In Vitro Study of Transporters Involved in Intestinal Absorption of

Article pubs.acs.org/crt

In Vitro Study of Transporters Involved in Intestinal Absorption of Inorganic Arsenic Marta Calatayud, Julio A. Barrios, Dinoraz Vélez, and Vicenta Devesa* Instituto de Agroquímica y Tecnología de Alimentos (CSIC), Av. Agustín Escardino, 7, 46980 Paterna, Valencia, Spain ABSTRACT: Inorganic arsenic (iAs) [As(III)+As(V)] is a drinking water contaminant, and human exposure to these arsenic species has been linked with a wide range of health effects. The main path of exposure is the oral route, and the intestinal epithelium is the first physiological barrier that iAs must cross in order to be absorbed. However, there is a lack of information about intestinal iAs absorption. The aim of this study was to evaluate the participation of certain transporters [glucose transporters (GLUT and SGLT), organic anion transporting polypeptides (OATPs), aquaporins (AQPs), and phosphate transporters (NaPi and PiT)] in intestinal absorption of As(V) and As(III), using the Caco-2 cell line as a model of the intestinal epithelium. For this purpose, the effects of chemical inhibition and gene silencing of the transporters of interest on iAs uptake were evaluated, and also the differential expression of these transporters after treatment with iAs. The results show that chemical inhibition using rifamycin SV (OATP inhibitor), phloridzin (SGLT inhibitor), phloretin (GLUT and AQP inhibitor), and copper sulfate (AQP inhibitor) leads to a significant reduction in the apparent permeability and cellular retention of As(III). RT-qPCR indicates up-regulation of GLUT2, GLUT5, OATPB, AQP3, and AQP10 after exposure to As(III), while exposure to As(V) increases the expression of sodium-dependent phosphate transporters, especially NaPiIIb. Gene silencing of OATPB, AQP10, and GLUT5 for As(III) and NaPiIIb for As(V) significantly reduces uptake of the inorganic forms. These results indicate that these transporters may be involved in intestinal absorption of iAs.

■

INTRODUCTION Inorganic arsenic (iAs) is classified by the International Agency for Research on Cancer as carcinogenic to humans (Group 1).1 Epidemiological studies also associate chronic exposure with the occurrence of other kinds of pathologies, such as skin lesions, cardiovascular and cerebrovascular pathologies, type 2 diabetes, respiratory illnesses, and neurobehavioral disorders in children.2 From a toxicological viewpoint, it has been shown that As(III) is more toxic than its pentavalent equivalent.3 Uptake studies conducted with various cell lines show a high entry and accumulation of As(III) inside the cell, compared with a meager entry of As(V).4 This is postulated as one of the causes for the difference in the degree of toxicity. However, in vivo studies in experimental animals show that both As(III) and As(V) administered orally can accumulate in target organs.5 The intestinal epithelium is the first physiological barrier after intake, and therefore, it might be decisive for the toxic effect of iAs. In vivo studies show that absorption of the inorganic forms is high. In assays with swine, Juhasz et al.6 showed that oral administration of aqueous standards of As(III) and As(V) leads to complete absorption. However, in vitro studies 7−9 using Caco-2 as a model of the intestinal epithelium show that there are marked differences in intestinal absorption of the two species. There have been few studies of the mechanisms involved in intestinal absorption of arsenic. Our previous studies,7,8 using an in vitro model, showed that these two forms of arsenic are transported via the paracellular pathway, although there are also © 2012 American Chemical Society

transcellular transport mechanisms, some energy dependent. There are more studies on As(III) transporters than on As(V) transporters, and they show the participation of aquaporins, AQP7 and AQP9,10,11 glucose transporters, GLUT1,12 and organic anion transporting polypeptides, OATPC.13 These studies were not conducted on intestinal epithelium cells, where the isoforms studied in other cell lines are not present or are expressed to a lesser extent. With regard to As(V), there is some indication that phosphate transporters participate in its transport, although only a single study has been conducted for intestinal cells.14 The aim of the present study was to evaluate the participation of certain transporters in intestinal absorption of As(V) and As(III), using the model generated by the human colon adenocarcinoma Caco-2 cell line. For this purpose, we evaluated the effect of transporter inhibitors on the apparent permeability coefficient and cell retention of inorganic arsenic, the effect on arsenic uptake of the silencing of genes that encode certain transporters, and the differential expression of these transporters after exposure to the inorganic arsenic species.

■

MATERIALS AND METHODS

Arsenic Species. The standard solution of As(V) (1000 mg/L) was purchased from Merck (Merck, Darmstadt, Germany). The standard of As(III) (1000 mg/L) was prepared by dissolving 1.320 g of

