Fast and Strong Adsorption of Native ... - ACS Publications

Subscriber access provided by READING UNIV

Article

Fast and strong adsorption of native oligonucleotides on citrate coated gold nanoparticles Anna V. Epanchintseva, Pavel E Vorobjev, Dmitrii V. Pyshnyi, and Inna A Pyshnaya Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.7b02529 • Publication Date (Web): 11 Dec 2017 Downloaded from http://pubs.acs.org on December 13, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Langmuir is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Fast and strong adsorption of native oligonucleotides on citrate-coated gold nanoparticles Epanchintseva Anna1#, Vorobjev Pavel1,2#, Pyshnyi Dmitrii1,2*, Pyshnaya Inna1 1

Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian

Academy of Sciences, 8 Lavrentiev Avenue, Novosibirsk, 630090, Russia. 2

Novosibirsk State University, 2, Pirogova Street, Novosibirsk, 630090, Russia.

Abstract The adsorption of oligonucleotides on citrate-coated gold nanoparticles (AuNPs) is studied in conditions “right after the synthesis”, i.e. in a weak citrate solution at pH value close to neutral (5.8±0.2). We found that short-term elevation of reaction temperature under these conditions provides fast and strong adsorption of oligonucleotides on the surface of AuNPs. The affinity of oligonucleotides to AuNPs depends on the length of the oligonucleotide and its nucleotide composition. The shortest oligonucleotide in this study – T6 is the most affine, having the equilibrium binding constant KD=0,10±0,04 nM, and the highest surface density – up to 200 molecules per one particle. Olygothymidylates are at least as affine to AuNPs as oligoadenylates, while oligocytidilates show the lowest affinity. We also studied the interaction of resulting DNA/AuNPs with a series of low- and high-molecular thiols, which provide a variety of operations with adsorbed oligonucleotides: displacement (complete or partial) and encapsulation in a secondary shell. These experiments imitate someway the conditions in a living cell or serum, and show that DNA/AuNPs obtained by this method can be applied in a number of bionanotechnological applications, including delivery of nucleic acid therapeutics and theranostics.

Key words Gold nanoparticles, native oligonucleotides, DNA, non-covalent adsorption, affinity, proteins, thiols

Introduction Gold nanoparticles (AuNPs) play an important role in bionanotechnology1-3 and nanomedicine4-6 thanks to a number of valuable properties: non-toxicity, catalytic activity, conductivity, and unique optical characteristics (extremely high extinction coefficients, size- and shape-dependent ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

color).7-8 AuNPs of desired size and shape are easily synthesized in large quantities, and their colloids are stable enough to survive long storage times.9-10 AuNPs readily form stable nanocomposites with DNA, proteins, and other polymers.11-12 DNA-functionalized AuNPs (DNA/AuNPs) are very attractive as a bionanotechnologycal material for a wide range of applications including self-assembling systems13, biosensors14, drug delivery systems15, and theranostics.16-17 Specific interactions, particularly aptamer-target recognition and DNA hybridization, can be detected colorimetrically due to prominent color change during the aggregation of AuNPs.18 Generally, ssDNA is covalently attached to AuNPs via the thiol group.19-20 Thiol-containing oligodeoxynucleotides are synthesized commercially, although the cost of thiol addition is very high. A classical procedure of attachment to gold surface for thiolated DNAs is time-consuming, but it provides the highest surface density.21 In a recent work, fast and convenient procedure has been proposed which gives the same result with short-term exposure to low pH.22 Strong non-covalent adsorption of ssDNA on AuNPs first came into research focus more than a decade ago.23-24 This process was considered as hampering towards targeted interactions of the anchored DNA25. Nowadays, the adsorption of non-thiolated DNA to AuNPs is getting more practical value because of excellent stability of resulting DNA/AuNPs and ability of adsorbed DNAs to interact with their molecular targets. Therefore, the interaction between DNA and AuNPs requires better understanding. In the past years, non-covalent adsorption of nucleobases, deoxynucleosides and oligonucleotides onto gold films or AuNPs has been studied by a number of research groups.26-27 Depending on the application, different parameters of DNA/AuNPs are considered as critical. The surface density of adsorbed DNA has been studied in details in a number of publications.28-31 It was found that larger quantities of short oligonucleotides and smaller quantities of long oligonucleotides are adsorbed onto AuNPs.28 Higher salt concentrations increase the surface density;28 the number of oligonucleotides per AuNP has also been shown to rise at low pH (130 molecules of A15 at pH 3.0 versus 40 at pH 7.0).29 It should be noted that high adsorption density is rather a difficulty for applications based on DNA hybridization.30 The problem is manifested even more strongly when we need to control the number of "valences" for each particle.31 But for other applications including intracellular delivery of oligonucleotides as drugs or reporters higher surface density means higher efficacy. Adsorbed oligonucleotides can be released when the medium changes to intracellular (pH, salt, reducing agents, proteins). Taking into account the growing potential of gold nanoparticles for photothermal theranostics, we should also mention that oligonucleotides can significantly potentiate the overall therapeutic and diagnostic impact. 16, 32

ACS Paragon Plus Environment

Page 2 of 27

Page 3 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Another intriguing point is the influence of nucleotide composition on the adsorption strength. The study of the thermal desorption of nucleobases from gold films revealed a decrease in desorption temperature in the row G>A>C>T.33 The adsorption of pentanucleotides onto gold films by Fourier transform infrared spectroscopy was characterized by another affinity order: A>C≥G>T.23 In a surface plasmon resonance study based on nucleoside-driven agglomeration of AuNPs, the order was G,C>A>T.34 The effect of a nucleotide composition on hybridization of thiol-bound oligonucleotides resulted in A>C>G>T order of adsorption strength.25, 34 Such variations in the order of affinity can be explained by the differences in surface types and experimental conditions. The most obvious is the difference between bare flat gold films (111) and citrate-coated AuNPs, where (100) surfaces also present. Salt concentration varies as well from study to study, while remaining relatively high. The type of salt can also make a difference.35-36 Conventionally, adenine is considered as the most affine nucleobase towards citrate-coated AuNPs. Oligoadenylate tails have been successfully used for the controlleddensity DNA functionalization of AuNPs.21, 29, 35 The length of oligoadenylate tale influences the dissociation kinetics of oligonucleotides from AuNPs under various conditions.37 Here we propose a new and very simple method of DNA functionalization of citrate-coated AuNPs by short incubation at mildly elevated temperature without any additional salts, i.e. in a weak citrate solution at a pH value close to neutral (5.8±0.2). Oligonucleotides were adsorbed to AuNPs at 56 oC for only 30 min. Resulting DNA-coated AuNPs demonstrate an excellent stability during electrophoresis and centrifugation and allowed us to study some characteristics of binding of DNA to AuNPs. Surprisingly, oligothymidilates and oligoadenylates show nearly equal affinities to AuNPs under these conditions, whereas oligocytidilates are the least affine. We have also studied the interaction of DNA/AuNPs with various thiol-containing reagents, including those abundant in serum or intracellular media (albumins and glutathione). Depending on the reagent type, oligonucleotides can be completely or partially displaced from AuNPs. They can also be encapsulated by polymeric molecules like albumins or thiol-modified PEGs.

