Construction of a Proteome Profile and Functional ... - ACS Publications

Spermatogenesis is a complex process of terminal differentiation wherein mature sperm are produced. In the first wave of mouse spermatogenesis, differ...
0 downloads 0 Views 42MB Size
Download PDF
Construction of a Proteome Profile and Functional Analysis of the Proteins Involved in the Initiation of Mouse Spermatogenesis Xiao-yan Huang, Xue-jiang Guo, Jian Shen, Yu-feng Wang, Lin Chen, Jin Xie, Ning-ling Wang, Fu-qiang Wang, Chun Zhao, Ran Huo, Min Lin, Xinru Wang, Zuo-min Zhou,* and Jia-hao Sha Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing, 210029, China Received March 7, 2008

Spermatogenesis is a complex process of terminal differentiation wherein mature sperm are produced. In the first wave of mouse spermatogenesis, different spermatogenic cells appear at specific time points, and their appearance is expected to be accompanied by changes in specific protein expression patterns. In this study, we used 2D-PAGE and MALDI-TOF/TOF technology to construct a comparative proteome profile for mouse testis at specific time points (days 0, 7, 14, 21, 28, and 60 postpartum). We identified 362 differential protein spots corresponding to 257 different proteins. Further cluster analysis revealed 6 expression patterns, and bioinformatics analysis revealed that each pattern was related to many specific cell processes. Among them, 28 novel proteins with unknown functions neither in somatic cells nor germ cells were identified, 8 of which were found to be uniquely or highly expressed in mouse testes via comparison with the GNF SymAtlas database. Further, we randomly selected 7 protein spots and the above 8 novel proteins to verify the expression pattern via Western blotting and RT-PCR, and 6 proteins with little information in testis were further investigated to explore their cellular localization during spermatogenesis by performing immunohistochemistry for the mouse testis tissue. Taken together, the above results reveal an important proteome profile that is functional during the first wave of mouse spermatogenesis, and they provide a strong basis for further research. Keywords: spermatogenesis • testis development • comparative proteome • bioinformatics analysis

Introduction Spermatogenesis is a biological process that involves successive mitotic, meiotic, and postmeiotic phases. During this complex process, round undifferentiated spermatogonia become elongated, terminally differentiated spermatozoa; this requires a precise and well-coordinated system that regulates the constantly changing patterns of gene and protein expression. It is known that the ultimate molecular regulation in male germ cells, as in all other cells, primarily occurs at the transcription level, next at the translation level, and thereafter at the post-translation level.1 The first of these stages focuses on gene expression, while the latter 2 are biased toward protein expression. In the last 20 years, the identification of numerous genes essential for the development of male germ cells has crucially improved knowledge on spermatogenesis. Further, a few laboratories have recently made considerable advances with regard to genome sequencing and microarray analysis and have observed the genome-wide expression patterns during spermatogenesis.2–5 However, a transcriptomic database can only serve as a starting point for understanding the functioning of a cell or whole tissue at the molecular level and for establishing that * To whom correspondence should be addressed. Zuomin Zhou, Laboratory of Reproductive Medicine, Department of Histology and Embryology, Nanjing Medical University, 140 Hanzhong Road, Nanjing, Jiangsu province, People’s Republic of China. Postal code: 210029. Phone: 86-025-86862908. Fax: 86-025-86862908. E-mail: [email protected]. 10.1021/pr800179h CCC: $40.75

 2008 American Chemical Society

proteins are the bona fide executors of life-cycle processes. Moreover, transcriptomics poses certain limitations since a majority of mRNAs and proteins are not always correlated.6,7 This feature is particularly distinct during spermatogenesis due to the following points: (1) male germ cell-specific proteins may be synthesized from specific alternate transcripts; (2) transcription is arrested during spermiogenesis, and preexisting mRNAs are stored for several days; (3) for the completion of spermatogenesis, appropriate temporal activation of the stored messages is required, and translational activation must occur independent of transcriptional control.1,8,9 Therefore, some researchers have focused their interest on protein expression, particularly via proteome analysis, during male germ-cell development. Recently, proteomes for Drosophila melanogaster sperm,10 rat spermatogonia,11 different rat spermatogenic cells,12 and human sperm13 have been reported. In our laboratory, we have previously established a proteome reference map by using adult mouse testis and we have performed a proteomic analysis for a heat-induced spermatogenic disorder in adult male mice.14 Proteomics is developing as a useful tool in male reproductive biology; however, only a few researchers have used proteomics to investigate the expression pattern during spermatogenesis in whole developing testis, particularly during the first wave of spermatogenesis, wherein germ cells multiply and differentiate in a synchronous manner in the testis. Therefore, the aim of the present study is to establish a proteome profile during the initiation of mouse spermatogenesis and to identify Journal of Proteome Research 2008, 7, 3435–3446 3435 Published on Web 06/27/2008

research articles more of the proteins involved in this process. After confirming specific time points by hematoxylin and eosin (H&E) staining, we used mouse testes at days 0, 7, 14, 21, 28, and 60 to perform a comparative proteomic analysis. We identified 362 significantly differentiated protein spots and MS/MS validated a subset of 86 of these. Further cluster analysis revealed 6 expression patterns, and bioinformatics analysis revealed that each pattern was related to many specific cell processes mostly in somatic cells and provided important information for further research during spermatogenesis. In addition, among them, we identified 28 novel proteins with unknown functions in the profile and 8 proteins that were uniquely or highly expressed in the mouse testis via comparison with the GNF SymAtlas database. Then we randomly selected 7 protein spots and the above 8 novel proteins to verify the expression patterns via Western blotting and RT-PCR, and 6 proteins were further investigated to explore cellular localization by performing immunohistochemistry (IHC) for the mouse testis tissue. Taken together, the above results reveal an important proteome profile that is functional during the first wave of mouse spermatogenesis and which also provides a resource for future study of many proteins with unknown function occurring in mouse spermatogenic cells.