Received: November 14, 2011 Published: January 3, 2012 446

dx.doi.org/10.1021/tx200491f | Chem. Res. Toxicol. 2012, 25, 446−453

Chemical Research in Toxicology

Article

As2O3 (Riedel de Haën, Germany) in 25 mL of 20% (m/v) KOH, neutralizing with 20% (v/v) H2SO4, and diluting to 1 L with 1% (v/v) H2SO4. Cell Culture. The Caco-2 cells were obtained from the European Collection of Cell Cultures (ECACC; number 86010202, Salisbury, U.K.). The cells were maintained in 75 cm2 flasks to which 10 mL of Dulbecco’s Modified Eagle Medium (DMEM) with glucose (4.5 g/L) was added at pH 7.4. The DMEM was supplemented with 10% (v/v) of fetal bovine serum (FBS), 1% (v/v) of nonessential amino acids (NEAA), 1% (v/v) of 100 mM sodium pyruvate, 1% (v/v) of 1 M HEPES (N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid), 1% (v/v) of antibiotics (penicillin/streptomycin), and 1% (v/v) of amphotericin B (DMEMc). The cells were incubated at 37 °C, in an atmosphere with 95% relative humidity and a CO2 flow of 5%. The medium was changed every 2−3 days. When the cell monolayer reached 80% confluence, the cells were detached with a solution of trypsin (0.5 g/L) and EDTA (0.2 g/L). The assays were performed with cultures between passages 5 and 25. All the reagents used were obtained from PAA Laboratories GmbH (Germany). Effect of Transporter Inhibitors on Apparent Permeability and Cellular Uptake of As(III). Apparent permeability was evaluated in two-chamber wells with polyester membranes (diameter 24 mm, pore size 0.4 μm; Transwell, Costar Corp., NY, U.S.A.). In this system, the Caco-2 cells are grown on a porous support that separates the well into two compartments: apical (upper) and basal (lower). The cells were seeded at a density of 7.5 × 104 cells/cm2, adding 1.5 mL of DMEMc to the apical chamber and 2 mL to the basal chamber. The cells were incubated at 37 °C, 5% CO2, and 95% relative humidity, with a change of medium every 2 to 3 days until cell differentiation was attained (14−15 days post seeding). The corresponding inhibitor [rifamycin SV sodium salt (Fluka Chemika Biochemika, Spain), phloridzin (phloretin 2′-β-D-glucopyranoside, Sigma, Spain), phloretin (β-4-hydroxyphenyl-2,4,6-trihydroxý Spain)] propiophenone, Sigma), or Cu2SO4 (Panreac Quimica, in Hanks’ balanced salt solution (HBSS, PAA) with sodium pyruvate (1 mM) and HEPES (1 mM) was then added, preincubating for 15 min. The inhibitor concentration used was 100 μM. After this time, the standard solution of As(III) (10 μM) was added to the HBSS medium. For rifamycin SV and phloridzin, a longer preincubation time (60 min) was also assayed. At the established times (5, 15, 30, 45, 60, 90, 120, 180, and 240 min), samples (400 μL) were taken from the basal compartment and replaced with fresh media. In the aliquots withdrawn at each time, total As was determined by atomic absorption spectrometry with a Zeeman graphite chamber (Analyst 600 model, Perkin-Elmer Hispania, S.A., Spain), in accordance with the method described in our previous study.7 The apparent permeability coefficient was calculated by applying eq 1.

Papp = (dC /dt )(Vr /ACo)

sodium pyruvate (1 mM) and HEPES (1 mM) was added. Rifamycin SV and phloridzin were preincubated for 60 min, whereas phloretin and Cu2SO4 were preincubated for 15 min. The cells were then exposed to As(III) (10 μM) in supplemented HBSS medium for 30 min, washed with PBS (PAA), and harvested by trypsinization. Samples were analyzed by hydride generation-cold trap-atomic absorption spectrometry at pH 1.15 Cellular viability was assessed by trypan blue staining (Sigma) at the end of the assays. All the inhibition assays were performed at least in triplicate in two separate experiments. The results were analyzed statistically by onefactor analysis of variance (ANOVA) with subsequent Tukey’s HSD multiple comparison test (SPSS, version 15.0). Differences were considered significant when p < 0.05. Differential Expression of Transporters by Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR). Cells were seeded at a density of 5 × 104 cells/cm2 in DMEMc medium in 6 well plates. After 12−15 days of differentiation, they were exposed to 100 μM As(V) or 10 μM As(III) in Minimal Essential Medium (MEM) (PAA) for 24, 48, and 72 h. After these times, the cells were washed with PBS and recovered for total RNA extraction with a NucleoSpin RNA II kit (Macherey-Nagel, Germany). The RNA extracted was quantified spectroscopically in a Nanodrop ND-1000 (NanoDrop Technologies, Wilmington, DE, U.S.A.), adjusting the samples with RNase-free water to work with the same concentrations. RNA integrity was analyzed by electrophoresis in 1% agarose gel. Firststrand cDNA (cDNA) was obtained from 100 ng of total RNA using a Reverse Transcriptase Core Kit (Eurogentec Headquarters, Belgium). qPCR was performed using the LightCycler 480 Real-Time q-PCR Instrument (Roche Diagnostics, Indianapolis, IN, U.S.A.). Reactions were carried out in a 20 μL final volume containing 10 μL of LightCycler 480 SYBR Green I Master Mix (2X) (Roche), 5 μL of cDNA (20 ng/μL), 2 μL of each forward and reverse primer (10 μM) (Biolegio, The Netherlands), and nuclease-free water. No-template controls were run to verify the absence of genomic DNA. Table 1 shows the oligonucleotide sequences that were used. The reference gene used was 18S rRNA. qPCR efficiency curves for each gene were calculated using five duplicate 2-fold dilutions of cDNA. The qPCR conditions were 95 °C for 5 min, followed by 40 cycles: 10 s denaturation at 95 °C, 10 s annealing at 55 °C, and 20 s elongation at 72 °C. The melting curve of each sample was analyzed after every qPCR run to confirm qPCR product specificity. The data was analyzed with the Relative Expression Software Tool (REST 2009, Qiagen), using the standard mode. All the assays were performed in quadruplicate in two independent experiments. siRNA Transfections. The silencing assays were performed with undifferentiated cells owing to the difficulty of transfecting differentiated cells.16 Prior to Caco-2 transient transfection, studies of expression of GLUT5, AQP10, OATPB, and NaPiIIb were carried out with undifferentiated Caco-2 cells (24 h post seeding), using the same times and conditions as for the transfection assays. In all cases, it was possible to detect the expression of the transporters studied (data not shown). siRNA transfection of Caco-2 cells was performed according to Qiagen’s HiPerFect Transfection Reagent Handbook (Qiagen, Germany), with modifications. Briefly, cells were trypsinized, counted, and then diluted in DMEM complete medium without antibiotics and antifungals. On average, 7.5 × 105 cells/cm2 were seeded in a 24 well plate and incubated for 24 h under their normal growth conditions. Gene silencing was then performed. For this purpose, siRNA obtained from Qiagen (Table 2) [GLUT5 (Hs_SLC2A5_3), AQP10 (Hs_AQPP10_4), NaPiIIb (Hs_SLC34A2_5), and OATPB (Hs_SLCO2B1_10 and Hs_ SLCO2B1_7)] were diluted to a final concentration of 50 nM in 100 μL of DMEM (without supplementation). HiPerFect transfection reagent (10 μL, Qiagen) was added to the diluted siRNA, and samples were incubated for 15 min to allow formation of transfection complexes. The complexes were then added dropwise to the cells and incubated under their normal growth conditions. Gene silencing was evaluated at 24 h (GLUT5 and NaPiIIb) and 48 h (OATPB and AQP10) after transfection at the mRNA level using RT-qPCR. Gene silencing was also monitored