Experimental Chemicals Tetrachloroauric acid (HAuCl4·3H2O) was from Aurat, Russia. Sodium citrate dihydrate, bovine serum albumin (BSA), 11-mercaptoundecanoic (MUA, 95 %) and thioglycolic acid (TGA,80 %) were from Sigma–Aldrich. Human serum albumin (HSA) was from Reanal, Hungary, glutathione was from AppliChem, α-thio-ω-carboxy poly(ethylene glycols) (HS-PEG-COOH) 3,2 kDa and 4,9 kDa were from Iris Biotech, Tris and glycine were from Amresco. γ[32P]-ATP and T4 polynucleotide kinase (EC 2.7.1.78) were from Biosan, Russia. ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

All oligodeoxynucleotides were synthesized on ASM-800 (Biosset, Russia) by the solid-phase phosphoroamidite protocol using phosphoramidites from ChemGenes. Oligonucleotides were purified by reversed phase HPLC on Agilent 1200 Series using Zorbax® 5 µm Eclipse-XDBC18 80 Å column 150 x 4.6 mm by Agilent. Water was purified by a Simplicity 185 water system (Millipore) and had a resistivity of 18.2 MΩ·cm at 25 °C. Polythymidylate with estimated length of 300-500 nt was kindly provided by Dr. S.N. Khodyreva (ICBFM). HSA labeled38 with Cy5 dye was kindly provided by Dr. T.S. Godovikova (ICBFM).

Methods Preparation of citrate-coated AuNPs AuNPs were prepared using classic citrate reduction procedure.39 The size and monodispersity were determined by transmission electron microscopy,40 (15 ± 1 nm), and dynamic light scattering, (17.3 ± 2.1 nm). A typical suspension of AuNPs exhibited a characteristic surface plasmon band at 520 nm.40 The concentration of particles was 3.6±0.5·10-9 M, as calculated from absorbance at 520 nm using extinction coefficient (8.78 ± 0.06)×108 M-1cm-1.41 5’-End-[32P]-labeling of DNA Oligonucleotides (100 nmol) were 5’-[32P]-labeled in a solution (10 µl) containing 50 mM TrisHCl, pH 7.6, 10 mM MgCl2, 5 mM dithiothreitol, 50 µM (0.1 mCi) γ[32P]-ATP, and 10 units of T4 polynucleotide kinase, for 1-2 hours at 37 oC. The reaction mixture was subjected to flashchromatography on Waters C18 125 Å 55-105 µm resin. Activity of 32P-containing specimens was counted in water using liquid scintillation counter Tri-Carb 2800TR, Perkin-Elmer. Gels containing [32P]-labeled specimens were exposed to Imaging Screen-K. Images were recorded with Pharos FX Imager, Bio-Rad.

DNA adsorption onto AuNPs (A) High concentration range. DNA (at least 10x concentrated against final concentration) was added to the suspension of AuNPs to 5 µl final volume and 0.1 µM final AuNPs concentration, and incubated for 30 min at 56 oC. For radioactivity measurements, 0.01 µM of [32P]-labeled DNA was added. For excess DNA removal (when necessary), sodium citrate solution (1 ml, 3.9 mM) was added to DNA/AuNPs suspension and centrifuged for 25 min (13200 rpm, 25 ºC), and the supernatant was removed. Before loading onto 0.8% agarose gel, 1 µl of 50% glycerol was added as a loading solution. Electrophoresis was carried out for 30 min at 5 V/cm in 25 mM Tris, 250 mM glycine.


Page 4 of 27

Page 5 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(B) Low concentration range. At a low AuNP concentration (0.5 nM), DNA solution containing a small amount (0,05 – 0,5 nM) of [32P]-labeled DNA was added to AuNPs to 1.4 ml final volume. Suspensions were incubated for 30 min at 56 oC and centrifuged. Radioactivity of supernatants was measured. (C) For dynamic light scattering (DLS) experiments, AuNPs were 3.4 nM, oligonucleotides 3.4 µM, polyT - 34 µM by monomer. The suspension was centrifuged, the supernatant removed, and DNA/AuNPs were resuspended in the same citrate solution. Hydrodynamic diameter and ζpotential were determined using Zetasizer Nano NS, Malvern Instruments, UK.

The Langmuir isotherm The concentration of adsorbed DNA was determined at a fixed concentration of AuNPs (0.5 nM or 0.1 µM); a 2 -200-fold excess of DNA was added. The Langmuir constant was determined by fitting the data to the Langmuir isotherm θ = aKC/(1 + KC), where K is the Langmuir constant, a is the adsorption capacity, C is the DNA concentration, and θ is the adsorbed DNA.28

An equilibrium dissociation constant (binding curve) [32P]-labeled DNA (to 0.05 nM final concentration) was added to AuNPs to 1.4 ml final volume and final AuNPs concentration ranging from 0.05 to 40 nM, incubated for 30 min at 56 oC, and centrifuged. DNA low-bind tubes, Eppendorf, were used. The radioactivity of supernatants was measured and concentration of unbound oligonucleotide was determined. KD values were determined by nonlinear fitting of parameters using the equation Y = BmaxX/(KD + X), where X is the total concentration of AuNPs, and Y is the bound fraction of oligonucleotide, Bmax is the number of binding sites.42

Nonlinear regression All binding probes were taken at least in triplicate, obtained data sets were analyzed using Prism 5, GraphPad Software. Data were fitted to the Langmuir isotherm or binding curve. Standard deviation is represented on graphs in error bars. For typical graphs see Supporting Information.

Salt-induced coagulation AuNPs, 50 nM, and DNA, 30 µM, were incubated 30 min at 56 oC and aliquoted per 5 µl into microplate wells. NaCl, 1 µl, was added to provide final concentration 0.05 – 0.3 M. After 5 min of incubation microplates were scanned by flatbed scanner.