Experimental Methods Animals. Pregnant ICR mice were obtained from the laboratory animal center of Nanjing Medical University (Nanjing, China) and were maintained in a controlled environment under a 12/12-h light/dark cycle at 20-22 °C and 50-70% humidity, with food and water available ad libitum. Following litter delivery, the testes of the male offspring were collected at different times postpartum (on days 0, 1, 3, 4, 7, 8, 10, 11, 14, 18, 20, 21, 26, 28, and 60) and were fixed in Bouin’s solution. The fixed tissues were then paraffin-embedded, sectioned, and stained with hematoxylin and eosin for histological examination in order to select specific time points. To facilitate the further analysis, finally, 6 time points during the first wave of mouse spermatogenesis (days 0, 7, 14, 21, 28, and 60) were selected (refer to Results for details). Protein Extraction. Testes obtained from the mice at the abovementioned 6 time points (3 independent mouse groups for each time point) were homogenized in lysis buffer (7 M urea, 2 M thiourea, 4% [w/v] CHAPS, 2% [w/v] DTT, and 2% [v/v] IPG buffer [pH 3-10]) in the presence of 1% (v/w) protease inhibitor cocktail (Pierce Biotechnology, Rockford, IL). The mixture was placed on a shaker at 4 °C for 1 h, and the insoluble matter was subsequently removed by centrifugation at 40 000g and 4 °C for 1 h. The protein concentration in each sample was determined by the Bradford method, using BSA as the standard. Two-Dimensional Electrophoresis. IPG strips (length, 24 cm; pH, 3-10 NL; Bio-Rad) loaded with 120 µg of proteins extracted from the mouse testes were rehydrated. Following isoelectric focusing, the IPG strips were equilibrated, run in an Ettan DALT twelve electrophoresis system (GE Healthcare, San Francisco, CA), and visualized by silver staining as described previously.14,15 Statistical Analysis. The stained gels were scanned, and the ImageMasterTM 2-D Platinum Software (Version 5.0, Amersham Bioscience, Swiss Institute of Bioinformatics, Geneva, Switzerland) was used for spot detection, quantification, and comparative analyses, as described previously.14 In this experiment, 24 gels were analyzed in total: 3 containing the independent protein groups and 1 containing a mixture of these 3436

Journal of Proteome Research • Vol. 7, No. 8, 2008

Huang et al. for each of the 6 time points. Thus, proteins from each time point were repeated four times. The expression level was determined based on the relative volume of each spot in the gel and was expressed as a percentage (%volume ) [spot volume/∑ volumes of all the spots resolved in the gel]). Only protein groups corresponding to the spots present in all gels were considered for differential analysis. The values obtained for 24 independent experiments were pooled for calculating the means and standard deviation. Protein spots differentially changed across time were determined if the P-value was less than 0.05 by statistical analysis (ANOVA). And the P-value corresponding to each differentiated spot is shown in the Supplemental Table 1. Protein Identification by MALDI-TOF/TOF. The differentiated protein spots were excised, dehydrated in acetonitrile (ACN), and dried at room temperature. The proteins were reduced using 10 mM DTT/25 mM NH4HCO3 at 56 °C for 1 h and were subsequently alkylated in situ with 55 mM iodoacetamide/25 mM NH4HCO3 in the dark at room temperature for 45 min. The gel fragments were thoroughly washed with 25 mM NH4HCO3, 50% ACN, and 100% ACN and dried in a Speed-Vac. These dried gel fragments were reswollen with 2-3 µL of trypsin (Promega, Madison, WI) solution (10 ng/µL in 25 mM NH4HCO3) at 4 °C for 30 min. The excess liquid was discarded, and the gel plugs were incubated at 37 °C for 12 h. Trifluoroacetic acid (TFA) at a final concentration of 0.1% was added to arrest the digestive reaction. The digests were immediately spotted onto 600-µm AnchorChips (Bruker Daltonics, Bremen, Germany). Spotting was achieved by pipetting 1 µL of the analyte onto the MALDI target plate in duplicate and subsequently, 0.05 µL of 2 mg/mL R-HCCA in 0.1% TFA/33% ACN containing 2 mM (NH4)3PO4 was added. Bruker peptide calibration mixture (Bruker Daltonics, Bremen, Germany) was also spotted for external calibration. All samples were air-dried at room temperature, and 0.1% TFA was used for on-target washing. All the samples were then analyzed on a time-of-flight Ultraflex II mass spectrometer (Bruker Daltonics, Bremen, Germany) in the positive-ion reflectron mode. Each acquired mass spectrum (m/z range, 700-4000; resolution, 15 000-20 000) was processed using the FlexAnalysis v2.4 and Biotools 3.0 software packages (Bruker Daltonics, Bremen, Germany) with the following specifications: peak detection algorithm, Sort Neaten Assign and Place (SNAP); S/N threshold, 3; and quality factor threshold, 50. Tryptic autodigestion ion picks (842.51, 1045.56, 2211.10, and 2225.12 Da) were used as internal standards for validating the external calibration procedure. Matrix and/or autoproteolytic trypsin fragments, or known contaminants (e.g., keratins), were removed. The masses of the peptides thus obtained were first searched for in the IPI mouse database (53 981 sequences) using Mascot (v2.1.03) in the automated mode with the following search parameters: a significant protein score at p < 0.05; minimum mass accuracy, 100 ppm; enzyme, trypsin; missed cleavage sites allowed, 1; cysteine carbamidomethylation; acrylamide-modified cysteine; methionine oxidation; similarity between pI and relative molecular mass specified; and a minimum sequence coverage of 15%. Protein identification was confirmed using the sequence information obtained by performing MS/MS. Each acquired MS/MS spectrum was also processed using the FlexAnalysis v2.4 and Biotools 3.0 software packages (Bruker Daltonics) by the SNAP method at a signal-to-noise ratio threshold of 3.0.

research articles

Proteome Profile in the Initiation of Mouse Spermatogenesis The MS/MS spectra were searched for in the IPI mouse database, using Mascot (v2.4) in the automated mode with the following search parameters: 100 ppm for the precursor ion and 0.3 Da for the fragment ions. The cleavage specificity and covalent modifications were considered as described above, and the score obtained was higher than the minimal significant (P < 0.05) individual ion score. All significant MS/MS identifications performed using Mascot were manually verified for spectral quality and for matching the y and b ion series. In the case of multiple entries corresponding to slightly different sequences, only the database entry exhibiting the highest number of matching peptides was included. These identified proteins are listed in Supplemental Table 1. Cluster Analysis. Identified proteins were subjected to clustering analysis. For each identified protein spot, mean abundance values from the four repeats were calculated and then normalized. The normalized abundance values were then loaded into the Cluster 3.0 software,16 and the protein spots were clustered using k-Means algorithm with similarity metric of Euclidian distance. Different numbers of clusters were tried and the one with minimal number of clusters and also giving sufficient separation of expression patterns across time was finally chosen. The clustering results were viewed using TreeView software.17 Bioinformatics Analysis Using Pathway Studio. To further explore the significance of proteins in each cluster, the Pathway Studio (v5.00) software (Ariadne Genomics, Inc., MD), a specialized graph visualization engine, was used to determine the relevant molecular functions of proteins exhibiting significantly differential expression during mouse testis development. The gene list was imported into Pathway Studio to identify the cell processes influenced by these proteins. Each identified cellular process was confirmed via the Pub Med/Medline hyperlink embedded in each node. GNF SymAtlas Database analysis. We compared each protein profile with those in Pubmed and thus identified several novel proteins with unknown functions. To predict the roles of these novel proteins in mouse testis spermatogenesis, we analyzed their tissue expression patterns via the GNF SymAtlas database, a database of publishing experimental gene functionalization for gene expression profiles from normal human and mouse samples across a diverse array of tissues, organs, and cell lines.19 Western Blot Analysis and Reverse Transcriptional PCR (RT-PCR). The protein levels of Hspa5, Arhgdia, Cct5, Prdx4, Sod2, Ddx4, Pdia3, and β-actin in the mouse testis tissue at the 6 time points (days 0, 7, 14, 21, 28, and 60) were analyzed by previously described methods.14 Antibodies against Hspa5 (1:100), Arhgdia (1:100), Cct5 (1:100), and Prdx4 (1:50) were commercially obtained from Santa Cruz Biotechnology. The other antibodies against Sod2 (1:2000), Ddx4 (1:100), Pdia3 (1: 1000), and β-actin (1:5000) were obtained from Abcam. β-Actin was used as the positive control. cDNAs of mouse testis from 6 time points during the first wave of mouse spermatogenesis (days 0, 7, 14, 21, 28, and 60) were prepared to perform RT-PCR with the abovementioned 8 novel testis proteins. RNA was extracted with Trizol reagent (Gibco BRL, GrandIsland, NY) and reverse-transcribed into cDNA with AMV reverse transcriptase (Promega). The various cDNAs were PCR-amplified with specific primers (Table 1) in 20 µL of PCR reactions containing 10× PCR buffer (2 µL), 25 mmol/L Mg2+ (1.5 µL), 2 mmol/L dNTPs (1.5 µL), Taq DNA polymerase (5 U/mL) (0.1 µL), distilled water (10.9 µL), 5 pmol

