High Signal-to-Background Ratio Detection of Cancer Cells with

Subscriber access provided by Queen Mary, University of London

Article

High Signal-to-background Ratio Detection of Cancer Cells with Activatable Strategy Based on Target-induced Self-assembly of Split Aptamers Baoyin Yuan, Yuqiong Sun, Qiuping Guo, Jin Huang, Xiaohai Yang, Yuanyuan Chen, Xiaohong Wen, Xiangxian Meng, Jianbo Liu, and Kemin Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b02153 • Publication Date (Web): 07 Aug 2017 Downloaded from http://pubs.acs.org on August 8, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Baoyin Yuan, Yuqiong Sun, Qiuping Guo,* Jin Huang, Xiaohai Yang, Yuanyuan Chen, Xiaohong Wen, Xiangxian Meng, Jianbo Liu and Kemin Wang* State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Biology, College of Chemistry and Chemical Engineering, Hunan University, Key Laboratory for Bio-Nanotechnology and Molecular Engineering of Hunan Province, Changsha 410082, China ABSTRACT: Highly sensitive detection of cancer cells with high signal-to-background ratio (SBR) is still urgently needed. Here, a self-assembling activatable probe (SAAP) based on split aptamers was developed for meeting this purpose. The SAAP formed with quenched fluorescence, only target cells presented would the split aptamers self-assemble together and thus activated fluorescence by intramolecular and intermolecular fluorescence quenching strategies. As proof of concept, a split aptamer pair stemmed from an intact aptamer ZY11 developed by our lab was selected to construct SAAP. Owing to the design of selfassembling and activatable strategy, the SBR of our approach could be raised to ~40 times that achieved a very low detection limit of 7 target 7721 cells in 100 μL binding buffer. Meanwhile, one-step detection of target cells was achieved within 15 min without any washing steps and pretreatment, which was potential for point-of-care detection. Moreover, we succeeded in the specific recognition of target cells in 50% human serum and mixed cell samples, which indicated this strategy had great advantages in the detection of complex biological samples. In addition, dual-signal detection was also successfully implemented, which may be helpful to accurate detection of target cells. Therefore, this rapid, facile, specific and high-sensitive detection method for cancer cells may provide convenience in cancer research and medical diagnosis.

Cancer cells, which can produce abnormal molecules on their surface, need to be detected in early stage to evaluate cancer development and increase survival rate.1,2 Since the early cancer cells are so rare that accurate detection is difficult, the sensitivity and specificity of cancer cell detection must be greatly improved.3,4 The most common methods are mainly focused on recognition probes with high sensitivity and specificity. Although antibodies are usually used as recognition probes, aptamers, which developed by SELEX (systematic evolution of ligands by exponential enrichment), offer unique advantages over antibodies in cancer cell detection, such as nontoxicity, long-term stability, easy synthesis, controllable modification and flexible designing for different detection strategies.5-10 In the past few years, aptamer-based methods for cancer cell detection have been explored. However, the sensitivity and specificity of these methods is still unsatisfactory because of weak recognition and high background signal caused by complexity of cancer cells. Therefore, it is undoubtedly necessary to develop aptamer probes with high sensitivity and specificity for cancer cell detection. Split aptamers, which split from parent aptamer and remain considerable binding affinity, hold great potential in improving detection sensitivity and specificity.11-13 Because split aptamers lack secondary conformations, nonspecific signals derived from complex environment can be avoided effectively. Only when targets present will the split aptamers self-assemble together and yield positive signals. The split aptamer-based strategies have been extensively applied to detect small molecules and biomacromolecules, using various signal models including fluorescence, colorimetric and electrochemical methods.14-18 Our group has developed a split aptasensor for cancer cell detection based on fluorescence resonance energy transfer (FRET).19 Although good detection sensitivity and specificity was achieved, signal-to-background

ratio (SBR) was unobtrusive (~12 times) because of quenchless background fluorescence and low efficiency of FRET. To our knowledge, the target recognition-induced selfassembly of split aptamers for cancer cell detection is rarely reported. Activatable aptamer probes (AAP), which displayed negligible fluorescence in quenched state while activated fluorescence after undergoing a conformational alteration upon binding, have particular advantage of reducing background signal contrast to ‘always on’ probes with which accompanying constant fluorescence and thus high background.20 In addition, the utilization of AAP for cancer cell detection can avoid tedious washing steps and is good for point-of-care test. Most importantly, this one-step assay absolutely eliminated loss of target cancer cells in detection process, which greatly elevated detection sensitivity.21 Recently, some AAP-based works for cancer cell detection have been developed.22-25 For example, a hairpin AAP was designed by our lab for in vivo contrast-enhanced imaging based on target cancer cell recognition-induced fluorescence restoration.22 This method exhibited good sensitivity for cancer cell detection with SBR of ~8 times. Zhao et al. reported an AAP strategy for simultaneous targeting multiple proteins in cancer cells, which showed improved sensitivity for cancer cell analysis with SBR of ~16 times.23 In another cause, Lei et al. developed a split aptamer-based activatable theranostic probe for cancer cell detection and therapy. 25 This probe further improved the detection sensitivity with SBR of ~20 times. In this study, by combining target recognitioninduced self-assembly of split aptamers with activatable fluorescence strategy, we developed a self-assembling and activatable aptamer probes (SAAP) for highly sensitive detection of cancer cells with SBR of ~40 times, which was highest among AAP-based cancer cell detections, to our knowledge.

