.; Dong, S. Graphene-Based Aptamer Logic Gates and Their Application to Multiplex Detection. ACS Nano 2012, 6, 6659−6666. (8) Liu, X.; Aizen, R.; Freeman, R.; Yehezkeli, O.; Willner, I. Multiplexed Aptasensors and Amplified DNA Sensors Using Functionalized Graphene Oxide: Application for Logic Gate Operations. ACS Nano 2012, 6, 3553−3563. (9) Orbach, R.; Mostinski, L.; Wang, F.; Willner, I. Nucleic Acid Driven DNA Machineries Synthesizing Mg2+-Dependent DNAzymes: An Interplay between DNA Sensing and Logic-Gate Operations. Chem.Eur. J. 2012, 18, 14689−14694. (10) Pei, H.; Liang, L.; Yao, G.; Li, J.; Huang, Q.; Fan, C. Reconfigurable Three-Dimensional DNA Nanostructures for the Construction of Intracellular Logic Sensors. Angew. Chem., Int. Ed. 2012, 51, 9020−9024. (11) Park, K. S.; Seo, M. W.; Jung, C.; Lee, J. Y.; Park, H. G. Simple and Universal Platform for Logic Gate Operations Based on Molecular Beacon Probes. Small 2012, 8, 2203−2212.

Figure 8. Selectivity of the method for Pb2+ and Cu2+ analysis by the DNAzyme. The concentration of all metal ions was 5.5 × 10−5 M.

metal ions of high concentration (5.5 × 10−5 M). Clearly, it was found that the presence of the reference metal ions did not interfere with the OR logic system even with a relative high concentration, demonstrating high selectivity of this sensing system for detecting Pb2+ and Cu2+.

■

CONCLUSIONS In summary, we have successfully constructed a set of DNA logic gates (AND, OR, INHIBIT) by using the metal ionspecitifc DNA/RNA-cleaving DNAzymes as functional components and the respective cofactor-ions as inputs. The output of the gate activities leads to the formation of the HRP-mimicking E

dx.doi.org/10.1021/jp4027892 | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

(12) Elbaz, J.; Wang, F.; Remacle, F.; Willner, I. pH-Programmable DNA Logic Arrays Powered by Modular DNAzyme Libraries. Nano Lett. 2012, 12, 6049−6054. (13) Shimron, S.; Wang, F.; Orbach, R.; Willner, I. Amplified Detection of DNA through the Enzyme-Free Autonomous Assembly of Hemin/G-Quadruplex DNAzyme Nanowires. Anal. Chem. 2012, 84, 1042−1048. (14) Shimron, S.; Elbaz, J.; Henning, A.; Willner, I. Ion-Induced DNAzyme Switches. Chem. Commun. 2010, 46, 3250−3251. (15) Zhu, J.; Li, T.; Zhang, L.; Dong, S.; Wang, E. G-Quadruplex DNAzyme Based Molecular Catalytic Beacon for Label-Free Colorimetric Logic Gates. Biomaterials 2011, 32, 7318−7324. (16) Shlyahovsky, B.; Li, Y.; Lioubashevski, O.; Elbaz, J.; Willner, I. Logic Gates and Antisense DNA Devices Operating on a Translator Nucleic Acid Scaffold. ACS Nano 2009, 3, 1831−1843. (17) Shimron, S.; Magen, N.; Elbaz, J.; Willner, I. pH-Programmable DNAzyme Nanostructures. Chem. Commun. 2011, 47, 8787−8789. (18) Elbaz, J.; Moshe, M.; Willner, I. Coherent Activation of DNA Tweezers: A “SET−RESET” Logic System. Angew. Chem., Int. Ed. 2009, 48, 3834−3837. (19) Li, T.; Wang, E.; Dong, S. Potassium−Lead-Switched GQuadruplexes: A New Class of DNA Logic Gates. J. Am. Chem. Soc. 2009, 131, 15082−15083. (20) Li, T.; Ackermann, D.; Hall, A. M.; Famulok, M. InputDependent Induction of Oligonucleotide Structural Motifs for Performing Molecular Logic. J. Am. Chem. Soc. 2012, 134, 3508−3516. (21) Moshe, M.; Elbaz, J.; Willner, I. Sensing of UO22+ and Design of Logic Gates by the Application of Supramolecular Constructs of IonDependent DNAzymes. Nano Lett. 2009, 9, 1196−1200. (22) Rogers, J. T.; Richards, J. G.; Wood, C. M. Ionoregulatory Disruption as the Acute Toxic Mechanism for Lead in the Rainbow Trout (Oncorhynchus mykiss). Aquat. Toxicol. 2003, 64, 215−234. (23) Wu, C. S.; Cupps, J. M.; Fan, X. Compact Quantum Dot Probes for Rapid and Sensitive DNA Detection Using Highly Efficient Fluorescence Resonant Energy Transfer. Nanotechnology 2009, 20, 305502. (24) Brewer, G. J. Risks of Copper and Iron Toxicity during Aging in Humans. Chem. Res. Toxicol. 2010, 23, 319−326. (25) Wu, C. S.; Khaing Oo, M. K.; Fan, X. Highly Sensitive Multiplexed Heavy Metal Detection Using Quantum-Dot-Labeled DNAzymes. ACS Nano 2010, 4, 5897−5904. (26) Xiao, Y.; Rowe, A. A.; Plaxco, K. W. Electrochemical Detection of Parts-Per-Billion Lead via an Electrode-Bound DNAzyme Assembly. J. Am. Chem. Soc. 2007, 129, 262−263. (27) Xiang, Y.; Tong, A.; Lu, Y. Abasic Site-Containing DNAzyme and Aptamer for Label-Free Fluorescent Detection of Pb2+ and Adenosine with High Sensitivity, Selectivity, and Tunable Dynamic Range. J. Am. Chem. Soc. 2009, 131, 15352−15357. (28) Zhang, Z.; Balogh, D.; Wang, F.; Willner, I. Smart Mesoporous SiO2 Nanoparticles for the DNAzyme-Induced Multiplexed Release of Substrates. J. Am. Chem. Soc. 2013, 135, 1934−1940. (29) Bi, S.; Yan, Y.; Hao, S.; Zhang, S. Colorimetric Logic Gates Based on Supramolecular DNAzyme Structures. Angew. Chem., Int. Ed. 2010, 49, 4438−4442. (30) Elbaz, J.; Lioubashevski, O.; Wang, F.; Remacle, F.; Levine, R. D.; Wilner, I. DNA Computing Circuits Using Libraries of DNAzyme Subunits. Nat. Nanotechnol. 2010, 5, 417−422. (31) Freeman, R.; Liu, X.; Willner, I. Chemiluminescent and Chemiluminescence Resonance Energy Transfer (CRET) Detection of DNA, Metal Ions, and Aptamer−Substrate Complexes Using Hemin/G-Quadruplexes and CdSe/ZnS Quantum Dots. J. Am. Chem. Soc. 2011, 133, 11597−11604.

F

dx.doi.org/10.1021/jp4027892 | J. Phys. Chem. C XXXX, XXX, XXX−XXX