(1)

where dC/dt is the flow (μM/s) determined by the linear slope of the equation that governs the variation in concentrations of arsenic species, corrected by dilution, against time. Vr is the volume of the basal compartment (2 mL). A is the surface occupied by the cell monolayer. Co is the initial concentration of arsenic in the apical compartment. Monolayer integrity was evaluated before the treatment and at the various times when aliquots were taken. For this purpose, transepithelial electrical resistance (TEER) was measured with a MillicellERS (Millipore Corp.), and the permeability coefficient of Lucifer Yellow (LY, Sigma), a fluorescent compound transported mainly across cell junctions, was determined. This compound was added at a concentration of 100 μM to the control wells and to the wells treated with As. The fluorescence of the LY transported to the acceptor side was measured with a microplate reader (PolarSTAR OPTIMA, BMGLabtech, Germany) at excitation/emission wavelengths of 485/ 520 nm, respectively. The assays of cellular uptake of As(III) were performed by seeding 5 × 104 cells/cm2 in 24 well plates. The cells were kept in the conditions described above. After 12−13 days, the culture medium was removed, and the corresponding inhibitor in HBSS supplemented with 447



Article

Table 1. Oligonucleotide Sequences Used in qPCR gene

GenBank accession no.

OATPB (SLCO2B1)

NM_001145211.1

OATPE (SLCO4A1)

NM_016354.3

GLUT1 (SLC2A1)

NM_006516.2

GLUT2 (SLC2A2)

NM_000340.1

GLUT3 (SLC2A3)

NM_006931.2

GLUT5 (SLC2A5)

NM_003039.2

SGLT1 (SLC5A1)

NM_000343.3

AQP1

NM_198098.2 (tr.1)

AQP3

NM_004925.3

AQP4

NM_001650.4

AQP10

NM_080429.2

P-gp (ABCB1)

NM_000927.3

MRP2 (ABCC2)

NM_000392.3

MRP3 (ABCC3)

NM_001144070.1

BCRP (ABCG2)

NM_004827.2

PiT1 (SLC20A1)

NM_005415.3

PiT2 (SLC20A2)

NM_006749.3

NaPiIIa (SLC34A1)

NM_003052.4

NaPiIIb (SLC34A2)

NM_006424.2

RN18S1

NR_003286.2

primer sequence

amplicon size (bp)

efficacy

F: TCAAGCTGTTCGTTCTGTGC R: GTGTTCCCCACCTCGTTGAA F: CTGCCAGCCAGAACACTACA R: AGAAGGAGGGGCTTTCTCTG F: CCAGCTGCCATTGCCGTT R: GACGTAGGGACCACACAGTTGC F: CACACAAGACCTGGAATTGACA R: CGGTCATCCAGTGGAAGAC F: CAATGCTCCTGAGAAGATCATAA R: AAAGCGGTTGACGAAGAGT F: CATCACTGTTGGCATCCTTGTG R: AGGATCGGCCAGCCATCTAC F: TCGGACTGTGGGCTATGTTTT R: GCCACTTCCAATGTTACTAGCA F: TGGCTGTGGGATTAACCCTG R: GGTTGCTGAAGTTGTGTGTGATC F: GGAATAGTTTTTGGGCTGTA R: GGCTGTGCCTATGAACTGGT F: GGAATTTCTGGCCATGCTTA R: AGACTTGGCGATGCTGATCT F: GGGTCAAGCTCCCCATTTACATC R: TGTATAGTTCTGTAGGGCATCATGGTAGA F: AGGAAGACATGACCAGGTATGC R: CCAACATCGTGCACATCAAAC F: ACTGTTGGCTTTGTTCTGTCCA R: CAACAGCCACAATGTTGGTCTCTA F: GCACCATTGTCGTGGCTACA R: GCAGGACACCCAGGACCAT F: CAGGTCTGTTGGTCAATCTCACA R: TCCATATCGTGGAATGCTGAAG F: CCAACTGTGCAGGCATAGAA R: TTCTTCCTGGTTCGTGCATT F: TCTGTTGGTGCAAACGATGTT R: GGAGCCGGTGGTTTCAAAT F: GGTGCATGACTGCTTTAACTGG R: CACAAGTCGAGTGATGTGGTG F: AAGACCCAGATTAACGTCACTGT R: GTAGGTCACATTCTTCATGGTCC F: CCATCCAATCGGTAGTAGCG R: GRAACCCGTTGAACCCCATT