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

a Strategy 1

b

Fluorescent dye

Target cell

Quencher

SAAP 1 400

Split aptamer fragment 1

400

300

Target cell

300

200

200

100

100

0

Quenched fragment 1

0 101 102 103 104 105 106

101 102 103 104 105 106

Quenched fragment 2 Strategy 2

Split aptamer fragment 2

Target cell

a

b SAAP 2

Target cell membrane

Scheme 1. Schematic representation of two different selfassembling and activatable strategies for cancer cell detection. To construct SAAP, an intramolecular (strategy 1) and an intermolecular (strategy 2) fluorescence quenching SAAP were respectively designed for comparison in cancer cell detection (Scheme 1). For strategy 1, split aptamer fragment 1 (SAF 1) and split aptamer fragment 2 (SAF 2) were respectively designed to match at ends as SAAP 1 whose fluorescence was quenched. When target cells presented, SAAP 1 re-assembled on target cells and fluorescence was activated after separation between fluorescent dye and quencher. As for strategy 2, SAF 1 and SAF 2 were respectively labeled with fluorescent dyes and then partially matched their complementary quenched fragments (QF) as non-fluorescent SAAP 2. When target cells presented, SAAP 2 self-assembled on target cells and the QFs dissociated, resulting in significant fluorescence recovery. This SAAP strategy may greatly improve detection speed, sensitivity and specificity because of one-step operation, low background and high target signal of self-assembling and activatable strategies.

Chemicals and Materials. All oligonucleotides were synthesized and purified by Sangon Biotechnology Company, Ltd. (Shanghai, China). Sequences of the oligonucleotides were listed in Table 1 and Table S1. The experimental containers were sterilized by vertical high-pressure steam sterilizer before using. Water was treated by the Milli-Q ultrapure water system (18.2 MΩ▪cm, Millipore System Inc.). Dulbecco’s phosphate buffered saline (D-PBS) was purchased from Sigma-Aldrich. The binding buffer contained 5 mM MgCl2, 4.5 g/L glucose, 1mg/mL BSA and 0.1 mg/mL yeast tRNA in D-PBS. Other chemicals were of analytical grade and used without further purification. Cells. Hepatocellular carcinoma SMMC-7721 (7721) and Bel-7404 (7404) cells, cholangiocarcinoma QBC-939 cells, acute lymphoblastic leukemia CCRF-CEM (CEM) cells and hepatocyte L02 cells used in the experiment were purchased from Cell Bank of the Committee on Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Burkitt’s lymphoma Ramos cells were purchased from the Cancer Institute and Hospital of Chinese Academy of Medical Sciences (Beijing, China). Cervical carcinoma HeLa cells were purchased from American Type Culture Collection and breast carcinoma MCF-7 cells were offered by our laboratory. All the cells were human-derived. The Cells were cultured in RPMI 1640 with 10% fetal bovine serum at 37 °C in a humidified incubator containing 5 wt %/vol CO2. Both