Table 1. Specific Primers of the 8 Novel Proteins name

sequences

1700019b03rik F: 5′ TTGACCGGGATTCAATGCCCTCG3′ R: 5′ GCCCTCTTACACATCAAGGCTGG3′ Sept10 F: 5′ GGTCGTCAGTATCCTTGGGGTA 3′ R: 5′ TGACGCTCACCATAGAACTCGTG 3′ 1110004e09rik F: 5′ CTGCACCCTAATATGCAAGGGCTG 3′ R: 5′ ATGACCGCACCTCGAAGCTG 3′ 1700113h08rik F: 5′ ACTCCAAGGGAGATTCTGGTCCTG 3′ R: 5′ GATGCTTGAGGGTCGTCTCTGG 3′ Prdx6-rs1 F: 5′ GGATGCTAACAGCATGCCTCTGAC 3′ R: 5′ TCGGGAAGGACCATCACGCTC3′ 1700037h04rik F: 5′ TGGCAGTGTCAAGTAGGAGCTGC 3′ R: 5′ CTGTGCAGGATCTTCAGGAAGCCA 3′ Acyp1 F: 5′ TCGGATCATCCAAGTGTTTGAGC 3′ R: 5′ CATGAAGCGCACCTTGGAGACG 3′ Irgc1 F: 5′ CCTGCCACCTCTTACTGTTC 3′ R: 5′ATTGATGAGGGAGGACTTGC3′

product length

232 bp 251 bp 281 bp 234 bp 210 bp 241 bp 209 bp 325 bp

primer (1 µL), and template cDNA (2 µL). The amplification conditions consisted of an initial denaturation at 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 52 °C for 30 s and 72 °C for 30 s, with a final extension at 72 °C for 7 min. The PCR products were analyzed with 1.5% (w/v) agarose electrophoresis, and mouse β-actin was amplified as the control. IHC. Testicular sections fixed in Bouin’s solution and embedded in paraffin were immunostained as described previously.18 In brief, the sections were incubated in 2% H2O2 for quenching the endogenous peroxidase activity and were washed in phosphate-buffered saline (PBS). They were then blocked with a blocking serum and incubated overnight at 4 °C with primary antibodies against Hnrpa2b1 (1:100), Arhgdia (1:50), Prdx4 (1:50), Pdia3 (1:3000), Hsp27 (1:100), and DDAH (1:10). After three washings with PBS, the sections were incubated with HRP-conjugated secondary antibodies. The immunoreactive sites were visualized as brown staining with diaminobenzidine and were mounted for performing bright-field microscopy (Axioskop 2 plus, ZEISS, Germany). The negative controls were incubated with a solution devoid of any primary antibody.

Results Identification of specific Time Points during the First Wave of Mouse Spermatogenesis. Consistent with previous literature,20 by performing H&E staining, we observed that the mitotic phase lasts for approximately 11 days, the meiotic phase for approximately 10 days, and the postmeiotic phase for approximately 14 days. Therefore, to make the further analysis economically and effectively, we selected 6 time points, which evidently represented the specific phase of spermatogenesis, from the abovementioned 15 time points originally considered. As shown in Figure 1, the seminiferous epithelium in the testes of newborn mice contained 2 distinct cell typessgonocytes and Sertoli cells. By postpartum days 6-7, the germ cells had adhered to the basement membrane, and mitosis was initiated. The primary spermatocytes attained an early pachytene stage by day 14, and the number of round spermatids increased by day 21; this signified the onset of spermiogenesis. By day 28, elongating spermatids were observed, and normal asynchronous spermatogenesis was in progress in the testis tissue on day 60. Identification of Proteins Related to the First Wave of Mouse Spermatogenesis. 2-DE of the testis tissue samples was performed on days 0, 7, 14, 21, 28, and 60 over a pH range of Journal of Proteome Research • Vol. 7, No. 8, 2008 3437

research articles

Huang et al.

Figure 1. H&E staining at 6 time points (days 0, 7, 14, 21, 28, and 60). Each one represented specific phases of mouse spermatogenesis. The seminiferous epithelium in the testes of newborn mice only contained gonocytes and Sertoli cells. By postpartum days 7, gonocytes had adhered to the basement membrane, and mitosis began. By day 14, the primary spermatocytes prepared to the first stage of meiosis. By postpartum day 21, the second stage of meiosis was processing and produced round spermatids. By postpartum day 28, elongating spermatids were observed and spermiogenesis began. On day 60, normal asynchronous spermatogenesis occurred in the testis tissue.