DNA displacement ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

After DNA adsorption to AuNPs excess DNA was removed by centrifugation. Displacing solution (100 µl for 0.1 µM AuNPs, 1.4 ml for 0.5 nM AuNPs) was added and incubated at 25 ºC. After the required amount of time suspensions were centrifuged, sediments and supernatants were analyzed separately by electrophoresis or radioactivity measurement. In experiments with Cy5-HSA supernatants were also analyzed using CLARIOstar plate fluorimeter, BMG Labtech, Germany, to determine the concentration of labeled protein.

Results and discussion The process of nucleic acid interaction with AuNP can be considered in a lot of aspects. Kinetic parameters of adsorption and desorption, thermodynamic stability of composites, stoichiometry and geometry of interaction are probably the smallest set of key characteristics for this process. These characteristics are affected by many parameters of the system26-27. First of all, these are the parameters of the AuNPs: the size, shape and type of coating. Next are those of the oligonucleotides: the length of the strand, the number of strands, and the nucleotide composition. And the last but not least is the environment, including the temperature, solvent, pH, ionic strength and ionic species. In this work we focused on the study of widely applied 15 nm AuNPs (15±1 nm by TEM, 17.3±2.1 nm by DLS) synthesized after classical procedure39 in a weak citrate solution, providing labile citrate coating of particles. Our goal was to examine the interaction of these AuNPs “right after synthesis” (without changing the environment) with synthetic single-stranded DNA fragments of varying length and composition. We use radioactive phosphate label consciously knowing that electrostatic repulsion between DNA and negatively charged particle surface significantly influences the adsorption process. We understand that at least for shortest oligonucleotides the influence of phosphate label cannot be completely negligible. Unfortunately, other kinds of labels, including very popular and convenient fluorescent dyes, can affect the affinity even more seriously43, since they someway imitate nucleobases of DNA, which play a key role in the adsorption process.

DNA adsorption

Taking into account that at least some interactions involved into adsorption process are hydrophobic36 and a well-known fact that hydrophobic interactions are potentiated with a temperature rise44, we studied DNA adsorption onto AuNPs varying the incubation temperature from 25 to 95 oC. AuNPs were incubated with hexaeicosathymidilate (T26) for 30 min and loaded


Page 6 of 27

Page 7 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

onto agarose gel. AuNPs were taken at a constant concentration of 0.1 µM, which provides a good visibility for 5 µl probes.

Figure 1. (A) Agarose gel electrophoresis of DNA/AuNPs. Adsorption of T26 on AuNPs (0.1 µM) depending on the concentration of T26 and reaction temperature for 30 min. Lane "0" citrate-coated AuNPs. (B) Adsorption of T26 (30 nM) on AuNPs (0.5 nM) depending on the incubation time at 56 oC. (C) Kinetics of 5’-[32P]-T26 displacement by 100-fold excess of nonlabeled T26 at 25 oC. Citrate-coated AuNPs coagulate gradually in a few minutes after the contact with Tris-glycine buffered agarose matrix (Figure 1A, lane “0”). Coagulation is accompanied by specific color transition to dark purple and results in low electrophoretic mobility of AuNPs aggregates. Samples incubated with DNA at 25-56 oC for 30 min produce on agarose gel bands of AuNPs with various mobility and unchanged color. DNA/AuNPs also do not aggregate in electrophoretic buffer, since no shift in SPR spectra is observed for DNA/AuNPs (see Supporting Information). An increase in the reaction temperature leads to formation of faster moving bands, their intensity also increasing with a rise of DNA concentration. Simultaneously, the intensity of slowly moving bands decreases. The mobility of DNA/AuNPs has some upper limit. These data suggest the saturation of AuNPs surface by oligonucleotides. Incubations for 30 min at 70 and 95 oC lead to aggregation of AuNPs in reaction tubes. In this case, very low sample recovery leads to "empty" lanes on the gel. It should be noted however, that shorter ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

incubation times (15 min at 70 oC or 10 min at 95 oC, not shown) give band distribution close to obtained at 56 oC and 6 nM, although with low reproducibility. This possibly takes place because of the lower stability of AuNP suspension in this temperature interval. The concentration of adsorbed DNA does not increase after 30 min of incubation (Figure 1B). Further we used incubation for 30 min at 56 oC for coating AuNPs with DNA. We tried to estimate the DNA desorption rate at 25 oC. Particles (0.5 nM) were loaded at 56 oC with T26 (0.2 µM), to maximize the load. After removing the excess of unbound labeled DNA by dilution and centrifugation we added a 100-fold excess of non-labeled DNA and measured the radioactivity of supernatants obtained after centrifugation (Figure 1C). We observed a very low loss of adsorbed oligonucleotide even after few days of incubation. The dissociation rate constant can be roughly estimated as 5·10-4 min-1. These results suggest a very high stability of the resulting DNA shell at 25 oC. Thus DNA/AuNPs allow long storage and manipulation without a significant loss of DNA. The concentration profile for T26 is shown in Figure 2A, upper pane. At a low concentration of T26 aggregation of AuNPs in the agarose gel is still observed. This fact does not necessarily indicate that no oligonucleotide is bound to AuNPs, rather the number of oligonucleotides bound is insufficient to prevent aggregation of AuNPs. Gradual increase of T26 concentration first leads to a rise of the particles stability (even the slowest band corresponding to 2 nM of oligonucleotide retains the original AuNPs color) and then gives an increase in mobility. The intensity of the band with the highest mobility increases significantly in the middle of the concentration range and then reaches a plateau (Figure 2A, lower pane depicts integral optical density for blue-boxed area on agarose gels). The fastest band is supposed to contain AuNPs with the highest density of adsorbed DNA, i.e. with the highest negative charge. This observation is further supported by the electrophoretic experiment with radiolabeled DNA presented in Supporting Information.


Page 8 of 27

Page 9 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure. 2. The concentration profiles of T26 (A) and T6 (B, C) adsorption on AuNPs (0.1 µM), analyzed by electrophoresis. Agarose gel electrophoresis (upper panes) and integral optical density (IOD) histograms (lower panes).

The slower diffuse band possibly corresponds to particles having lower mobility because of lower negative charge (i.e., less oligonucleotides adsorbed) and can arise because of the nonequilibrium character of electrophoretic separation. We compared concentration profiles for adsorption of a series of oligonucleotides and determined the saturating concentration (Csat, i.e., concentration at the start of the intensity plateau, magenta boxes in Figure 2) for each oligonucleotide (Table 1).