154

1.89 ± 0.08

216

1.95 ± 0.1

99

1.89 ± 0.05

198

2 ± 0.05

172

1.9 ± 0.1

78

2 ± 0.1

122

1.87 ± 0.1

65

1.8 ± 0.06

159

1.85 ± 0.07

226

1.83 ± 0.05

101

1.9 ± 0.04

184

1.78 ± 0.03

100

1.85 ± 0.05

68

1.79 ± 0.02

77

1.84 ± 0.06

92

1.78 ± 0.08

111

1.75 ± 0.04

91

1.85 ± 0.07

105

1.9 ± 0.09

151

1.94 ± 0.08

Table 2. siRNA Sequences siRNA name

gene accession no.

gene

sense strand

antisense strand

Hs_SLCO2B1_7 Hs_SLCO2B1_10 Hs_AQP10_4 Hs_SLC34A2_5 Hs_SLC2A5_3

NM_001145211 NM_001145211 NM_080429 NM_001177998 NM_001135585

SLCO2B1 SLCO2B1 AQP10 SLC34A2 SLC2A5

5′-GGAGCAAGAGGGUCUUCUUTT-3′ 5′-CAGGUAUGCUUGUCAUCCATT-3′ 5′-CCGUUGGCACAGCCACUUATT-3′ 5′-GCAUGACCUUCAUCGUACATT-3′ 5′-GAAUCUCCUUGCAAACGUATT-3′

5′-AAGAAGACCCUCUUGCUCCAG-3′ 5′-UGGAUGACAAGCAUACCUGGG-3′ 5′-UAAGUGGCUGUGCCAACGGTG-3′ 5′-UGUACGAUGAAGGUCAUGCCT-3′ 5′-UACGUUUGCAAGGAGAUUCCG-3′

■

visually by observing the effect on a cell death control (All Start HS Cell Death Control siRNA, Qiagen) at different times (2, 4, 6, 24, and 48 h). Control samples with untransfected cells, a mock transfection control with only transfection reagent, and a negative control siRNA without transfection reagent were used. Cellular uptake studies were conducted at 48 h post-transfection for OATPB and AQP10 and 24 h post-transfection for GLUT5 and NaPiIIb. Transfected and control cells were exposed to 10 μM As(III) or 100 μM As(V) for 2 h. Cell retention of arsenic was quantified by hydride generation hyphenated to a cryogenic trap and detection by atomic absorption spectroscopy at pH 1.15

RESULTS

Effect of Potential Inhibitors on Apparent Permeability (Papp) and Cellular Retention of As(III). Apparent permeability is a parameter that evaluates the rate of transport of a solute through the cell monolayer. The Papp coefficient for As(III) was calculated at 60 min because the treatment with Cu2SO4 affects the integrity of the membrane after this time (changes in TEER values greater than 25% of initial value and LY Papp > 0.2 × 10−6 cm/s). Table 3 shows the Papp results and 448



Article

times of 15 min. Both compounds produced a similar reduction in Papp for As(III) (40%). The same trend was observed for cellular uptake, with reductions in As(III) uptake of 57 and 53% for phloridzin and phloretin, respectively. The Papp value for As(III) in the presence of Cu2SO4, an inhibitor of AQP, decreased by 69% in comparison with the value without inhibitor. Similarly, cellular uptake of As(III) decreased by 55% after preincubation with Cu2SO4. Differential Expression of Transporters after Exposure to As(III). The transporters that were selected for differential expression after treatment with As(III) were members of the OATP, GLUT, SLGT, and AQP families. Changes in expression of SGLT1, GLUT1, GLUT2, GLUT5, OATPB, OATPE, AQP1, AQP3, AQP4, and AQP10 were analyzed after exposure to 10 μM As(III) for 24, 48, and 72 h. The levels of expression of the transporters AQP1, GLUT1, and OATPE were very low in the conditions assayed, both in the controls and in the treated samples, and therefore, they were not considered in the evaluation of the differential expression. Figure 1 shows the changes in expression of mRNA after treatments with As(III) at the various times assayed. The results show an up-regulation of GLUT2 and AQP3 at 48 and 72 h. OATPB, GLUT5, AQP10, and AQP4 show an up-regulation at all of the treatment times. For SGLT1, there are no significant changes between the treated samples and the control samples. Because of the importance of efflux transporters in the absorption of compounds, we also studied the differential expression of P-gp, MRP2, MRP3, and BCRP at 24, 48, and 72 h after treatment with 10 μM As(III). The results appear in Figure 1. In general, there is a tendency to down-regulation, except for MRP3, for which there is an up-regulation at 24 and 72 h. Expression of BRCP alters with time; at 24 and 48 h, there is a down-regulation, whereas at 72 h, there is an induction of its expression.

Table 3. Effect of Chemical Inhibition on Apparent Permeability Values (Papp, 60 min) and Cellular Uptake (30 min) of 10 μM As(III) in Caco-2 Cellsa treatment

preincubation Papp (10−6 cm/s)

without inhibitor

cellular uptake (ng As /106 cells)