3-10 (Figure 2). By examining the 2-DE gels with the ImageMaster 2D Platinum software, we obtained 487 spots that were significantly (P < 0.05) different. Finally, 362 spots corresponding to 257 proteins were successfully identified via MALDI-TOF/ TOF and 86 spots were further validated via MS/MS (Supplemental Table 1). These protein spots were considered highly related to specific phases in the first wave of mouse spermatogenesis and further emphasized. Also, the results showed many proteins in the profile yielded more than 2 spots in the gel. Cluster Analysis. Cluster analysis was performed to better characterize the more specific and unique expression patterns of the 362 protein spots. Finally, 6 numbers of clusters corresponding to 6 distinct expression patterns with relatively discrete chronological boundaries emerged with time. These 6 unique patterns included high expression immediately postpartum (day 0) (Figure 3, C0); upregulation on postpartum day 7 (Figure 3, C1); dramatic upregulation only on postpartum day 14, followed by downregulation in adulthood (Figure 3, C2); high expression mainly on day 21 with sustained expression until day 28 (Figure 3, C3); induction on day 28 with sustained elevation until adulthood (Figure 3, C4); and significantly elevated expression in adulthood (Figure 3, C5). Bioinformatics Analysis. Supplemental Table 2 shows the relationship between the important specific cell processes and the proteins involved in each cluster. List 2-41 showed the proteins (19/54, 35%) belonging to C0 participate in the 6 cell processes related to “stem cell properties”, such as embryogenesis, embryonic development, anagen and so forth. List 42-119 showed the proteins (22/35, 63%) belonging to C1 were concerned with the 11 cell processes related to mitosis. List 120-169 showed the proteins (25/75, 33%) belonging to C2 were involved in the 8 cell processes related to meiosis. List 170-207 showed the proteins (23/94, 24%) belonging to C3 and 3438

Journal of Proteome Research • Vol. 7, No. 8, 2008

C4 participate in the 4 cell processes related to spermiogenesis, also indicated in Figure 4 as an example. List 208-246 displayed the proteins (23/84, 27%) belonging to C4 and C5 were concerned with the 6 cell processes related to fertilization. Tissue Expression of Novel Proteins. On the basis of the profiles analyzed, 28 novel proteins with unknown functions neither in somatic cells nor germ cells were identified. GNF SymAtlas database analysis revealed 3 to be uniquely expressed and 5 to be highly expressed in mouse testes. Figure 5 shows the tissue expression profiles of 2 representative proteins that were uniquely and highly expressed in the testes. And these 8 novel proteins are the perfect candidates for further exploring their roles during mouse spermatogenesis. Western Blot Analysis and RT-PCR. To verify the results of 2D-PAGE of the identified proteins, we randomly selected several known proteins for Western blot. Because in the gel usually more than 1 spot represents 1 protein, we considered the results of Western blot should be identical with the protein spots which had the proper molecular weight in the gel. As shown in Figure 6A, the results of Western blot and 2D-PAGE analyses were sufficiently consistent. Such as with the protein Arhgdia, the Western blot showed it was highly expressed postpartum and with sustained expression until day 21, then the expression level was reduced. And also the corresponding spot in the gel changed the expression level with the similar tendency, as seen in Cluster 0. The expression patterns of Hspa5, Cct5 and Sod2 were similar as seen in Cluster 3 and indicated induced expression on day 14 or 21 and sustained expression level until day 28. The expression level of Pdia3 was mostly induced on day 21 and day 28 as in Cluster 4. Ddx4 and Prdx4 were highly expressed on day 60, while Ddx4 was induced on day 14 and gradually increased, and one isoform

Proteome Profile in the Initiation of Mouse Spermatogenesis

research articles

Figure 2. 2-DE gels of mouse testis tissue samples at the 6 time points. Differential expressed proteins were extracted, separated by 2D-PAGE, and visualized by silver staining.

Figure 3. Cluster analysis of 362 differentially expressed protein spots. Six numbers of clusters corresponding to 6 distinct expression patterns were identified. Green shows the expression level repressed and red shows the expression level induced.

of Prdx4 (white arrow) was only highly expressed in adulthood. Both of them fell into Cluster 5. As to the novel proteins that have only sequence information in NCBI, no antibody can be obtained at present, so we used RT-PCR to verify the expression pattern in the 2D results. Figure 6B showed the results of RT-PCR (left) for the 8 novel proteins which were uniquely or highly expressed in mouse testes were similar with the 2D-PAGE results. All were highly expressed in adult mouse testis.

Figure 4. Four specific cellular processes (yellow), 23 participating proteins (red) were identified and were consistent with previous literatures (the line) in Cluster 3 and 4, related to spermiogenesis.

IHC. To explore the preliminary function of the identified proteins, we selected several proteins that the literature indicated little information in testis, and performed IHC to define the cellular localization for mouse testis tissue with the 6 time points. 1. Hsp27: This protein was highly expressed in the spermatogonial cytoplasm in the testes of the newborn mice. However, later, it was mostly expressed in the cytoplasm of the primary spermatocytes, while the other spermatogenic cells exhibited faint immunoreactivity (Figure 7A). Journal of Proteome Research • Vol. 7, No. 8, 2008 3439

research articles

Huang et al.

Figure 5. GNF SymAtlas database analysis shows the tissue distribution of proteins with unknown funcitons. (A) One protein with unknown function was uniquely expressed in the mouse testis; (B) another protein was highly expressed in the mouse testis.

Figure 6. Western blot validation of known proteins and RT-PCR validation of novel proteins. The expression tendency was almost identical. (A) The left panel shows the results of Western blot analysis performed with randomly selected 7 protein antibodies using aliquots of total protein extracts from mouse testis tissue at the 6 time points. The right panel shows the corresponding spots with the same molecular weight distributed in the 2-DE gels. (B) The left panel shows the results of RT-PCR with 8 novel protein specific primers using cDNA of mouse testis tissue at the 6 time points. The right panel shows the corresponding spots distributed in the 2-DE gels.

2. Hnrpa2b1: A weak signal was obtained for this protein in the spermatogonia of the mouse testes on days 0 and 7. With 3440

Journal of Proteome Research • Vol. 7, No. 8, 2008

the appearance of spermatocytes, it was expressed in the spermatocyte nucleus during the early stage, while the sper-

Proteome Profile in the Initiation of Mouse Spermatogenesis

research articles

Figure 7. Immunolocalization of Hsp27 (A) and Arhgdia (B) in the mouse testis at the 6 time points. (A) Hsp27 was highly expressed in the spermatogonial cytoplasm (arrows) in the testes of the newborn mice. Later, it was mostly expressed in the cytoplasm of the primary spermatocytes (arrowheads). (B) Arhgdia was diffusively expressed in the seminiferous tubules of the mouse testes on days 0 and 7. With the appearance of spermatogenic cells of all stages, the signal became stronger, and distinct immunoreactivity was observed in the Sertoli cells (arrows). Scale bars are all 10 µm.

matogenic cells at later stages almost completely lacked immunoreactivity (Supplemental Figure A). 3. Pdia3: This protein was expressed in the spermatogonial cytoplasm in the testes of the newborn mice; subsequently, an intermediate signal was distributed in the spermatogenenic cells at every level, particularly in the round and elongated spermatids. Leydig cells and Sertoli cells lacked immunoreactivity (Supplemental Figure B). 4. Arhgdia: This protein was diffusively expressed in the seminiferous tubules of the mouse testes on days 0 and 7. With the appearance of spermatogenic cells of all stages, the signal became stronger, and distinct immunoreactivity was observed in the Sertoli cells (Figure 7B).