Page 2 of 8

subculture and pretreatment of cells were completed in the clean bench. The cell number was counted for three times by a hemocytometer, then calculated the average value. Preparation and Characterization of SAAP. For SAAP 1, the probe fragments were dissolved in D-PBS containing 5 mM Mg2+ respectively and then heated at 95 °C for 10 min and cooled at 25 °C for half an hour. For SAAP 2, the split aptamer fragments and quenched fragments were first mixed in D-PBS containing 5 mM Mg2+. Then the mixture was heated at 95 °C for 10 min and cooled at 25 °C for half an hour. SAAP 2' was prepared by using the same operation as SAAP 2. The formation of SAAP was investigated by measuring the fluorescence intensity and relative quantum yields of SAAP using the F-7000 fluorescence spectrophotometer (Hitachi, Japan). The quantum yield of FAM-labeled and Cy5-labeled probes were respectively determined using Rhodamine 6G (Φ = 0.45) and Cy5.5 (Φ = 0.2) as the references.26-27 The quantum yields were calculated from the equation: ΦS = (ΦR FS AR nS2) / (FR AS nR2), where the subscripts S and R denote sample and references respectively; Φ, F, A, and n represent quantum yield, integrated fluorescence intensity, absorbance, and refractive index of the solvent, respectively.28 In this case, the experiments were all implemented in PBS, nS2 / nR2 = 1. Flow Cytometry Assays. Generally, different probes were incubated with 50,000 cells in 200 μL binding buffer at 25 °C for half an hour and then immediately analyzed using flow cytometer (Gallios, Beckman Coulter) by counting 10,000 events. 7404 cells were used as control. Samples with cell numbers ranging from 0 to 50,000 were used for the quantitative assay in binding buffer and 50% human serum. For the mixed cell assay, samples were prepared by mixing target 7721 cells and non-target 7404 cells in binding buffer in ascending ratios with a fixed total of 50,000 cells. After incubation, all the samples were analyzed directly by using flow cytometry without any washing and separation steps. The fluorescence signal was collected in FL1 for FAM (fluorescence channel: EX 488 nm, EM 525 nm band pass) and FL6 for Cy5 (fluorescence channel: EX 633 nm, EM 660 nm band pass). Confocal Imaging. To confirm the performance of the aptamer probes in cell imaging, the cells were imaged by a laser scanning confocal microscope (LSCM, Olympus, Japan). 7721, 7404 and HeLa cells were cultivated overnight in culture dishes, and washed with D-PBS for three times. The cells were then incubated with the aptamer probes (25 nM) in binding buffer at 25 °C for 15 min. After incubation, the cells were imaged directly by using LSCM without any washing and separation steps. For time-dependent fluorescence imaging, the pretreatment was same to the above, after adding SAAP 2 to the target cells in binding buffer, the cells were imaged at different times by a LSCM (Nikon, Japan). The fluorescence signal was collected by a 100× objective (For FAM, fluorescence channel: EX 488 nm, EM 505 nm longpass; For Cy5, fluorescence channel: EX 633 nm, EM 660 nm long-pass).

As proof of concept, a DNA aptamer ZY11 (detailed sequences seen in Table 1) that binding to target 7721 cells was selected to construct SAAP. ZY11 was developed by our lab through cell-SELEX, and the binding sites of ZY11 were located on cell membrane. ZY11 possessed two stems (purple


Page 3 of 8


Table 1. Detailed sequences of some oligonucleotides used in this work. a

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

a

Probe

Sequence (5'-3')

ZY11

TTGACTTGCCACTGACTACCTGGCGCATTGACGTCAGGTTGAGCTGAAGATCGTACCGTGAAG TCAGTCGGTCGTCATC

SAF 1

CGTCAGGTTGAGCTGAAGATCGTACCGTGAAGTCCGT

SAF 2

ACGGACTACCTGGCG

F-SAAP 1a-Q

FAM-ACTGATTTTGAGCTGAAGATCGTACCGTGAAGACAGT-BHQ1

F-SAAP 1b-Q

BHQ1-ACTGTCTAAATCAGT-FAM

QF1-8

AAATCAGT-BHQ1

QF2-8

TAGACAGT-BHQ1

F-SAAP 2a

FAM-ACTGATTTGCTTGAGCTGAAGATCGTACCGTGAACTAGACAGT

F-SAAP 2b

FAM-ACTGTCTAGTAGCAAATCAGT

Random

FAM-N(52nt)

Two stem regions of the aptamer are in purple and green respectively, the recognition region of the aptamer is in red.

A

B Random ZY 11

SAF 1+SAF 2

SAF 1 SAF 2

101

102

103

104

105

106

FAM

Figure 1. (A) Cutting method of ZY11 for obtaining split aptamer fragments. (B) Flow cytometry assays of 7721 cells incubated with FAM-labeled random sequence and FAMlabeled split aptamer fragments. Samples were washed three times by binding buffer before flow cytometry assays. and green bases in Table 1, the two separate purple sequences will match for stem formation after binding, as well as two green sequences) and one recognition loop (red bases in Table 1) after binding to target cells. Since the two stems were structure-conserved for stabilizing the overall structure of ZY11 and the loop was base-conserved for unique recognition of target cells according to our previous report, 19 we carefully split ZY11 into two fragments (named SAF 1 and SAF 2, sequences seen in Table 1) by ripping through the two stems (Figure 1A). Then one of the obtained split aptamer fragments was labeled with FAM for flow cytometry analysis. Sure enough, the flow cytometry analysis demonstrated that the obtained split aptamer fragments retained great binding ability to target 7721 cells (Figure 1B). For strategy 1, on one side, the background signal would decrease with the increasing of the base-pair number of double strand region of SAAP 1, but on the other, the probe selfassembly and activation would become more difficult. So, we first optimized the base-pair number of the SAAP 1. Four pairs of split aptamer probes (SAP 1, 2, 3 and 4) with 6, 5, 4 and 3 base-pairs (orange bases in Table S1) in double strand region respectively were labeled with FAM fluorescent group for flow cytometry assays (Table S1). As shown in Figure S1, when the base-pair number was 5, SAP lost its binding ability