4.5 ± 0.3

47 ± 7

rifamycin 100 μM

15 min 60 min

2.7 ± 0.3* 1.2 ± 0.3*

n.a. 17 ± 4*

phloridzin 100 μM

15 min 60 min

4.0 ± 0.4 2.7 ± 0.4*

n.a. 22 ± 4*

phloretin 100 μM

15 min

2.7 ± 0.3*

20 ± 3*

CuSO4 100 μM

15 min

1.4 ± 0.3*

21 ± 6*

Values expressed as mean ± standard deviation (n = 6). Significant changes in Papp or cellular uptake with respect to cells without inhibitor are marked with an asterisk (p < 0.05). n.a.: not analyzed. a

cellular uptake values after exposure to As(III) and various combinations of As(III) and inhibitor. After the treatment with rifamycin SV, a substrate of organic anion transporting polypeptides (OATPs), a significant reduction (40%) was observed in the Papp value in comparison with the value obtained for As(III) without inhibitor. The reduction was higher (70%) for longer preincubation times. Cellular retention also decreased significantly (64%). Phloridzin, an inhibitor of sodium dependent glucose transporters (SGLT), and phloretin, an inhibitor of glucose permeases (GLUTs) and aquaporins (AQP), also reduced uptake and transport significantly. Phloridzin needed preincubation times of 60 min to produce significant decreases in the Papp value, whereas phloretin produced a decrease in Papp with preincubation

Figure 1. Relative expression ratio of transporters (2-log scale) of Caco-2 cells treated with As(III) (10 μM) (mean ± standard deviation, n = 8). Bars represent various treatment times: 24 h (black bars); 48 h (light gray bars); 72 h (dark gray bars). Significant differences with respect to controls are marked with an asterisk (p < 0.05). 449



Article

Figure 2. Relative expression ratio of transporters (2-log scale) of Caco-2 cells treated with As(V) (100 μM) (mean ± standard deviation, n = 8). Bars represent various treatment times: 24 h (black bars); 48 h (light gray bars); 72 h (dark gray bars). Significant differences with respect to controls are marked with an asterisk (p < 0.05).

Differential Expression of Transporters after Exposure to As(V). The changes in expression of type II (NaPiIIa and NaPiIIb) and type III (PiT1 and PiT2) phosphate transporters were evaluated. This selection was made on the basis of the data in the literature that implicate these proteins in the transport of As(V).17,18 We also evaluated differential expression of OATPB since earlier studies13 showed that transfection of OATPC into cells of a human embryonic kidney cell line (HEK-293) increased uptake and cytotoxicity of arsenate. Other transporters evaluated were AQP3, AQP4, and AQP10, and also the glucose transporter SGLT1. Figure 2 shows the changes in expression of mRNA after treatments with 100 μM As(V). There is an up-regulation of the NaPiII transporters, which appears at 48 h for NaPiIIa and at 24 and 48 h for NaPiIIb. With regard to the other transporters, for SGLT1, there is a down-regulation at 24 h, whereas for OATPB, AQP3, and AQP10 this effect is observed at 72 h. siRNA Inhibition of Transporter Expression and Effect on Cellular Uptake of Inorganic Arsenic. Figures 3 and 4, respectively, show the changes in expression and percentage of cellular retention of the transfected samples in comparison with the respective controls nontransfected. For the four transporters studied (GLUT5, AQP10, OATPB, and NaPiIIb), there is significant silencing, similar for AQP10, OATPB, and NaPiIIb. For GLUT5, the silencing is greater than for the other genes.

Figure 3. Relative expression ratio of transporters in siRNA transient transfected Caco-2 cells with respect to untransfected Caco-2 cells (2-log scale) (mean ± standard deviation, n = 6). Significant expression changes with respect to untransfected cells are marked with an asterisk (p < 0.05). Gene silencing was evaluated at 24 h (GLUT5 and NaPiIIb) and 48 h (OATPB and AQP10) after transfection. 450



Article

considered an inhibitor of aquaporins.25 The inhibition studies conducted showed reductions in the permeability coefficient of As(III) (40−70%), which implies less transport of this arsenic species across the intestinal monolayer. Previous studies8 showed that the paracellular (across tight junctions) and the transcellular pathways are involved in transport of As(III) across the Caco-2 monolayer. Therefore, reductions in permeability might be due to an effect of inhibitors on cell junctions and/or on transcellular mechanisms. A decrease in paracellular transport of As(III) caused by an effect of inhibitors is not very likely because the TEER and the LY Papp values, indicators of membrane integrity, remained stable in the various treatments. Moreover, there was a significant reduction (53− 64%) in As(III) cellular accumulation in the presence of these inhibitors, indicating a decrease in transcellular transport of this species. For the GLUT, AQP, and OATP studied, there was overexpression after exposure to As(III) and a reduction in Papp and cellular accumulation when they were blocked. For SGLT1, however, no significant changes were observed in expression, but chemical inhibition significantly reduced cellular uptake and transport of As(III). This might be due to the processes of regulation of this transporter, in which changes in expression are not as important as the processes of exo- and endocytosis of proteins synthesized in intracellular vesicles.26 Since the effects of the inhibitors are not totally specific, we conducted gene interference studies to confirm the results obtained. These studies concentrated on the up-regulated transporters that are targeted to the apical membrane of intestinal epithelial cells, GLUT5, AQP10, and OATPB,27−29 and that are therefore more closely related with absorption processes. Although the gene silencing studies were conducted on undifferentiated cells and there may be differences in gene expression profile between differentiated and undifferentiated Caco-2, the data obtained indicate that silencing of these genes produces a significant reduction in uptake of As(III). These data combined with those obtained from the chemical inhibition assays suggest that these transporters are involved in transcellular transport of As(III). These transporters function as bidirectional carriers,30−32 and therefore they might favor entry of As(III) from the intestinal lumen and also a process of cellular elimination. Moreover, the present study showed that exposure to As(III) generates up-regulation of other transporters belonging to families whose chemical inhibition, as we have shown, affects As(III) permeability. This is the case with GLUT2, AQP3, and AQP4, which are located on the basolateral side of enterocytes.33,34 More tests are needed to confirm their participation in transport of As(III), which would mean the pass of As(III) from inside the intestinal epithelium to the blood or vice versa since they are also bidirectional carriers. In the studies of differential expression after exposure to As(III), we also evaluated the transporters that, according to the literature, might participate in its cellular extrusion, such as ABC transporters. The present study showed a downregulation of P-glycoprotein and MRP2 at various As(III) exposure times, contrary to what has been reported. Liu et al.35 showed an increase in expression of MRP1, MRP2, and P-glycoprotein in rat hepatocytes chronically exposed to As(III). Drobná et al.36 observed a positive correlation between protein expression levels of MRP2 and efflux of iAs in primary cultures of human hepatocytes.