Table 1. AuNP-saturating concentrations (Csat) of oligonucleotides determined by electrophoresis DNA

T6 S1* A16 S2* S3* C2A20C2 Т26 C26

Length, nt 6 10 16 20 20 24 26 26

Csat, µM

DNA

26 >10 >10 6 6 6 6 8

A26 N26* (GT)13 (AC)13 S4* S5* T40 S6*

Length, nt 26 26 26 26 26 30 40 40

Csat, µM

6 6 6 6 6 6 4 4

* - N26– pool of random sequences; S1 - ACCTCGCGCG; S2 - CCTGGATCCTTCTTCCCACT; S3 - TCAGGCAGTACCACAAGGCC; S4 - CAACACAACCAACACAACCAACACAA; S5 - GAGGTAGAATTCGAAAGTGGGAAGAAGGAT; S6 – CCTGGATCCTTCTTCCCACTCGCGCGAGGTAGAATTCGAA.

Binding affinity

In the Table 1 we see quite a large set of 26-mers, all having the same saturating concentration value – of 6 µM. The only exception is C26 oligonucleotide with 8 µM. We also observe high saturating values for short oligonucleotides (6-16 nt) and lower Csat for 40-mers. Is there a correlation between Csat and real binding affinities of oligonucleotides to AuNPs? To address this question, we determined the equilibrium dissociation constants for a series of oligonucleotides (Table 2) at a very low concentration of the oligonucleotide and rising concentration of AuNPs, so that only one oligonucleotide molecule could interact with one AuNP. This procedure is analogous to a study of nucleic acid – protein interaction.42 Low ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 27

concentration of nucleic acid is titrated with increasing concentration of protein to determine thermodynamic dissociation constant of the complex. This method makes it possible to prevent the interaction between DNAs on AuNPs surface. We suppose that KD values obtained in this way provide the most correct comparison of binding affinities of different DNAs to AuNPs. For typical fitting see Supporting Information.

Table 2. Equilibrium dissociation constant (KD) of DNA/AuNP Sequence T6 T26 A26 C26 N26 T40

KD, nM 0.10±0.04 1.8±0.3 6±1 18±3 2±1 0.17±0.03

KD values determined are in a good correlation with saturating concentration values except T6, where we observe very low KD, but not the saturating concentration (Figure 2B, C, Table 1). Hence, the saturating concentration of DNA can be used for raw but fast comparison of affinities to AuNPs for oligonucleotides of similar length. Shorter oligonucleotides obviously add less negative charge to AuNP at adsorption. To achieve the upper limit of electrophoretic mobility gold nanoparticle has to adsorb higher amount of short oligonucleotides, which can be achieved at higher oligonucleotide concentrations (Figure 2C). The lowest KD values (highest affinity) are observed for T6 and T40, affinity of T26 is lower (higher KD) (Table 2). The decrease of KD for longer oligonucleotide can be a consequence of lower dissociation rate28, which is explained by larger number of contacts with the particle surface. In this context, low KD value obtained for T6 looks controversial. But it can be explained taking into account hydrodynamic diameter and ζ-potential data determined by DLS. Hydrodynamic diameter of DNA/AuNPs increases with the length of DNA chain (Figure 3A) from 6 nt to 300-500 nt (polythymidylates).


Page 11 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 3. (A) Hydrodynamic diameter and ζ-potential of DNA/AuNPs. (B) Concentration profile of polyT adsorption on AuNPs, analyzed by electrophoresis. *PolyT concentration per nucleotide.

As the difference in hydrodynamic diameter between T6- and T26-coated AuNPs is 8 nm we suggest that these oligonucleotides interact with AuNPs differently. Probably, some part of T26 strand does not directly contact with the surface, forming an overhang or a loop (series of loops) near AuNP surface. Very small difference in hydrodynamic diameter between T26- and T40coated AuNPs (only 2 nm) indicates that their overhangs/loops are close in size. Hence, T40 should keep larger part of the strand in a direct contact with the surface, and should have larger affinity to AuNPs, which is supported by lower KD value (Table 2). Very long overhangs or large loops can be formed by polythymidylate, giving a hydrodynamic diameter of 48 nm. The existence of long overhangs in polyT/AuNPs can be further confirmed by electrophoresis data shown in Figure 3B. PolyT/AuNP bands are significantly retarded in comparison with all other DNA/AuNP bands due to high length (300-500 nt) and are very diffuse probably because of heterogeneity of polyT specimen. We do not observe changes in mobility of other DNA/AuNPs depending on the chain length. This could be explained by large pore size, which is characteristic for 0.8% agarose gel. The difference in mobility between AuNPs loaded with short DNA strands is observed generally in 1.5-3% gels.31, 45-46 AuNPs with adsorbed T6 have close ζ-potential values with intact citrate-coated AuNPs (Figure 3A), suggesting that similar quantity of negative charges is displaced by binding oligonucleotide. Longer DNA chains significantly increase the negative ζ-potential of AuNPs. Again, ζ-potentials of T26- and T40-coated AuNPs are close, showing that similar amounts of citrate are displaced. Additional negative charges are connected probably with the portion of oligonucleotide molecule which forms an overhang or a loop and does not interact with the surface. This negatively charged overhang can adversely affect the overall affinity of the oligonucleotide owing to repulsion from closely arranged citrates or DNAs. Thus, short oligonucleotides unable to form overhangs can be more affine than longer ones if the number of direct contacts with the surface is not significantly different. Langmuir adsorption isotherm is used to estimate the binding affinity of DNA to AuNPs.28-29, 47 This isotherm can be applied when no interaction between adsorbent molecules on the surface occurs or this interaction is negligible. We observed adsorption isotherms for T26 and T40 using the data presented in Figure 4A, and corresponding Langmuir constants were determined to be K=0.042±0.003 nM-1 for T26 and K=0.28±0.03 nM-1 for T40. These data correlate with published


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

reports28 and obtained KD values (Table 2); for more affine DNA we observe higher K and lower KD.