to target cells because increasing base-pair number of double strand region endowed probe stability and hindered the probe self-assembly. So, SAP 3 was chosen for subsequent experiments. Then the two fragments (termed SAAP 1a and SAAP 1b) of SAP 3 were respectively labeled with FAM and BHQ1 pairs (termed F-SAAP 1a-Q and F-SAAP 1b-Q, Table 1) for feasibility investigation. F-SAAP 1a-Q and F-SAAP 1b-Q had 4 complementary bases in the 5' and 3' ends for matching respectively, which leading to quenched fluorescence. As demonstrated in Figure S2, the combination of F-SAAP 1a-Q and SAAP 1b achieved the highest SBR among SAP 3, SAAP 1a/F-SAAP 1b-Q and F-SAAP 1a-Q/F-SAAP 1b-Q. Due to fluorescence self-quenching of two adjacent FAM groups,29 the SBR of F-SAAP 1a-Q/F-SAAP 1b-Q that possessed two FAM groups was lower than F-SAAP 1a-Q/SAAP 1b and SAAP 1a/F-SAAP 1b-Q which possessed one FAM group after binding to target cells. Then F-SAAP 1a-Q/SAAP 1b (denoted as SAAP 1) was chosen as detection probe in strategy 1 because of its highest SBR. When target 7721 cells presented, SAAP 1 re-assembled on target cells and the conformation of two stems and one loop formed, leading to the separation of FAM and BHQ1, and thus fluorescence recovery of SAAP 1. In Figure 2A, SAAP 1 demonstrated good binding ability to target 7721 cells rather than control 7404 cells, suggesting that SAAP 1 was feasible for cancer cell detection. The confocal imaging results also revealed the specific binding of SAAP 1, proven by a strong fluorescence on 7721 cells incubated with SAAP 1 (Figure S3). As for strategy 2, to ensure QF1 and QF2 (sequences seen in Table 1 and Table S1) hybridized stably with stem regions of SAAP 2a and SAAP 2b, we respectively extended 1, 2, 3 and 4 base-pairs (blue bases in Table S1) at two stems of the split aptamer (named SA 1, 2, 3 and 4, Table S1) because of tolerance of stem regions to base-pair number to some extent. Flow cytometry assays demonstrated that the binding ability began to decrease when 4 base-pairs were added to stem region (Figure S4). So, SA 3 with 3 base-pairs extended in stems was selected for probe construction. Then the two fragments of SA 3 were both labeled with FAM while the QFs were labeled with BHQ1. After incubating with together, FSAAP 2a-Q and F-SAAP 2b-Q were obtained. F-SAAP 2a-Q and F-SAAP 2b-Q presented quenched fluorescence since FAM-labeled SAAP 2a and SAAP 2b (F-SAAP 2a and F-



A

B

7721 + F-SAAP 2a-Q

7721+ SAAP 1b

7721 + F-SAAP 2b-Q

7404 + SAAP 1

7404 + SAAP 2

7721+ SAAP 1

7721 + SAAP 2

C

40 30

SBR

7721 + F-SAAP 1a-Q

20 10

100 101 102 103

104

105 106

100

101

0

102

FAM

103

104

105

SAAP 1

106

SAAP 2

Probe

FAM

Figure 2. Comparison of feasibility of two self-assembling and activatable strategies. (A) Flow cytometry assays of 7721 cells incubated with F-SAAP 1a-Q, 7721 cells incubated with SAAP 1b, 7404 cells incubated with SAAP 1 and 7721 cells incubated with SAAP 1. (B) Flow cytometry assays of 7721 cells incubated with F-SAAP 2a-Q, 7721 cells incubated with F-SAAP 2b-Q, 7404 cells incubated with SAAP 2 and 7721 cells incubated with SAAP 2. (C) Corresponding SBR of SAAP 1 and SAAP 2 for detecting 7721 cells. The error bars indicated the standard deviations of three experiments. 500 cells