5. Prdx4: A weak signal corresponding to this protein appeared in the spermatogonia of the testis during the first week and subsequently diffused toward the spermatogenic cells at other stages. However, strong immunoreactivity was observed in the spermatids and residual bodies in the adult testes. Simultaneously, during testicular differentiation, Leydig cells also yielded a similar strong signal (Figure 8A). 6. DDAH: In the mouse testis tissue during the first week, this protein was expressed in the spermatogonial nucleus, and an intermediate signal was observed in the interstitial cells. While the spermatogonia were attached to the basement, the signal became increasingly weak, and the signal in the Leydig cells became stronger. In the adult testis, DDAH was highly Journal of Proteome Research • Vol. 7, No. 8, 2008 3441

research articles

Huang et al.

Figure 8. Immunolocalization of Prdx4 (A) and DDAH (B) in the mouse testis at the 6 time points. (A) A weak signal corresponding to Prdx4 appeared in the spermatogonia of the testis during the first week. However, strong immunoreactivity was observed in the spermatids and residual bodies in the adult testes (arrowhead). Simultaneously, during testicular differentiation, Leydig cells also yielded a similar strong signal (arrows). (B) During the first week, DDAH was expressed in the spermatogonial nucleus, and an intermediate signal was observed in the interstitial cells. While the spermatogonia were attached to the basement, the signal in the Leydig cells became stronger. In the adult testis, DDAH was highly expressed in the Leydig cells (arrows). Scale bars are all 10 µm.

expressed in the Leydig cells but yielded a weak signal in the spermatogenic cells (Figure 8B).

Discussion Spermatogenesis occurs in successive mitotic, meiotic, and postmeiotic phases; during this complicated process,1 the germ cells move from the periphery to the lumen of the seminiferous tubules. It is known that spermatozoa are continuously produced asynchronously in the postpubertal testes; this makes it difficult to identify the genes and proteins involved in specific actions within the testes. However, during the first wave of 3442

Journal of Proteome Research • Vol. 7, No. 8, 2008

spermatogenesis, germ cells multiply and differentiate in a synchronous manner in the testes.21 Therefore, the major stages of germ cell development can be independently analyzed to determine the cellular processes involved in the formation of spermatozoa. In the present study, after confirming specific time points by H&E staining, testes obtained from mice at postpartum days 0, 7, 14, 21, 28, and 60 were used to perform a comparative proteome analysis. We consider the above 6 time points to perfectly represent the following major stages of germ-cell development during the first wave of spermato-

Proteome Profile in the Initiation of Mouse Spermatogenesis genesis: the appearance of fetal testis exhibiting stem-cell properties (day 0); spermatogonial mitosis (day 7); initiation of spermatocyte meiosis (day 14); round-spermatid production (day 21); elongated-spermatid formation, also termed spermiogenesis (day 28); and normal postpubertal spermatogenesis (day 60). We assumed that many important and different proteins are expressed during these processes and that the identification of these differentially expressed proteins could serve as a useful basis for future studies on the biological factors influencing testicular development and spermatogenesis. In this study, 487 protein spots were observed to exhibit significantly (P < 0.05) differential expression and these spots were considered highly related to mouse spermatogenesis; further, 362 protein spots corresponding to 257 proteins were successfully identified. Thus, many proteins in the profile yielded more than 2 spots in the gel. We consider that many post-translational modification forms of these proteins exist during mouse testicular development and spermatogenesis. Further, cluster analysis revealed 6 distinct expression patterns of the abovementioned proteins. Next, we used the Pathway Studio (v5.00) software to determine the important cellular processes that are influenced by these proteins in each cluster; the results obtained were consistent with the previous literature. Thus, bioinformatics analysis provided abundant information on the functions of the identified proteins in somatic cells and also indicated their possible roles in mouse spermatogenesis. In C0, 54 proteins were highly expressed immediately postpartum, and 19 of these were previously reported to be involved in cell processes requiring stem-cell properties, such as embryogenesis, embryonic development, anagen and so forth. It is known that the testicular structure is established during the proliferation and differentiation of migrated primordial germ cells (PGCs) into gonocytes prepartum and that these gonocytes then undergo mitotic arrest, which is maintained until 3/4 days postpartum.22 After birth (approximately 6 days postpartum), gonocytes reach the basement membrane of the seminiferous tubules, and those that survive subsequently differentiate into spermatogonia. All these germ cells are termed “gonadal stem cells”.23 Although the proteins identified in association with stem-cell properties were found to be related to other stem cells, they can be presumed to play a potential role in the gonadal stem cells. Here, we select one protein Hsp27 (also named Hsp25) to explain the above prediction. Adly et al. demonstrated that the expression of Hsp27 was prominent in human scalp anagen hair follicles but was weak in both catagen and telogen hair follicles.24 Gernold et al. demonstrated that Hsp25 accumulation in mammals is developmentally regulated during mouse embryogenesis.25 Here, by performing IHC, we observed that Hsp27 was highly expressed in the cytoplasm of gonacytes during the first week; however, during the later stages, it was mostly expressed in the cytoplasm of the primary spermatocytes. Presuming that Hsp27 is strongly related to the properties of gonadal stem cells, it would be useful to investigate the functions of all the abovementioned proteins in these cells. In C1, 35 highly expressed proteins were identified. On day 7, as the gonacytes approached the basement of the seminiferous tubules, they began to produce spermatogonia. This was followed by spermatogonial proliferation via mitotic division.26 Further, in our study, many proteins were found to participate in proliferation, mitosis, mitogenesis and so forth. Such as CBX3

research articles

(HP1γ), a component of heterochromatin, Minc et al. demonstrated that in mammals, HP1R and HP1γ exist in different phosphorylated forms and become hyperphosphorylated at the time of mitosis.27 Another protein, Grb2, functions as a link between tyrosine kinase receptors and Ras signaling. Tari et al. observed that Grb2 downregulation inhibited the growth of ErbB2-overexpressing breast cancer cells, indicating its importance in the proliferation of this type of breast cancer cells.28 Although most of the above results were obtained in studies on somatic cells, they provide a large amount of useful information for investigating the functional mechanisms of these proteins during spermatogonial mitosis. In C2, the proteins that were highly expressed up to day 14 were considered to be involved in the initiation of spermatocyte meiosis. It is known that during the meiotic prophase, homologous chromosomes pair and undergo recombination, followed by 2 divisions, in the absence of an intervening S phase.29 In the present study, 13 proteins were confirmed to be strongly related to the meiosis and pachytene stages, consistent with the previous literature. It has been unequivocally established that most of these proteins, for example, Pgk-1, a key enzyme involved in the metabolism of glucose or fructose during glycolysis, participate in spermatocyte meiosis. In mammalian spermatogenic cells, transcriptional repression of the Pgk-1 gene occurs due to X-chromosome inactivation during the prophase of meiosis I.30 Other proteins such as aldose reductase, serum albumin, and GNAS are reported to be related to oocyte meiosis;31–33 however, no information is available regarding their roles in spermatocyte meiosis. Here, via IHC for mouse testis tissue, we also explored the preliminary function of another protein, Hnrpa2b1, selected from this cluster. Hnrpa2b1 is an important RNA-binding protein. Kamma et al. reported that it is expressed from the spermatogonium stage to the spermatocyte stage in rat testis.34 In the present study, it was weakly expressed in the spermatogonia of the mouse testis from days 0 to 7. With the appearance of spermatocytes, it was expressed in the spermatocyte nucleus during the early stage, while the spermatogenic cells at later stages almost completely lacked immunoreactivity. Therefore, we consider that Hnrpa2b1 probably plays an important role as a chaperone during spermatocyte meiosis. In addition, several cell processes occurring in somatic cells, such as chromosomal DNA replication, DNA recombination, DNA methylation, DNA nucleotide excision repair and so forth, are also implicated in the process of meiosis;35,36 further research should be conducted to explore the manner in which the proteins considered in this study along with those related to oocyte meiosis function during spermatocyte meiosis. Spermiogenesis is the phase of spermatogenesis during which round spermatids differentiate into elongated spermatozoa, with a unique process involving the formation of acrosome with a large vesicle structure, condensation of nucleus, generation of sperm tail and removal of most cytoplasm as residual body. During acrosome formation, many acrosome-specific proteins follow the exocytic pathway and are packed in proacrosomal granules,37 while microtubules and cytoskeletal elements are largely involved in the other processes of spermiogenesis.38,39 In this study, the proteins distributed in C3 and C4 were highly related to spermiogenesis. On the basis of information obtained using somatic cells, 23 of these proteins have been determined to be involved in cell processes Journal of Proteome Research • Vol. 7, No. 8, 2008 3443