Modes of binding

An interesting observation was made when we determined the capacity of AuNPs in the “electrophoretic” concentration range (all concentrations including AuNPs concentration were 200 times higher as compared to conditions on Figure 4A). The graph on Figure 4B shows a significant increase in capacity of AuNPs for all oligonucleotides. The increment in capacity exceeds 100% for T26 and T40 and 20% for T6. We suppose that such a drastic change in conditions can influence the mode of adsorption. In the low concentration range, oligonucleotides probably interact with DNA by longer portions. The shift to high concentrations can reduce this portion to some minimum which can be even less than six nucleotides. Analogously, only 3 nucleotides were suggested to be involved into binding of oligoadenylates at high concentrations29 and 60-80 nucleotides long polyA tail has been shown to wreathe the Au particle at low concentrations31. This definitely affects the affinity of oligonucleotides to AuNPs. The Langmuir constants obtained under these conditions are 0.46 and 0.60 µM-1 for T26 and T40 respectively. A significant difference between the Langmuir constant values obtained at different concentrations of AuNPs probably indicates that in this concentration range Langmuir model is not applicable because of prominent interaction between oligonucleotides on the surface. Other models would possibly suit better, although larger data sets are required. The adsorption curve for T6 (Figure 4C) cannot be fitted to the Langmuir isotherm equation, probably because of a large difference in binding properties of phosphate-labeled and unlabeled hexanucleotides. Unlabeled hexanucleotide contains only five internucleotide negative charges, so the addition of two extra charges (on terminal phosphate) should significantly decrease its binding strength owing to the electrostatic repulsion. Therefore, at the fixed concentration of phosphate-labeled hexanucleotide, the increasing concentration of unlabeled oligonucleotide can inhibit the adsorption of the labeled oligonucleotide to a great extent. This could probably be the reason for significant binding decrease at higher concentrations of unlabeled T6. Nevertheless, the graph observed at high concentrations of AuNPs and T6 shows a large amount of T6 (up to 200) bound prior to inhibition (Figure 4C).


Page 12 of 27

Page 13 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 4. Adsorption of DNA on AuNPs. (A) The number of adsorbed DNA molecules per AuNP at 0.5 nM concentration of the AuNPs. (B) The number of adsorbed DNA molecules per AuNP at 0.1 µM concentration of the AuNPs. (C) Competitive inhibition of binding of phosphate labeled T6 to AuNPs by non-labeled T6 at 0.1 µM concentration of the AuNPs. (D) Fraction of adsorbed oligonucleotide at titration with AuNPs at 0.05 nM concentration of the oligonucleotide. We compared affinities of 26-mer oligonucleotides A26, C26, T26; G26 was not taken into the study because of anticipated competing structures. The obtained data suggest that there is no significant difference in affinity between 26-mers except homocytidylate, which seems to be less affine to AuNPs (Figure 4D). Low difference in affinity is observed between A26 and T26 under these conditions (Table 2). Significantly higher KD value for C26 corresponds to the lowest affinity to AuNPs. Interestingly, KD value for N26, a randomized mixture of sequences obtained by an automated synthesis, is very close to lowest KD for 26-mers, suggesting that some hetero sequences can be even more affine than our "leader" - T26.

DNA displacement from DNA/AuNPs

DNA/AuNPs are more stable than citrate-coated AuNPs in solutions with elevated ionic strength.21, 48 Citrate-coated AuNPs coagulate immediately upon addition of 0.05 M NaCl.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Oligothymidylate-coated AuNPs preserve their original color even in 0.1 NaCl, which points on the absence of coagulation (Figure 5A). Higher concentrations of NaCl lead to fast coagulation, although T6/AuNPs preserve their short-term stability in 0.2 M NaCl solution, which is probably the result of higher affinity and capacity of AuNPs in this case. Various thiol-containing ligands are known to prevent non-covalent binding of other molecules on AuNPs surface.49-50 In our experiments most of bound DNA is displaced from the particles by 25 µM thioglycolic acid (TGA) (Figure 5B).

Figure 5. (A) Salt-induced coagulation of DNA/AuNPs after 5 min iincubation. (B) Displacement of oligothymidylates from AuNPs by 25 µM TGA. (C) Agarose gel electrophoresis of T40/AuNPs after 1.5 h incubation at 25 oCwith BSA, HSA, TCPEG3.2s or TCPEG4.9.

A correlation is observed between the percent of DNA displacement by TGA and the KD values of DNA/AuNPs. T6 having the lowest KD value is not displaced completely under these conditions, T26 having the highest KD value is completely displaced after 1 hour of incubation, and T40 with intermediate value is displaced slower than T26. Similarly, other low-molecular thiol mercaptoundecanoic acid (MUA) which is also a shell forming agent for AuNPs51 displaces oligonucleotides from AuNPs very efficiently. Oligonucleotide T26 was completely displaced after 30 min incubation with 10-4 М MUA at 56 oC. α-Thio-ω-carboxy polyethylene glycols (TCPEGs) partially displace DNA from AuNPs. A short incubation (1.5 hour) of DNA/AuNPs with TCPEG 3.2 kDa or TCPEG 4.9 kDa changes the electrophoretic mobility of particles, which clearly shows that the interaction takes place (Figure 5C). Hydrodynamic diameter of TCPEG-coated particles is 62±6 nm52; it is high enough to lower the mobility of particles even in 0.8% agarose gel. Low concentrations of TCPEGs displace T26 moderately; 10±2% of loaded oligo is displaced by 10-6-10-4 M TCPEGs. Significant displacement (40%) was achieved after 16 h incubation with 10-3 M TCPEGs. The fact that TCPEGs affect the mobility of DNA/AuNPs even if oligonucleotides are not significantly displaced suggests the mushroom-type53 binding of TCPEGs, i.e., TCPEG moieties form a secondary shell outside the oligonucleotide layer54. Partial displacement of nonACS Paragon Plus Environment

Page 14 of 27

Page 15 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

covalently bound oligonucleotides by covalently binding thiols can be explained by nonuniformity of AuNPs surface, which consists of faces (111) and (100) in proportion 66 to 34.55 Various substances differently react with different faces.56 Co-adsorption with other substances is demonstrated for thiols on (111) faces.57 We were also interested in imitating the conditions in living cell or serum to estimate the possibility of intracellular or intravascular release of DNA adsorbed on AuNPs. For this modeling we have chosen the most abundant low-molecular and high-molecular thiol-containing reductants – glutathione and serum albumins.58 Reduced glutathione (10-3 M) displaces only 18% of loaded T26 after 30 min incubation, and 25% after 16 h. Human serum albumin (HSA) also partially displaces oligonucleotides from DNA/AuNPs. Binding of fluorescently labeled HSA to AuNPs and DNA/AuNPs has been studied. The estimation of limit binding values revealed that more HSA (22.7 molecules per one AuNP) is bound in the absence of oligonucleotides, 10.5 HSA molecules are bound to T26/AuNPs, and only 3.0 molecules per one particle are bound to T6/AuNPs. No difference is observed between 1 h and 16 h points. These results support the thesis that T6 covers AuNPs surface more tightly than T26. The process of HSA binding to the particles is accompanied by displacement of a part of adsorbed oligonucleotides. Less oligonucleotide (10% of loaded) is displaced in the case of T6, some more (20%) is displaced in the case of T26. In the latter experiment no difference is observed between HSA and bovine serum albumin (BSA), which displaces the same percent of bound oligonucleotides. T40 is displaced by BSA more efficiently than other oligonucleotides (up to 40%) probably because of higher steric hindrance between oligonucleotide overhangs and protein molecules. The displacement of T6 and T26 by BSA has been also studied over the long-time range. Only 11.7 % of bound T6 and 20 % of T26 is displaced after incubation for 11 days. Conclusion Here we suggest a fast and convenient method for coating AuNPs with DNA. The method consists in short and moderate heating AuNPs with DNA (30 min, 56 oC) without any change in AuNPs environment, i.e. exactly in conditions, which are established right after the AuNPs synthesis. This method provides very good stability of resulting DNA/AuNPs, and controllable loading capacities for oligonucleotides varying in length and composition. We estimated the affinity of oligonucleotides to AuNPs. Surprisingly, under these conditions oligothymidylates and oligoadenylates demonstrate similar affinities, while oligocytidylates are significantly less affine. We also suppose that DNA concentration affects the mode of binding: higher DNA concentration increase AuNPs capacity but lower the affinity. Resulting DNA/AuNPs were studied in reactions with a series of low-molecular and high-molecular thiols in a wide range of conditions. These experiments show that the process of DNA loading and displacement can be ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