1.0M

1.0M

800K

800K

800K

600K

SS-A

SS-A

SS-A

1.0M

600K

600K

400K

400K

400K

200K

200K

200K

0

0

0 101 102 103 104 105 106

101 102 103 104 105 106 FAM

101 102 103 104 105 106 FAM

FAM

5 cells

50 cells

0 cells

1.0M

1.0M

800K

800K

800K

400K

SS-A

600K

SS-A

1.0M

600K

600K

400K

400K

200K

1e+5 1e+4 1e+3 1e+2 1e+1 1e+0 1e+0

1e+1

1e+2

1e+3

1e+4

1e+5

1e+6

Number of cells by hemocytometer

0

0 101 102 103 104 105 106 FAM

1e+6

200K

200K

0

B

Number of cells by this strategy

5000 cells

50000 cells

A

SS-A

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 8

101 102 103 104 105 106

101 102 103 104 105 106

FAM

FAM

Figure 3. (A) Flow cytometry assays of SAAP 2 labeled 7721 cells with the decreasing of cell number from 0 to 50,000 in 100 μL binding buffer. (B) Corresponding calibration curve implied the linear relationship between the number of 7721 cells counted by the proposed strategy and the number of 7721 cells counted by the hemocytometer. All the error bars represented standard deviations of three repeated measurements. SAAP 2b, sequences seen in Table 1) hybridized with BHQ1labeled QF1 and QF2, which leading to proximity of FAM and BHQ1. Because the background signal would decrease with the rising of the stability of double strand regions of SAAP 2, while the probe self-assembly and activation might be increasingly difficult, we first optimized the base-pair number of double strand regions by hybridizing with QF1-7, 8, 9, 10 and QF2-7, 8, 9, 10 (Table S1) which possess 7, 8, 9 and 10 complementary bases to SAAP 2a and SAAP 2b respectively. Flow cytometry results indicated that the SBR was highest when 8 bases (8 bases of 5' end of F-SAAP 2a matched with QF1-8, 8 bases of 5' end of F-SAAP 2b matched with QF2-8, sequences seen in Table 1) were paired (Figure S5). So we selected them (denoted as SAAP 2) as detection probe in strategy 2. The fluorescence spectrum results demonstrated that the SAAP 2 was successfully formed with quenched fluorescence (Figure S6A). Moreover, the relative quantum yields of the quenched F-SAAP 2a-Q and F-SAAP 2b-Q were obviously lower than that of fluorescent F-SAAP 2a and FSAAP 2b (Figure S6B), indicating satisfactory intermolecular

quenching efficiency of SAAP 2. It was noting that F-SAAP 1a-Q also showed distinct intramolecular quenching efficiency. When target cells presented, F-SAAP 2a and F-SAAP 2b reassociated on target cells and the QFs disassociated, leading to the separation of FAM and BHQ1, and thus significant fluorescence recovery of SAAP 2. In Figure 2B, SAAP 2 showed excellent binding ability to target cells, suggesting that SAAP 2 was absolutely feasible for 7721 cell detection. The same results were also tested by confocal imaging, proven by a strong fluorescence surrounding 7721 cells incubated with SAAP 2 (Figure S7). Specifically, SAAP 2 performed better in detecting 7721 cells with approximate 5 times higher in SBR than SAAP 1 (Figure 2C). The probable reasons for the difference of SBR between SAAP 2 and SAAP 1 were as follows: Firstly, FRET usually occurred when the distance between donor and acceptor was 1 to 10 nm.30,31 Since the length of SAAP 1b (15 bases) was small (~5 nm), the distance between FAM and BHQ1 was mostly within 5 nm considering strand folding and curling after SAAP 1 binding to target cells. However, this


Page 5 of 8 50000 cells

500 cells

5000 cells 1.0M

1.0M

800K

800K

800K

600K

SS-A

SS-A

SS-A

1.0M

600K

600K

400K

400K

400K

200K

200K

200K

0 101 102 103 104 105 106 FAM

0 101 102 103 104 105 106 FAM

50 cells

0 101 102 103 104 105 106 FAM

0 cells

5 cells 1.0M

800K

800K

800K

600K

SS-A

1.0M

SS-A

1.0M

SS-A

600K

600K

400K

400K

400K

200K

200K

200K

0

101 102 103 104 105 106 FAM

0

101 102 103 104 105 106 FAM

0

101 102 103 104 105 106 FAM

Figure 4. Flow cytometry assays of 7721 cells with cell number ranging from 0 to 50,000 in 100 μL binding buffer containing 50% human serum by SAAP 2. 7721 cells appeared in black frame, and serum fragments located in black frame outside. distance was probably beyond 10 nm for SAAP 2 since the BHQ1-labeled QFs dissociated from SAAP 2 after binding. Therefore, FRET still occurred to some extent for SAAP 1 rather than SAAP 2, resulting in fluorescence reduction and low SBR of SAAP 1. Secondly, higher probe fluorescence intensity contributed to higher SBR because only one FAM group was labeled on SAAP 1 while two FAM groups on SAAP 2. Thirdly, SAAP 2 showed better binding ability to target 7721 cells because the dissociation constant of SAAP 2 (14.8 nM, Figure S8B) to target cells was lower than SAAP 1 (51.1 nM, Figure S8A), which likely leading to high SBR of SAAP 2 for target cell detection. Taking account of higher SBR was favorable for cancer cell detection, SAAP 2 was subsequently selected to detect target 7721 cells. To further improve SBR for detecting 7721 cells with SAAP 2, probe concentration, incubation temperature, incubation time and probe ratio were respectively optimized. In Figure S9, with variation of different probe concentrations (1, 2.5, 5, 10, 25, 50, and 100 nM), incubation temperatures (4, 25, 37, and 40 °C), incubation times (15, 30, 45 and 60 min), probe ratios (F-SAAP 2a-Q to F-SAAP 2b-Q, 3:1, 2:1, 1:1, 1:2 and 1:3), different corresponding SBR were respectively displayed. The results demonstrated that the SBR were highest when the probe concentration was 25 nM and incubation temperature was 25 °C. We found that incubation time do not significantly affect the probes binding to target cells. Taking account of time-saving, we chose 15 min as the best incubation time. To further investigate the binding velocity of SAAP 2 to target cells, the time-dependent fluorescence imaging was performed (Figure S10), the results showed that the signal reached a plateau in about 15 min, which was consistent with the optimal incubation time. In addition, the SBR were approximately constant with different probe ratios, we chose 1:1 as best ratio considering of saving probes. In view of above results, the best detection condition was determined as 25 °C with 25 nM probes in a 1:1 probe ratio for 15 min of incubation. After condition optimization, the SBR of SAAP 2 for cancer cell detection was raised to ~40 times.