Figure 4. Percentage of arsenic cellular uptake in Caco-2 cells [two hours of exposure to 10 μM As(III) for OATPB, GLUT5, and AQP10 or 100 μM As(V) for NaPiIIb] after siRNA transient transfection with respect to control cells (mean ± standard deviation, n = 6). Significant differences are marked with an asterisk (p < 0.05).

The silencing of GLUT5, AQP10, and OATPB causes a similar reduction in cellular accumulation of As(III) (57−59%). Silencing of the NaPiIIb gene causes a reduction of more than 80% in cellular retention of As(V).

■

DISCUSSION Intestinal absorption of iAs and the aspects related have not been studied in detail. Existing studies of cellular uptake of iAs have identified various transporters that are involved in this process. Using oocytes of Xenopus laevis, Liu et al. 10,12 showed that AQP7, AQP9, and GLUT1 facilitate permeability of arsenic trioxide. Shinkai et al.19 and Torres-Á vila et al.11 described the contribution of AQP9 to the entry of iAs into murine liver. Lu et al.13 showed the participation of OATPC in the entry of As(III) and As(V) in transfected HEK-293. However, none of these studies refer to intestinal cells or models that reproduce the intestinal epithelium. Caco-2 cells are a good model for studying intestinal transport because it expresses many transporters present in the human small intestine.20 In the present work, the studies of expression in Caco-2 concentrated on the major intestinal isoforms of glucose transporters, OATPs, and AQPs. The results obtained show that most of the isoforms initially selected are expressed in the clone of Caco-2 employed and that exposure to 10 μM As(III) induces expression of OATPB, AQP3, AQP4, AQP10, GLUT2, and GLUT5. In order to clarify the possible participation of these transporters in intestinal absorption of As(III), we conducted studies of chemical inhibition and gene silencing. To study chemical inhibition, we used phloridzin, phloretin, rifamycin SV, and copper sulfate. Phloridzin inhibits human sodium-glucose symporters (SGLT1 and SGLT2),21 whereas phloretin blocks GLUT transporters22 and aquaporins.23 Rifamycin SV is a substrate of organic anion transporters,24 and copper sulfate is 451



Article

the induction by iAs exposure of GLUT5, AQP10, OATPB, and NaPiIIb, identified in the present study as possible transporters of As(III) and As(V), would imply that exposure to these species acts by facilitating their own intestinal permeability. Moreover, the up- and down-regulations observed may involve changes in the absorption of substances that use these transporters, which in most cases are essential nutrients.

Treatment of the Caco-2 cell line with As(III) was accompanied by an increase in expression of MRP3 at 24 and 72 h. This transporter has been described in other studies as a possible transporter of GSH complexes with trivalent arsenicals from the liver to the blood.36 There was also an increase in expression of the transporter BCRP after 72 h of exposure to As(III). There are no reports of participation of BCRP in cellular extrusion of iAs, although changes have been observed in its expression during the process of transformation of stem cells to cancer stem cells by exposure to As(III).37 The localization in the intestine of the efflux transporters assayed is also polarized. P-glycoprotein, MRP2, and BCRP expression is highest at the brush border membrane, where absorption takes place.38 MRP3, however, is localized in the basolateral membrane.39 The increase in the expression of MRP3 at 24 h induced by As(III) would facilitate its entry into the systemic circulation, while the down-regulation of efflux transporters localized in the apical membrane (24 h) would make it more difficult to eliminate it toward the intestinal lumen, thus favoring the absorption process. In view of the importance of efflux in As(III) toxicity, more studies are needed to confirm the participation of these transporters, especially BCRP and MRP3, in the extrusion of As(III) from intestinal epithelial cells. In this study, we also evaluated the effect of As(V) on expression of transporters in Caco-2 cells and the effect of silencing of NaPiIIb on As(V) uptake. Previous studies suggest the participation of inorganic phosphate transporters in cellular uptake of this arsenic species.17 It has been shown that there is inhibition of transport of As(V) in the presence of inorganic phosphate and vice versa in various models.14,7 Beene et al.17 showed that a type II phosphate transporter in zebrafish, NaPiIIb1, can transport arsenate in vitro when expressed in Xenopus laevis and that there is a correlation between tissues where NaPiIIb1 is expressed and accumulation of arsenic. The gene interference studies that we conducted show a reduction of over 80% in cellular retention of As(V) after partial silencing of NaPiIIb, which suggests its participation in intestinal absorption of As(V). The expression results demonstrate overexpression of phosphate transporters after 24 h of exposure to 100 μM As(V), with the induction of NaPiIIb being especially notable. Studies exist that indicate various processes of regulation of activity of the Na-Pi cotransporter at intestinal level. For instance, when rodents are fed with a low-phosphate diet, an increase in activity of this transporter is reported.40,41 Beene et al.17 suggested that the nutrient level of phosphate could greatly impact the toxicity of ingested arsenate, indicating that if physiological phosphate is not sufficiently high, arsenate could be transported into the cell via sodium-dependent phosphate transporters. This effect would be especially important in physiological situations characterized by high phosphate demands, such as growth, pregnancy, and lactation, since increased As(V) uptake could occur in phases where the deleterious effects of iAs are particularly notorious. Another effect that became evident after exposure of the Caco-2 cells to As(V) was down-regulation of SGLT1, OATPB, AQP3, AQP4, and AQP10. This effect, like the other changes in expression induced by As(III) and As(V), might be the result of complex cell responses. In view of the large number of cell signaling pathways that might be affected by iAs,42 more studies are needed to clarify the mechanisms that produce these transcription regulation processes, which ultimately lead to changes in transporter expression. Finally, it must not be forgotten that