controlled by reaction conditions. Furthermore, under simulated intracellular and intravascular conditions at least a part of DNA can be displaced and hence can be considered as a useful load. It also can be encapsulated by high-molecular thiols due to formation of composite shells on the surface of DNA/AuNPs. Both capabilities can be successfully employed in a number of bionanotechnological applications.

Author information

Corresponding Author *E-mail: [email protected] Author Contributions ∥

Anna Epanchintseva and Pavel Vorobjev contributed equally.

Notes The authors declare that they have no competing financial interests.

Acknowledgment The work was supported by Russian State funded budget project (VI.62.1.4, 0309-2016-0004). The work described in the section “DNA displacement from DNA/AuNPs” was supported by Russian Science Foundation (grant No.16-1510156).

Supporting Information Optical absorption spectra of T26/AuNPs in sodium citrate and Tris-glycine solutions. Comparison of agarose gel electrophoresis data of T26/AuNPs obtained on a flatbed scanner and on Pharos FX Imager with addition of 5’-end-[32P]-labeled DNA. Typical data of quantitative analysis of oligonucleotide binding with AuNPs (Langmuir isotherm and binding curve). This information is available free of charge via the Internet at http://pubs.acs.org/

Cited literature (1) Kumar, D.; Saini, N.; Jain, N.; Sareen, R.; Pandit, V., Gold nanoparticles: an era in bionanotechnology. Expert Opinion on Drug Delivery 2013, 10 (3), 397-409. (2) Chen, Y.; Xianyu, Y.; Jiang, X., Surface Modification of Gold Nanoparticles with Small Molecules for Biochemical Analysis. Accounts of Chemical Research 2017, 50 (2), 310-319. (3) Samanta, A.; Medintz, I. L., Nanoparticles and DNA - a powerful and growing functional combination in bionanotechnology. Nanoscale 2016, 8 (17), 9037-9095. (4) Haume, K.; Rosa, S.; Grellet, S.; Śmiałek, M. A.; Butterworth, K. T.; Solov’yov, A. V.; Prise, K. M.; Golding, J.; Mason, N. J., Gold nanoparticles for cancer radiotherapy: a review. Cancer Nanotechnology 2016, 7 (1), 8. ACS Paragon Plus Environment