With optimized conditions, quantitative assay was implemented by using flow cytometry. The target cells with number ranging from 0 to 50,000 in 100 μL binding buffer were prepared. As shown in Figure 3A, the SAAP 2 labeled target cells appearing in upright region gradually decreased with the reduction of cell number. The background signal was determined without any cells in the 100 μL binding buffer. Effective counts were obtained by subtracting background counts plus three times standard deviation. The calibration curve presented an outstanding linear response with a regression equation of lg Y = 0.9549 lg X + 0.0631, which X and Y represented cell number measured by the proposed method and a hemocytometer respectively (Figure 3B). The detection limit in theory was calculated as 7 cells in 100 μL binding buffer by taking background counts plus three times standard deviation as effective minimum counts. This detection limit was lower than most of aptamer-based methods that using ‘always on’ probes32-35, self-assembling probes19 or A

Normalization of mean FI

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


B

1.2

Low fluorescence

1:0

1.0 0.8

2:1

0.6

1:1

0.4

High fluorescence

1:2

0.2

0:1

0.0 21 04 M os -7 La L02 77 74 CE Ram CF He M

100 101

102 103 104 105 106

FAM

Figure 5. (A) Mean fluorescence intensity (FI) of target 7721 cells and control cells (7404, CEM, Ramos, MCF-7, HeLa, and L02 cells) incubating with SAAP 2 by flow cytometry. The error bars indicated the standard deviations of three experiments. (B) Flow cytometry assays of cell mixtures incubated with SAAP 2. The ratios of 7404 cells to 7721 cells were 1:0, 2:1, 1:1, 1:2 and 0:1. The total number of cells was 50,000 and the final volume was 200 μL in each sample.


Analytical Chemistry Fluorescence recovered

Fluorescence quenched

×

FAM

BHQ1 Cy5

BHQ2

Target cell

Overlap

b'

a

Cell membrane

SAAP 2'

Scheme 2. Schematic representation of dual-signal strategy with SAAP 2' for target cell detection.

A

100 101 102

Cy5

7721

×

FAM

7404

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 8

B 7721 + F-SAAP 2a-Q

7721 + F-SAAP 2a-Q

7721 + F-SAAP 2b'-Q

7721 + F-SAAP 2b'-Q

7404 + SAAP 2'

7404 + SAAP 2'

7721 + SAAP 2'

7721 + SAAP 2'

103 104 105 106

FAM

100 101 102

Figure 7. LSCM images of 7721 and 7404 cells incubated with SAAP 2'. The left is fluorescence channel of FAM, the middle is fluorescence channel of Cy5, the right is the overlays of the FAM channel and Cy5 channel.

103 104 105 106

Cy5

Figure 6. Flow cytometry assays of 7721 cells incubated with F-SAAP 2a-Q, 7721 cells incubated with F-SAAP 2b'-Q, 7404 cells incubated with SAAP 2' and 7721 cells incubated with SAAP 2' in channel FAM (A) and Cy5 (B). activatable probes21,22,25 alone (Table S2). In addition, the ability of SAAP 2 to detect target cells in 50% human serum was also evaluated, the results demonstrated that the labeled counts appearing in the black frame decreased corresponding to the reduction of cell number in the sample, which indicated that SAAP 2 possess great potential to detect complex samples (Figure 4). We next assessed the specificity of SAAP 2 to 7721 cells by comparing fluorescence intensity of control cells incubated with SAAP 2. As shown in Figure 5A, the fluorescence intensity of 7721 cells was obviously higher than the control cells, which revealed the excellent specificity of SAAP 2. Furthermore, the ability of SAAP 2 for detecting target cells from cell mixture was investigated. As shown in Figure 5B, increasing cells were observed in high fluorescence (right of dashed line) region while decreasing cells appeared in low fluorescence (left of dashed line) region with rising number of target cells in cell mixture, indicated that SAAP 2 was great specific to target 7721 cells in complex samples. Since single-signal fluorescent readout is easier to be affected by environment factors, such as pH, temperature, photobleaching, and so on. Especially in the detection of complex biological samples, biological autofluorescence usually accompany with single-signal detection system, may lead to inaccuracy of the detection.36 However, dual-signal detection could significantly avoid false positive and negative signal caused by single-signal detection. Therefore, dual-signal detection of target cells was carried out by replacing F-SAAP 2b-Q with F-SAAP 2b'-Q which labeled with Cy5 and BHQ2 pair (Scheme 2). Cy5 is a near-infrared dye which is not easily be interfered by autofluorescence of biological samples. 37 In this strategy, the different fluorescence emission bands of FAM and Cy5 enable the detection accuracy. For example, if the fluorescence in FAM channel is generated by biological