research articles such as exocytosis, motility, contraction, and relaxation, which were considered related to spermiogenesis. Therefore, although we did not find any protein in these 2 clusters reported directly involved in spermiogenesis, we still suggest that these proteins may participate in mouse spermiogenesis, and further research should be conducted in this regard. Proteins that are highly expressed in adult mouse testes are suggested to be primarily involved in the future fertilizationrelated functions of the sperm, such as capacitation, acrosome reaction, sperm-egg recognition, binding, and fusion. The previous literature has identified 5 proteins (Fbp1, Glul, Grp58, Hspa2 and Sod1) in C4 and C5 as participants in fertilization. Ergur et al. demonstrated that diminished levels of the chaperone Hspa2 can predict IVF failure; therefore, they considered this protein to be strongly related to fertilization.40 IHC for mouse testis tissue revealed that another protein, ERp57, also referred to as Pdia3, was expressed in the spermatogonial cytoplasm in the testes of newborn mice and that an intermediate signal was distributed in spermatogenenic cells at every stage, particularly in round and elongated spermatids. In fact, we previously identified this protein as a human sperm acrosomal protein that plays a critical role in gamete fusion41 (because of some reason, it was not embodied in PathwayStudio software). Thus, we consider that not only Erp57 but also other proteins that are highly expressed in adult testis may play important roles in fertilization. Further, proteins involved in related cell processes such as mating, proteolysis, phagocytosis, conjugation, and motility are suggested to be strongly related to sperm function, and these proteins should be further investigated. Spermatogenesis is a complex process activated by testosterone, which is synthesized by Leydig cells and targets Sertoli cells.42 Interesting, we also observed that some proteins in our proteome profile were related to the functions of Sertoli or Leydig cells. Arhgdia, also known as Rho GDI, is a regulator that maintains the Rho-family members in a GDP-bound inactive form in the cytosol.43 In this study, IHC for mouse testis revealed that the signal was diffused in the newborn and 7-dayold mice. Subsequently, with the appearance of spermatogenic cells, the signal became increasingly strong, and distinct immunoreactivity was observed in the Sertoli cells. In fact, Togawa et al. observed that in the testis of Rho GDIa-/- mice, vacuolar degeneration occurred in germ cells at every spermatogenic stage, and they predicted that vacuolization may reflect Sertoli cell dysfunction.44 However, they did not discuss whether Rho GDIa was localized in Sertoli cells. Thus, to the best of our knowledge, this is the first report to directly indicate that mouse Rho GDI is primarily expressed in Sertoli cells; its precise role should be further investigated. DDAH is a dimethylarginine dimethylaminohydrolase that metabolizes the endogenous nitric oxide synthase (NOS) inhibitors NG-monomethyl-arginine and NG,NG-dimethyl-Larginine to citrulline.45 Kostic et al. demonstrated that inhibition of NOSs, the family of enzymes responsible for NO generation, prevented a similar inhibition of Leydig cell function.46 Although no report is available on the relationship between DDAH and Leydig cells, in our study, we observed that DDAH was in fact mostly expressed in the Leydig cells. This result provides a useful insight for further investigation of the role of DDAH in Leydig cells. Another protein, Prdx4, is the fourth isoform of peroxiredoxin. It exists as a 27-kDa secretable form in most tissues, while the 31-kDa Prdx4, which represents the unprocessed, 3444

Journal of Proteome Research • Vol. 7, No. 8, 2008

Huang et al. 47

membrane-bound form, is only found in testis. In adult rat testis, the 31-kDa form was observed to be highly expressed in the elongated spermatids and residual bodies; it was restricted to the membranes of the acrosome vesicle in the elongated spermatids and was not detected in spermatozoa, indicating that this form plays a role in acrosome formation during vesicular reorganization in spermiogenesis.48 However, to the best of our knowledge, there has been no report on the role of the 27-kDa form in the testis. Here, by performing a comparative proteomic analysis of mouse testis, we observed that the 31-kDa form of Prdx4 was in fact only expressed in the adult testis tissue. Western blotting revealed that its 27-kDa form was continually expressed in the testes of newborn to adult mice. Further, IHC for the mouse testis tissue indicated, in the adult testes, elongated spermatids and residual bodies exhibited strong immunoreactivity, and we consider that the 31-kDa form of Pxdx4 is localized here. However, strong signals were also distributed in the Leydig cells in the testes of newborn to adult mice; this result is significant, indicating that the 27-kDa form, which exhibits peroxidase activity, is expressed in the Leydig cells. A number of studies have suggested that oxidative damage induced by reactive oxygen species (ROS) can affect critical events associated with steroidogenesis in Leydig cells; therefore, these cells exhibit many protective mechanisms against antioxidants, including high antioxidant enzyme activity.49,50 It is known that peroxiredoxins play a role against oxidative damage; therefore, we predict that the 27-kDa form of Prdx4 is the functional antioxidative enzyme localized in Leydig cells during testicular development in mice. In addition to the abovementioned proteins with known functions in somatic cells but unknown functions in germ cells, we identified 28 novel proteins with unknown functions neither in somatic cells nor germ cells. To determine whether they are functional in mouse spermatogenesis, we investigated their tissue expression in comparison with information from a known database (GNF SymAtlas). Of these novel proteins, 3 were uniquely expressed and 5 were highly expressed in mouse testis tissue. Further RT-PCR results showed the mRNA expression level were similar with the protein level during the first wave of mouse spermatogenesis. So we consider these 8 proteins may play critical roles in spermatogenesis; it would be interesting to further conduct functional investigations on these proteins. In summary, by performing a comparative proteome analysis for mouse testis during the first wave of spermatogenesis, we constructed the protein expression profile involved in this process. Further, via bioinformatics analysis, we obtained information on proteins with known functions in somatic cells and on those with unknown functions; this information could serve as a basis for further exploration of the functions of these proteins in mouse spermatogenic cells.