Page 16 of 27

Page 17 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(5) Tatar, A.-S.; Nagy-Simon, T.; Tomuleasa, C.; Boca, S.; Astilean, S., Nanomedicine approaches in acute lymphoblastic leukemia. Journal of Controlled Release 2016, 238, 123-138. (6) Capek, I., Polymer decorated gold nanoparticles in nanomedicine conjugates. Adv Colloid Interface Sci 2017. (7) Daniel, M.-C.; Astruc, D., Gold Nanoparticles: Assembly, Supramolecular Chemistry, Quantum-Size-Related Properties, and Applications toward Biology, Catalysis, and Nanotechnology. Chemical Reviews 2004, 104 (1), 293-346. (8) Sun, Y.; Gray, S. K.; Peng, S., Surface chemistry: a non-negligible parameter in determining optical properties of small colloidal metal nanoparticles. Physical Chemistry Chemical Physics 2011, 13 (25), 11814-11826. (9) Tyagi, H.; Kushwaha, A.; Kumar, A.; Aslam, M., A Facile pH Controlled Citrate-Based Reduction Method for Gold Nanoparticle Synthesis at Room Temperature. Nanoscale Research Letters 2016, 11, 362. (10) Wilcoxon, J., Optical Absorption Properties of Dispersed Gold and Silver Alloy Nanoparticles. The Journal of Physical Chemistry B 2009, 113 (9), 2647-2656. (11) Rai, M.; Ingle, A. P.; Gupta, I.; Brandelli, A., Bioactivity of noble metal nanoparticles decorated with biopolymers and their application in drug delivery. International Journal of Pharmaceutics 2015, 496 (2), 159-172. (12) Fratila, R. M.; Mitchell, S. G.; del Pino, P.; Grazu, V.; de la Fuente, J. M., Strategies for the Biofunctionalization of Gold and Iron Oxide Nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2014, 30 (50), 15057-15071. (13) Shen, C.; Lan, X.; Zhu, C.; Zhang, W.; Wang, L.; Wang, Q., Spiral Patterning of Au Nanoparticles on Au Nanorod Surface to Form Chiral AuNR@AuNP Helical Superstructures Templated by DNA Origami. Advanced Materials 2017, 1606533-n/a. (14) Verma, M. S.; Rogowski, J. L.; Jones, L.; Gu, F. X., Colorimetric biosensing of pathogens using gold nanoparticles. Biotechnology Advances 2015, 33 (6, Part 1), 666-680. (15) Mendes, R.; Fernandes, R. A.; Baptista, V. P., Gold Nanoparticle Approach to the Selective Delivery of Gene Silencing in Cancer—The Case for Combined Delivery? Genes 2017, 8 (3). (16) Khlebtsov, N.; Bogatyrev, V.; Dykman, L.; Khlebtsov, B.; Staroverov, S.; Shirokov, A.; Matora, L.; Khanadeev, V.; Pylaev, T.; Tsyganova, N.; Terentyuk, G., Analytical and theranostic applications of gold nanoparticles and multifunctional nanocomposites. Theranostics 2013, 3 (3), 167-80. (17) Fu, L.; Ke, H.-T., Nanomaterials incorporated ultrasound contrast agents for cancer theranostics. Cancer Biology & Medicine 2016, 13 (3), 313-324. (18) Seok Kim, Y.; Ahmad Raston, N. H.; Bock Gu, M., Aptamer-based nanobiosensors. Biosensors and Bioelectronics 2016, 76, 2-19. (19) Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J., A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature 1996, 382 (6592), 607609. (20) Alivisatos, A. P.; Johnsson, K. P.; Peng, X. G.; Wilson, T. E.; Loweth, C. J.; Bruchez, M. P.; Schultz, P. G., Organization of 'nanocrystal molecules' using DNA. Nature 1996, 382 (6592), 609-611. (21) Pei, H.; Li, F.; Wan, Y.; Wei, M.; Liu, H.; Su, Y.; Chen, N.; Huang, Q.; Fan, C., Designed diblock oligonucleotide for the synthesis of spatially isolated and highly hybridizable functionalization of DNA-gold nanoparticle nanoconjugates. Journal of the American Chemical Society 2012, 134 (29), 11876-9. (22) Zhang, X.; Servos, M. R.; Liu, J., Instantaneous and quantitative functionalization of gold nanoparticles with thiolated DNA using a pH-assisted and surfactant-free route. Journal of the American Chemical Society 2012, 134 (17), 7266-9.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(23) Kimura-Suda, H.; Petrovykh, D. Y.; Tarlov, M. J.; Whitman, L. J., Base-dependent competitive adsorption of single-stranded DNA on gold. Journal of the American Chemical Society 2003, 125 (30), 9014-5. (24) Sandstrom, P.; Boncheva, M.; Akerman, B., Nonspecific and thiol-specific binding of DNA to gold nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2003, 19 (18), 7537-7543. (25) Brown, K. A.; Park, S.; Hamad-Schifferli, K., Nucleotide-surface interactions in DNAmodified Au-nanoparticle conjugates: Sequence effects on reactivity and hybridization. J Phys Chem C 2008, 112 (20), 7517-7521. (26) Carnerero, J. M.; Jimenez-Ruiz, A.; Castillo, P. M.; Prado-Gotor, R., Covalent and NonCovalent DNA–Gold-Nanoparticle Interactions: New Avenues of Research. ChemPhysChem 2017, 18 (1), 17-33. (27) Liu, B.; Liu, J., Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Analytical Methods 2017, 9 (18), 2633-2643. (28) Zhang, X.; Servos, M. R.; Liu, J., Surface science of DNA adsorption onto citrate-capped gold nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2012, 28 (8), 3896-902. (29) Zhang, X.; Liu, B.; Dave, N.; Servos, M. R.; Liu, J., Instantaneous attachment of an ultrahigh density of nonthiolated DNA to gold nanoparticles and its applications. Langmuir : the ACS journal of surfaces and colloids 2012, 28 (49), 17053-60. (30) Zhang, X.; Liu, B.; Servos, M. R.; Liu, J., Polarity control for nonthiolated DNA adsorption onto gold nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2013, 29 (20), 6091-8. (31) Yao, G. B.; Pei, H.; Li, J.; Zhao, Y.; Zhu, D.; Zhang, Y. N.; Lin, Y. F.; Huang, Q.; Fan, C. H., Clicking DNA to gold nanoparticles: poly-adenine-mediated formation of monovalent DNA-gold nanoparticle conjugates with nearly quantitative yield. Npg Asia Mater 2015, 7. (32) Young, J. K.; Figueroa, E. R.; Drezek, R. A., Tunable Nanostructures as Photothermal Theranostic Agents. Ann Biomed Eng 2012, 40 (2), 438-459. (33) Demers, L. M.; Ostblom, M.; Zhang, H.; Jang, N. H.; Liedberg, B.; Mirkin, C. A., Thermal desorption behavior and binding properties of DNA bases and nucleosides on gold. Journal of the American Chemical Society 2002, 124 (38), 11248-11249. (34) Storhoff, J. J.; Elghanian, R.; Mirkin, C. A.; Letsinger, R. L., Sequence-dependent stability of DNA-modified gold nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2002, 18 (17), 6666-6670. (35) Liu, B.; Kelly, E. Y.; Liu, J., Cation-size-dependent DNA adsorption kinetics and packing density on gold nanoparticles: an opposite trend. Langmuir : the ACS journal of surfaces and colloids 2014, 30 (44), 13228-34. (36) Nelson, E. M.; Rothberg, L. J., Kinetics and Mechanism of Single-Stranded DNA Adsorption onto Citrate-Stabilized Gold Nanoparticles in Colloidal Solution. Langmuir : the ACS journal of surfaces and colloids 2011, 27 (5), 1770-1777. (37) Lu, W.; Wang, L.; Li, J.; Zhao, Y.; Zhou, Z.; Shi, J.; Zuo, X.; Pan, D., Quantitative investigation of the poly-adenine DNA dissociation from the surface of gold nanoparticles. 2015, 5, 10158. (38) Chubarov, A. S.; Zakharova, O. D.; Koval, O. A.; Romaschenko, A. V.; Akulov, A. E.; Zavjalov, E. L.; Razumov, I. A.; Koptyug, I. V.; Knorre, D. G.; Godovikova, T. S., Design of protein homocystamides with enhanced tumor uptake properties for 19F magnetic resonance imaging. Bioorganic & Medicinal Chemistry 2015, 23 (21), 6943-6954. (39) Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L., One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes. Journal of the American Chemical Society 1998, 120 (9), 1959-1964. (40) Pyshnaya, I. A.; Razum, K. V.; Poletaeva, J. E.; Pyshnyi, D. V.; Zenkova, M. A.; Ryabchikova, E. I., Comparison of behaviour in different liquids and in cells of gold nanorods