autofluorescence, the absence of Cy5 fluorescence will eliminate this concern because of its large-scale difference in emission band, and vice versa. After the quenched aptamer probes were successful prepared, which proved by the low relative quantum yields of F-SAAP 2a-Q and F-SAAP 2b'-Q (Figure S6B), the feasibility of dual-signal detection was investigated. As displayed in Figure 6, the FAM (A) and Cy5 (B) fluorescence signals of target cells were obviously stronger than controls, indicated good feasibility of dual-signal detection. With optimized detection conditions, the dual-signal detection of 7721 cells in binding buffer and 50% human serum were respectively explored. As demonstrated in Figure S11 and Figure S12, FAM and Cy5 labeled 7721 cells appeared in detection regions decreased with the reduction of target cell number in samples, indicated convincing performances of dual-signal detection. In addition, the dual-signal imaging of target cells was also verified by LSCM. As seen in Figure 7, green fluorescence of FAM, red fluorescence of Cy5 and yellow fluorescence of overlap were respectively observed on target 7721 cells after staining with SAAP 2', while no fluorescence was observed on control 7404 cells staining with SAAP 2'. These results further demonstrated the excellence of dual-signal detection.

In summary, we have ingeniously designed two types of SAAP for cancer cell detection based on self-assembling and activatable strategy which demonstrates strong superiority. Firstly, the detection sensitivity is greatly improved because of the ultralow background with the high SBR (~40 times) based on target cell recognition-induced self-assembly of split aptamers. The detection limit is achieved as low as 7 cells in 100 μL binding buffer. Secondly, one-step detection of target cells can be realized within 15 min without any washing steps and pretreatment, which is potential for point-of-care detection. Importantly, this method performs well for detecting target cells in 50% human serum and mixed cell samples, demonstrating great prospect in clinical diagnosis. Furthermore, dual-signal detection is also successfully achieved, which may be helpful to accurate detection of target cells. Therefore, this fast, facile, specific and high-sensitive detection method for cancer cells may provide convenience in cancer research and medical diagnosis.


Page 7 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The Supporting Information is available free of charge on the ACS Publications website. Detailed sequences of oligonucleotides used in this work (Table S1); detection limit of other methods (Table S2); optimization of the base-pair number of the SAAP 1, SAAP 2 and the parent split aptamer stems (Figure S1, S4 and S5); investigation of probe combination of SAAP 1 for cancer cell detection (Figure S2); confocal imaging of target cells stained with the SAAP 1 and SAAP 2 (Figure S3 and S7); the fluorescence spectrum and relative quantum yields of the quenched probes (Figure S6); the dissociation constant of SAAP 1 and SAAP 2 (Figure S8); optimization of the experimental conditions (Figure S9); time-dependent fluorescence imaging of target cells (Figure S10); Dualsignal detection of target cells in binding buffer and 50% human serum (Figure S11 and S12).

* E-mail: [email protected]. Tel/ Fax: +86-731-88821566. * E-mail: [email protected]. Tel/ Fax: +86-731-88821566. The authors declare no competing financial interests.

This work was supported by the National Natural Science Foundation of China (Grants 21175035, 21190040, 21275043) and the Hunan Province Science and Technology Project of China (Grant 2013FJ4042), the Foundation for Innovative Research Groups of NSFC (Grant 21521063).

(1) Pantel, K.; Brakenhoff, R. H.; Brandt, B. Nat. Rev. Cancer 2008, 8, 329-340. (2) Wu, L.; Qu, X. Chem.Soc.Rev. 2015, 44, 2963-2997. (3) Hong, B.; Zu, Y. Theranostics 2013, 3, 377-394. (4) Ho, K. F.; Gouw, N. E.; Gao, Z. TrAC-Trends Anal. Chem. 2015, 64, 173-182. (5) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-822. (6) Tuerk, C.; Gold, L. Science 1990, 249, 505-510. (7) Fang, X.; Tan, W. Acc. Chem. Res. 2010, 43, 48-57. (8) Tan, W.; Donovan, M. J.; Jiang, J. Chem. Rev. 2013, 113, 28422862. (9) Famulok, M.; Hartig, J. S.; Mayer, G. Chem. Rev. 2007, 107, 3715-3743. (10) Shamah, S. M.; Healy, J. M.; Cload, S. T. Acc. Chem. Res. 2008, 41, 130-138. (11) Stojanovic, M. N.; Prada, P.; Landry, D. W. J. Am. Chem. Soc. 2000, 122, 11547-11548. (12) Chen, A.; Yan, M.; Yang, S. TrAC-Trends Anal. Chem. 2016, 80, 581–593. (13) Kent, A. D.; Spiropulos, N. G.; Heemstra, J. M. Anal. Chem. 2013, 85, 9916−9923. (14) Yu, H.; Canoura, J.; Guntupalli, B.; Lou, X.; Xiao, Y. Chem. Sci. 2017, 8, 131-141. (15) Freeman, R.; Sharon, E.; Tel-Vered, R.; Willner, I. J. Am. Chem. Soc. 2009, 131, 5028–5029. (16) Zuo, X.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2009, 131, 6944–6945. (17) Ling, K.; Jiang, H.; Li, Y.; Tao, X.; Qiu, C.; Li, F. R. Biosens. Bioelectron. 2016, 86, 8-13. (18) Chen, C. K.; Shiang, Y. C.; Huang, C. C.; Chang, H. T. Biosens. Bioelectron. 2011, 26, 3464-3468.