Acknowledgment. The study was supported by grants from 973 program (2007CB948103), Chinese Natural Science Funds (30700274, 30425006), Program of Changjiang Scholars and Innovative Research Team in University (IRT0631) and Jiangsu Natural Sciences of University (07KJB310070). Supporting Information Available: Supplemental Table 1 with full peptide data sets. Supplemental Table 2 with identified proteins and cell processes in each cluster. Supplemental Figure with immunolocalization of Hnrpa2/b1 (A) and Pdia3 (B) in the mouse testis at the 6 time points. This material is available free of charge via the Internet at http://pubs.acs.org.

Proteome Profile in the Initiation of Mouse Spermatogenesis

References (1) Eddy, E. M. Male germ cell gene expression. Recent Prog. Horm. Res. 2002, 57, 103–128. (2) Sha, J.; Zhou, Z.; Li, J.; Yin, L.; Yang, H.; Hu, G.; Luo, M.; Chan, H. C.; Zhou, K. Identification of testis development and spermatogenesis-related genes in human and mouse testes using cDNA arrays. Mol. Hum. Reprod. 2002, 8, 511–517. (3) Schultz, N.; Hamra, F. K.; Garbers, D. L. A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 12201–12206. (4) Schlecht, U.; Demougin, P.; Koch, R.; Hermida, L.; Wiederkehr, C.; Descombes, P.; Pineau, C.; Jegou, B.; Primig, M. Expression profiling of mammalian male meiosis and gametogenesis identifies novel candidate genes for roles in the regulation of fertility. Mol. Biol. Cell 2004, 15, 1031–1043. (5) Shima, J. E.; McLean, D. J.; McCarrey, J. R.; Griswold, M. D. The murine testicular transcriptome: characterizing gene expression in the testis during the progression of spermatogenesis. Biol. Reprod. 2004, 71, 319–330. (6) Gygi, S. P.; Rochon, Y.; Franza, B. R.; Aebersold, R. Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 1999, 19, 1720–1730. (7) Conrads, K. A.; Yi, M.; Simpson, K. A.; Lucas, D. A.; Camalier, C. E.; Yu, L. R.; Veenstra, T. D.; Stephens, R. M.; Conrads, T. P.; Beck, G. R. A combined proteome and microarray investigation of inorganic phosphate-induced pre-osteoblast cells. Mol. Cell. Proteomics 2005, 4, 1284–1296. (8) Venables, J. P. Alternative splicing in the testes. Curr. Opin. Genet. Dev. 2002, 12, 615–619. (9) DeJong, J. Basic mechanisms for the control of germ cell gene expression. Gene 2006, 366, 39–50. (10) Dorus, S.; Busby, S. A.; Gerike, U.; Shabanowitz, J.; Hunt, D. F.; Karr, T. L. Genomic and functional evolution of the Drosophila melanogaster sperm proteome. Nat. Genet. 2006, 38, 1440– 1445. (11) Com, E.; Evrard, B.; Roepstorff, P.; Aubry, F.; Pineau, C. New insights into the rat spermatogonial proteome: identification of 156 additional proteins. Mol. Cell. Proteomics 2003, 2, 248–261. (12) Rolland, A. D.; Evrard, B.; Guitton, N.; Lavigne, R.; Calvel, P.; Couvet, M.; Jegou, B.; Pineau, C. Two-dimensional fluorescence difference gel electrophoresis analysis of spermatogenesis in the rat. J. Proteome Res. 2007, 6, 683–697. (13) Shetty, J.; Naaby-Hansen, S.; Shibahara, H.; Bronson, R.; Flickinger, C. J.; Herr, J. C. Human sperm proteome: immunodominant sperm surface antigens identified with sera from infertile men and women. Biol. Reprod. 1999, 61, 61–69. (14) Zhu, Y. F.; Cui, Y. G.; Guo, X. J.; Wang, L.; Bi, Y.; Hu, Y. Q.; Zhao, X.; Liu, Q.; Huo, R.; Lin, M.; Zhou, Z. M.; Sha, J. H. Proteomic analysis of effect of hyperthermia on spermatogenesis in adult male mice. J. Proteome Res. 2006, 5, 2217–2225. (15) Wang, L.; Zhu, Y. F.; Guo, X. J.; Huo, R.; Ma, X.; Lin, M.; Zhou, Z. M.; Sha, J. H. A two-dimensional electrophoresis reference map of human ovary. J. Mol. Med. 2005, 83, 812–821. (16) De Hoon, M. J. L.; Imoto, S.; Nolan, J.; Miyano, S. Open source clustering software. Bioinformatics 2004, 20, 1453–1454. (17) Saldanha, A. J. Java Treeview-extensible visualization of microarray data. Bioinformatics 2004, 20, 3246–8. (18) Armstrong, D. J.; Hiscott, P.; Batterbury, M.; Kaye, S. Corneal stromal cells (keratocytes) express thrombospondins 2 and 3 in wound repair phenotype. Int. J. Biochem. Cell Biol. 2002, 34, 588– 593. (19) Su, A. I.; Cooke, M. P.; Ching, K. A.; Hakak, Y.; Walker, J. R.; Wiltshire, T.; Orth, A. P.; Vega, R. G.; Sapinoso, L. M.; Moqrich, A.; Patapoutian, A.; Hampton, G. M.; Schultz, P. G.; Hogenesch, J. B. Large-scale analysis of the human and mouse transcriptomes. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 4465–4470. (20) Clermont, Y.; Trott, M. Duration of the cycle of the seminiferous epithelium in the mouse and hamster determined by means of 3H-thymidine and radioautography. Fertil. Steril. 1969, 20, 805– 817. (21) Nebel, B. R.; Amarose, A. P.; Hacket, E. M. Calendar of gametogenic development in the prepuberal male mouse. Science 1961, 134, 832–833. (22) Monk, M.; McLaren, A. X-chromosome activity in foetal germ cells of the mouse. J. Embryol. Exp. Morphol. 1981, 63, 75–84. (23) de Rooij, D. G.; Grootegoed, J. A. Spermatogonial stem cells. Curr. Opin. Cell Biol. 1998, 10, 694–701.