■

AUTHOR INFORMATION

Corresponding Author

*Tel: (+34) 963 900 022. Fax (+34) 963 636 301. E-mail: [email protected]. Funding

This work was supported by the Spanish Ministry of Science and Innovation (AGL2009-10100) for which we are deeply indebted. M.C. received a Personnel Training Grant from the Spanish Ministry of Science and Education, in order to carry out this study.

■

REFERENCES

(1) IARC (International Agency for Cancer Research). (2004) IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. Overall Evaluations of Carcinogenicity: An Updating of IARC Monographs, Vol. 84, p 39. (2) EFSA (2009). Scientific Opinion on Arsenic in Food. EFSA Panel on Contaminants in the Food Chain (CONTAM), Vol. 10, p 1351, European Food Safety Authority (EFSA), Parma, Italy. (3) Styblo, M., Del Razo, L. M., Vega, L., Germolec, D. R., LeCluyse, E. L., Hamilton, G. A., Reed, W., Wang, C., Cullen, W. R., and Thomas, D. J. (2000) Comparative toxicity of trivalent and pentavalent inorganic and methylated arsenicals in rat and human cells. Arch. Toxicol. 74, 289−299. (4) Dopp, E., von Recklinghausen, U., Diaz-Bone, R., Hirner, A. V., and Rettenmeier, A. W. (2010) Cellular uptake, subcellular distribution and toxicity of arsenic compounds in methylating and non-methylating cells. Environ. Res. 110, 435−442. (5) Kenyon, E. M., Del Razo, L. M., and Hughes, M. F. (2005) Tissue distribution and urinary excretion of inorganic arsenic and its methylated metabolites in mice following acute administration of arsenate. Toxicol. Sci. 85, 468−475. (6) Juhasz, A. L., Smith, E., Weber, J., Rees, M., Rofe, A., Kuchel, T., Sansom, L., and Naidu, R. (2006) In vivo assessment of arsenic bioavailability in rice and its significance for human health risk assessment. Environ. Health Perspect. 114, 1826−1831. (7) Calatayud, M., Gimeno, J., Vélez, D., Devesa, V., and Montoro, R. (2010) Characterization of the intestinal absorption of arsenate, monomethylarsonic acid, and dimethylarsinic acid using the Caco-2 cell line. Chem. Res. Toxicol. 23, 547−556. (8) Calatayud, M., Devesa, V., Montoro, R., and Vélez, D. (2011) In vitro study of intestinal transport of arsenite, monomethylarsonous acid, and dimethylarsinous acid by Caco-2 cell line. Toxicol. Lett. 204, 127−133. (9) Laparra, J. M., Vélez, D., Barberá, R., Montoro, R., and Farré, R. (2005) An approach to As(III) and As(V) bioavailability studies with caco-2 cells. Toxicol. in Vitro 19, 1071−1078. (10) Liu, Z., Shen, J., Carbrey, J. M., Mukhopadhyay, R., Agre, P., and Rosen, B. P. (2002) Arsenite transport by mammalian aquaglyceroporins AQP7 and AQP9. Proc. Natl. Acad. Sci. U.S.A. 99, 6053−6058. (11) Torres-Á vila, M., Leal-Galicia, P., Sánchez-Peña, L. C., Del Razo, L. M., and Gonsebatt, M. E. (2010) Arsenite induces aquaglyceroporin 9 expression in murine livers. Environ. Res. 110, 443−447. (12) Liu, Z., Sanchez, M. A., Jiang, X., Boles, E., Landfear, S. M., and Rosen, B. P. (2006) Mammalian glucose permease GLUT1 facilitates transport of arsenic trioxide and methylarsonous acid. Biochem. Biophys. Res. Commun. 351, 424−430.