(19) Yuan, B.; Zhou, Y.; Guo, Q.; Wang, K.; Yang, X.; Meng, X.; Wan, J.; Tan, Y.; Huang, Z.; Xie, Q.; Zhao, X. Chem. Commun. 2015, 52, 1590-1593. (20) Urano, Y.; Asanuma, D.; Hama, Y.; Koyama, Y.; Barrett, T.; Kamiya, M.; Nagano, T.; Watanabe, T.; Hasegawa, A.; Choyke, P. L.; Kobayashi, H. Nat. Med. 2009, 15, 104-109. (21) Zeng, Z.; Tung, C. H.; Zu, Y. Mol. Ther.-Nucl. Acids 2014, 3, e184. (22) Shi, H.; He, X.; Wang, K.; Wu, X.; Ye, X.; Guo, Q.; Tan, W.; Qing, Z.; Yang, X.; Zhou, B. Proc. Natl. Acad. Sci.U.S.A. 2011, 108, 3900−3905. (23) Zhao, B.; Wu, P.; Zhang, H.; Cai, C. Biosens. Bioelectron. 2015, 68, 763-770. (24) Yan, L.; Shi, H.; He, X.; Wang, K.; Tang, J.; Chen, M.; Ye, X.; Xu, F.; Lei, Y. Anal. Chem. 2014, 86, 9271-9277. (25) Lei, Y.; Tang, J.; Shi, H.; Ye, X.; He, X.; Xu, F.; Yan, L.; Qiao, Z.; Wang, K. Anal. Chem. 2016, 88, 11699-11706. (26) Alfano, R. R.; Shapiro, S. L.; Yu, W. Opt. Commun. 1973, 7, 191-192. (27) Talanov, V. S.; Regino, C. A.; Kobayashi, H.; Bernardo, M.; Choyke, P. L.; Brechbiel, M. W. Nano Lett. 2006, 6, 1459-1463. (28) Conlon, P.; Yang, C. J.; Wu, Y.; Chen, Y.; Martinez, K.; Kim, Y.; Stevens, N.; Marti, A. A.; Jockusch, S.; Turro, N. J.; Tan, W. J. Am. Chem. Soc. 2008, 130, 336-342. (29) Jozawa, H.; Kabir, M.; Zako, T.; Maeda, M.; Chiba, K.; Kuroda, Y. FEBS Lett. 2016, 590, 3501-3509. (30) Sapsford, K. E.; Berti, L.; Medintz, I. L. Angew. Chem. Int. Ed. 2006, 45, 4562-4589. (31) Selvin, P. R. Nature 2000, 7, 730-734. (32) Xie, Q.; Tan, Y.; Guo, Q.; Wang, K.; Yuan, B.; Wan, J.; Zhao, X. Anal. Methods 2014, 6, 6809–6814. (33) Liu, G.; Mao, X.; Phillips, J. A.; Xu, H.; Tan, W.; Zeng, L. Anal. Chem. 2009, 81, 10013-10018. (34) Chen, X.; Pan, Y.; Liu, H.; Bai, X.; Wang, N.; Zhang, B. Biosens. Bioelectron. 2015, 79, 353-358. (35) Bi, S.; Ji, B.; Zhang, Z.; Zhang, S. Chem. Commun. 2013, 49, 3452-3454. (36) Hilderbrand, S. A.; Weissleder, R. Curr. Opin. Chem. Biol. 2010, 14, 71-79. (37) Luo, S.; Zhang, E.; Su, Y.; Cheng, T.; Shi, C. Biomaterials 2011, 32, 7127-7138.



Table of Contents (TOC) 40

SAAP 1 SBR

30 20 10

Target cell

0 SAAP 1

SAAP 2

Probe

400 300

Split aptamer

Counts

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Confocal

200 100

SAAP 2

Flow cytometry 0 101 102 103 104 105 106


Page 8 of 8

High Signal-to-Background Ratio Detection of Cancer Cells with

Recommend Documents