research articles

(24) Adly, M. A.; Assaf, H. A.; Hussein, M. R. Expression of the heat shock protein-27 in the adult human scalp skin and hair follicle: hair cycle-dependent changes. J. Am. Acad. Dermatol. 2006, 54, 811–817. (25) Gernold, M.; Knauf, U.; Gaestel, M.; Stahl, J.; Kloetzel, P. M. Development and tissue-specific distribution of mouse small heat shock protein hsp25. Dev. Genet. 1993, 14, 103–111. (26) de Kretser, D. M.; Loveland, K. L.; Meinhardt, A.; Simorangkir, D.; Wreford, N. Spermatogenesis Hum Reprod. 1998, 13, 1–8. (27) Minc, E.; Allory, Y.; Worman, H. J.; Courvalin, J. C.; Buendia, B. Localization and phosphorylation of HP1 proteins during the cell cycle in mammalian cells. Chromosoma 1999, 108, 220– 234. (28) Tari, A. M.; Hung, M. C.; Li, K.; Lopez-Berestein, G. Growth inhibition of breast cancer cells by Grb2 downregulation is correlated with inactivation of mitogen-activated protein kinase in EGFR, but not in ErbB2, cells. Oncogene 1999, 18, 1325– 1332. (29) Schlecht, U.; Primig, M. Mining meiosis and gametogenesis with DNA microarrays. Reproduction 2003, 125, 447–456. (30) McCarrey, J. R.; Dilworth, D. D.; Sharp, R. M. Semiquantitative analysis of X-linked gene expression during spermatogenesis in the mouse: ethidium-bromide staining of RT-PCR products. Genet. Anal. Tech. Appl. 1992, 9, 117–123. (31) Colton, S. A.; Downs, S. M. Potential role for the sorbitol pathway in the meiotic dysfunction exhibited by oocytes from diabetic mice. J. Exp. Zool., Part A 2004, 301, 439–448. (32) Faerge, I.; Grondahl, C.; Ottesen, J. L.; Hyttel, P. Autoradiographic localization of specific binding of meiosis-activating sterol to cumulus-oocyte complexes from marmoset, cow, and mouse. Biol. Reprod. 2001, 64, 527–536. (33) Haas, D.; White, S. N.; Lutz, L. B.; Rasar, M.; Hammes, S. R. The modulator of nongenomic actions of the estrogen receptor (MNAR) regulates transcription-independent androgen receptor-mediated signaling: evidence that MNAR participates in G protein-regulated meiosis in Xenopus laevis oocytes. Mol. Endocrinol. 2005, 19, 2035– 2046. (34) Kamma, H.; Horiguchi, H.; Wan, L.; Matsui, M.; Fujiwara, M.; Fujimoto, M.; Yazawa, T.; Dreyfuss, G. Molecular characterization of the hnRNP A2/B1 proteins: tissue-specific expression and novel isoforms. Exp. Cell Res. 1999, 246, 399–411. (35) Grimes, S. R. Testis-specific transcriptional control. Gene 2004, 343, 11–22. (36) Rousseaux, S.; Caron, C.; Govin, J.; Lestrat, C.; Faure, A. K.; Khochbin, S. Establishment of male-specific epigenetic information. Gene 2005, 345, 139–153. (37) Ramalho-Santos, J.; Schatten, G.; Moreno, R. D. Control of membrane fusion during spermiogenesis and the acrosome reaction. Biol. Reprod. 2002, 67, 1043–1051. (38) Kierszenbaum, A. L. Sperm axoneme: a tale of tubulin posttranslation diversity. Mol. Reprod. Dev. 2002, 62, 1–3. (39) Tanaka, H.; Baba, T. Gene expression in spermiogenesis. Cell. Mol. Life Sci. 2005, 62, 344–354. (40) Ergur, A. R.; Dokras, A.; Giraldo, J. L.; Habana, A.; Kovanci, E.; Huszar, G. Sperm maturity and treatment choice of in vitro fertilization (IVF) or intracytoplasmic sperm injection: diminished sperm HspA2 chaperone levels predict IVF failure. Fertil. Steril. 2002, 77, 910–918. (41) Zhang, J.; Wu, J.; Huo, R.; Mao, Y.; Lu, Y.; Guo, X.; Liu, J.; Zhou, Z.; Huang, X.; Sha, J. ERp57 is a potential biomarker for human fertilization capability. Mol. Hum. Reprod. 2007, 13, 633–639. (42) Sharpe, R. M. Testosterone and spermatogenesis. J. Endocrinol. 1987, 113, 1–2. (43) Sasaki, T.; Takai, Y. The Rho small G protein family-Rho GDI system as a temporal and spatial determinant for cytoskeletal control. Biochem. Biophys. Res. Commun. 1998, 245, 641–645. (44) Togawa, A.; Miyoshi, J.; Ishizaki, H.; Tanaka, M.; Takakura, A.; Nishioka, H.; Yoshida, H.; Doi, T.; Mizoguchi, A.; Matsuura, N.; Niho, Y.; Nishimune, Y.; Nishikawa, S.; Takai, Y. Progressive impairment of kidneys and reproductive organs in mice lacking Rho GDIalpha. Oncogene 1999, 18, 5373–5380. (45) MacAllister, R. J.; Parry, H.; Kimoto, M.; Ogawa, T.; Russell, R. J.; Hodson, H.; Whitley, G. S.; Vallance, P. Regulation of nitric oxide synthesis by dimethylarginine dimethylaminohydrolase. Br. J. Pharmacol. 1996, 119, 1533–1540. (46) Kostic, T. S.; Andric, S. A.; Maric, D.; Stojilkovic, S. S.; Kovacevic, R. Involvement of inducible nitric oxide synthase in stressimpaired testicular steroidogenesis. J. Endocrinol. 1999, 163, 409– 416. (47) Okado-Matsumoto, A.; Matsumoto, A.; Fujii, J.; Taniguchi, N. Peroxiredoxin IV is a secretable protein with heparin-binding

Journal of Proteome Research • Vol. 7, No. 8, 2008 3445

research articles properties under reduced conditions. J. Biochem. (Tokyo) 2000, 127, 493–501. (48) Sasagawa, I.; Matsuki, S.; Suzuki, Y.; Iuchi, Y.; Tohya, K.; Kimura, M.; Nakada, T.; Fujii, J. Possible involvement of the membranebound form of peroxiredoxin 4 in acrosome formation during spermiogenesis of rats. Eur. J. Biochem. 2001, 268, 3053–3061. (49) Diemer, T.; Allen, J. A.; Hales, K. H.; Hales, D. B. Reactive oxygen disrupts mitochondria in MA-10 tumor Leydig cells and inhibits

3446

Journal of Proteome Research • Vol. 7, No. 8, 2008

Huang et al. steroidogenic acute regulatory (StAR) protein and steroidogenesis. Endocrinology 2003, 144, 2882–2891. (50) Luo, L.; Chen, H.; Trush, M. A.; Show, M. D.; Anway, M. D.; Zirkin, B. R. Aging and the brown Norway rat leydig cell antioxidant defense system. J. Androl. 2006, 27, 240–247.

PR800179H