Page 18 of 27

Page 19 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

and spherical nanoparticles modified by linear polyethyleneimine and bovine serum albumin. BioMed research international 2014, 2014, 908175. (41) Liu, X.; Atwater, M.; Wang, J.; Huo, Q., Extinction coefficient of gold nanoparticles with different sizes and different capping ligands. Colloids and Surfaces B: Biointerfaces 2007, 58 (1), 3-7. (42) Ryder, S. P.; Recht, M. I.; Williamson, J. R., Quantitative Analysis of Protein-RNA Interactions by Gel Mobility Shift. In RNA-Protein Interaction Protocols, Lin, R.-J., Ed. Humana Press: Totowa, NJ, 2008; pp 99-115. (43) Amaya-González, S.; López-López, L.; Miranda-Castro, R.; de-los-Santos-Álvarez, N.; Miranda-Ordieres, A. J.; Lobo-Castañón, M. J., Affinity of aptamers binding 33-mer gliadin peptide and gluten proteins: Influence of immobilization and labeling tags. Analytica Chimica Acta 2015, 873, 63-70. (44) Schellman, J. A., Temperature, stability, and the hydrophobic interaction. Biophysical Journal 1997, 73 (6), 2960-2964. (45) Zanchet, D.; Micheel, C. M.; Parak, W. J.; Gerion, D.; Alivisatos, A. P., Electrophoretic Isolation of Discrete Au Nanocrystal/DNA Conjugates. Nano Lett 2001, 1 (1), 32-35. (46) Eidelshtein, G.; Fattal, M.; Avishai, G.; Kempinski, B.; Giannini, C.; Kotlyar, A., Preparation, Characterization and Manipulation of Conjugates between Gold Nanoparticles and DNA. Nanomaterials 2016, 6 (9). (47) Liu, J., Adsorption of DNA onto gold nanoparticles and graphene oxide: surface science and applications. Physical Chemistry Chemical Physics 2012, 14 (30), 10485-10496. (48) Lin, M. Y.; Lindsay, H. M.; Weitz, D. A.; Ball, R. C.; Klein, R.; Meakin, P., Universality in colloid aggregation. Nature 1989, 339 (6223), 360-362. (49) Lang, N. J.; Liu, B.; Zhang, X.; Liu, J., Dissecting Colloidal Stabilization Factors in Crowded Polymer Solutions by Forming Self-Assembled Monolayers on Gold Nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2013, 29 (20), 6018-6024. (50) Chen, N.; Wei, M.; Sun, Y.; Li, F.; Pei, H.; Li, X.; Su, S.; He, Y.; Wang, L.; Shi, J.; Fan, C.; Huang, Q., Self-assembly of poly-adenine-tailed CpG oligonucleotide-gold nanoparticle nanoconjugates with immunostimulatory activity. Small 2014, 10 (2), 368-75. (51) Laaksonen, T.; Ahonen, P.; Johans, C.; Kontturi, K., Stability and Electrostatics of Mercaptoundecanoic Acid-Capped Gold Nanoparticles with Varying Counterion Size. ChemPhysChem 2006, 7 (10), 2143-2149. (52) Pyshnaya, I. A.; Razum, K. V.; Dolodoev, A. S.; Shashkova, V. V.; Ryabchikova, E. I., Surprises of electron microscopic imaging of proteins and polymers covering gold nanoparticles layer by layer. Colloids and Surfaces B: Biointerfaces 2017, 150 (Supplement C), 23-31. (53) Siriwardana, K.; Gadogbe, M.; Ansar, S. M.; Vasquez, E. S.; Collier, W. E.; Zou, S. L.; Walters, K. B.; Zhang, D. M., Ligand Adsorption and Exchange on Pegylated Gold Nanoparticles. J Phys Chem C 2014, 118 (20), 11111-11119. (54) Shashkova, V. V.; Epanchintseva, A. V.; Vorobjev, P. E.; Razum, K. V.; Ryabchikova, E. I.; Pyshnyi, D. V.; Pyshnaya, I. A., Multilayer associates based on oligonucleotides and gold nanoparticles. Russian Journal of Bioorganic Chemistry 2017, 43 (1), 64-70. (55) Barnard, A. S., Direct Comparison of Kinetic and Thermodynamic Influences on Gold Nanomorphology. Accounts of Chemical Research 2012, 45 (10), 1688-1697. (56) Azcárate, J. C.; Floridia Addato, M. A.; Rubert, A.; Corthey, G.; Kürten Moreno, G. S.; Benítez, G.; Zelaya, E.; Salvarezza, R. C.; Fonticelli, M. H., Surface Chemistry of Thiomalic Acid Adsorption on Planar Gold and Gold Nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2014, 30 (7), 1820-1826. (57) Park, J.-W.; Shumaker-Parry, J. S., Strong Resistance of Citrate Anions on Metal Nanoparticles to Desorption under Thiol Functionalization. ACS nano 2015, 9 (2), 1665-1682. (58) Turell, L.; Radi, R.; Alvarez, B., The thiol pool in human plasma: The central contribution of albumin to redox processes. Free Radical Biology and Medicine 2013, 65, 244253. ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 20 of 27

Page 21 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Graphical abstract For Table of Contents Use Only


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. (A) Agarose gel electrophoresis of DNA/AuNPs. Adsorption of T26 on AuNPs (0.1 µM) depending on the concentration of T26 and reaction temperature for 30 min. Lane "0" - citrate-coated AuNPs. (B) Adsorption of T26 (30 nM) on AuNPs (0.5 nM) depending on the incubation time at 56 oC. (C) Kinetics of 5’[32P]-T26 displacement by 100-fold excess of non-labeled T26 at 25 oC. 121x109mm (300 x 300 DPI)


Page 22 of 27

Page 23 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure. 2. The concentration profiles of T26 (A) and T6 (B, C) adsorption on AuNPs (0.1 µM), analyzed by electrophoresis. Agarose gel electrophoresis (upper panes) and integral optical density (IOD) histograms (lower panes). 192x68mm (300 x 300 DPI)


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. (A) Hydrodynamic diameter and ζ-potential of DNA/AuNPs. (B) Concentration profile of polyT adsorption on AuNPs, analyzed by electrophoresis. *PolyT concentration per nucleotide. 124x45mm (300 x 300 DPI)


Page 24 of 27

Page 25 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 4. Adsorption of DNA on AuNPs. (A) The number of adsorbed DNA molecules per AuNP at 0.5 nM concentration of the AuNPs. (B) The number of adsorbed DNA molecules per AuNP at 0.1 µM concentration of the AuNPs. (C) Competitive inhibition of binding of phosphate labeled T6 to AuNPs by non-labeled T6 at 0.1 µM concentration of the AuNPs. (D) Fraction of adsorbed oligonucleotide at titration with AuNPs at 0.05 nM concentration of the oligonucleotide. 133x106mm (300 x 300 DPI)


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. (A) Salt-induced coagulation of DNA/AuNPs after 5 min iincubation. (B) Displacement of oligothymidylates from AuNPs by 25 µM TGA. (C) Agarose gel electrophoresis of T40/AuNPs after 1.5 h incubation at 25 oCwith BSA, HSA, TCPEG3.2s or TCPEG4.9. 178x46mm (300 x 300 DPI)


Page 26 of 27

Page 27 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Graphical abstract 131x63mm (300 x 300 DPI)


Fast and Strong Adsorption of Native ... - ACS Publications

Recommend Documents