452



Article

(13) Lu, W., Tamai, I., Nezu, J., Lai, M., and Huang, J. (2006) Organic anion transporting polypeptide-C mediates arsenic uptake in HEK-293 cells. J. Biomed. Sci. 13, 525−353. (14) Villa-Bellosta, R., and Sorribas, V. (2008) Role of rat sodium/ phosphate cotransporters in the cell membrane transport of arsenate. Toxicol. Appl. Pharmacol. 232, 125−134. (15) Devesa, V., Del Razo, L. M., Adair, B., Drobna, Z., Waters, S. B., Hughes, M. F., Styblo, M., and Thomas, D. J. (2004) Comprehensive analysis of arsenic metabolites by pH-specific hydride generation atomic absorption spectrometry. J. Anal. At. Spectrom. 19, 1460−1467. (16) Uduehi, A. N., Moss, S. H., Nutall, J., and Pouton, C. W. (1999) Cationic lipid-mediated transfection of differentiated Caco-2 cells: a filter culture model of gene delivery to a polarized epithelium. Pharm. Res. 16, 1805−1811. (17) Beene, L. C., Halluer, J., Yoshinaga, M., Hamdi, M., and Liu, Z. (2011) Pentavalent arsenate transport by zebrafish phosphate transporter NaPi-IIb1. Zebrafish 8 (3), 125−131. (18) Villa-Bellosta, R., and Sorribas, V. (2010) Arsenate transport by sodium/phosphate cotransporter type IIb. Toxicol. Appl. Pharmacol. 247, 36−40. (19) Shinkai, Y., Sumi, D., Toyama, T., Kaji, T., and Kumagai, Y. (2009) Role of aquaporin 9 in cellular accumulation of arsenic and its cytotoxicity in primary mouse hepatocytes. Toxicol. Appl. Pharmacol. 237, 232−236. (20) Lenaerts, K., Bouwman, F. K., Lamers, W. H., Renes, J., and Mariman, E. C. (2007) Comparative proteomic analysis of cell lines and scrapings of the human intestinal epithelium. BMC Genomics 8, 91. (21) Hirayama, B. A., Lostao, M. P., Panayotova-Heiermann, M., Loo, D. D. F., Turk, E., and Wright, E. M. (1996) Kinetic and specificity differences between rat, human, and rabbit Na+- glucose cotransporters (SGLT-1). Am. J. Physiol. Gastrointest. Liver Physiol. 270, G919−926. (22) Haddoub, R., Rützler, M., Robin, A., and Flitsch, S. L. (2009) Design, synthesis and assaying of potential aquaporin inhibitors. Handb. Exp. Pharmacol. 190, 385−402. (23) Kwon, O., Eck, P., Chen, S., Corpe, C. P., Lee, J., Kruhlak, M., and Levine, M. (2007) Inhibition of the intestinal glucose transporter GLUT2 by flavonoids. FASEB J. 21, 366−377. (24) Vavricka, S. R., Van Montfoort, J., Ha, H. R., Meier, P. J., and Fattinger, K. (2002) Interactions of rifamycin SV and rifampicin with organic anion uptake systems of human liver. Hepatology 36, 164−172. (25) Zelenina, M., Tritto, S., Bondar, A. A., Zelenin, S., and Aperia, A. (2004) Copper inhibits the water and glycerol permeability of aquaporin-3. J. Biol. Chem. 279, 51939−51943. (26) Wright, E. M., Hirsch, J. R., Loo, D. D. F., and Zampighi, G. A. (1997) Regulation of Na+/glucose cotransporters. J. Exp. Biol. 200, 287−293. (27) Davidson, N. O., Hausman, A. M. L., Ifkovits, C. A., Buse, J. B., Gould, G. W., Burant, C. F., and Bell, G. I. (1992) Human intestinal glucose transporter expression and localization of GLUT5. Am. J. Physiol. 262, C795−800. (28) Mobasheri, A., Shakibaei, M., and Marples, D. (2004) Immunohistochemical localization of aquaporin 10 in the apical membranes of the human ileum: A potential pathway for luminal water and small solute absorption. Histochem. Cell Biol. 121, 463−471. (29) Sai, Y., Kaneko, Y., Ito, S., Mitsuoka, K., Kato, Y., Tamai, I., Artursson, P., and Tsuji, A. (2006) Predominant contribution of organic anion transporting polypeptide OATP-B (OATP2B1) to apical uptake of estrone-3-sulfate by human intestinal Caco-2 cells. Drug Metab. Dispos. 34, 1423−1431. (30) Bell, G. I., Burant, C. F., Takeda, J., and Gould, G. W. (1993) Structure and function of mammalian facilitative sugar transporters. J. Biol. Chem. 268, 19161−19164. (31) Verkman, A. S., and Mitra, A. K. (2000) Structure and function of aquaporin water channel. Am. J. Physiol. Renal Physiol. 278, F13− F28. (32) Mahagita, C., Grassl, S. M., Piyachaturawat, P., and Ballatori, N. (2007) Human organic anion transporter 1B1 and 1B3 function as

bidirectional carriers and do not mediate GSH-bile acid cotransport. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G271−G278. (33) Cheeseman, C. I. (1993) GLUT2 is the transporter for fructose across the rat intestinal basolateral membrane. Gastroenterology 105, 1050−1056. (34) Koyama, Y., Yamamoto, T., Tani, T., Nihei, K., Kondo, D., Funaki., H., Yaoita, E., Kawasaki, K., Sato, N., Hatakeyama, K., and Kihara, I. (1999) Expression and localization of aquaporins in rat gastrointestinal tract. Am. J. Physiol. Cell Physiol. 276, C621−627. (35) Liu, J., Chen, H., Miller, D. S., Saavedra, J. E., Keefer, L. K., Johnson, D. R., Klaassen, C. D., and Waalkes, M. P. (2001) Overexpression of glutathione S-transferase II and multidrug resistance transport proteins is associated with acquired tolerance to inorganic arsenic. Mol. Pharmacol. 60, 302−309. (36) Drobná, Z., Walton, F. S., Paul, D. S., Xing, W., Thomas, D. J., and Stýblo, M. (2010) Metabolism of arsenic in human liver: The role of membrane transporters. Arch. Toxicol. 84, 3−16. (37) Tokar, E. J., Diwan, B. A., and Waalkes, M. P. (2010) Arsenic exposure transforms human epithelial stem/progenitor cells into a cancer stem-like phenotype. Environ. Health Perspect. 118, 108−115. (38) Ito, K., Suzuki, H., Horie, T., and Sugiyama, Y. (2005) Apical/ basolateral surface expression of drug transporters and its role in vectorial drug transport. Pharm. Res. 22, 1559−1577. (39) Yokooji, T., Murakami, T., Yumoto, R., Nagai, J., and Takano, M. (2007) Site-specific bidirectional efflux of 2,4-dinitrophenyl-Sglutathione, a substrate of multidrug resistance-associated proteins, in rat intestine and Caco-2 cells. J. Pharm. Pharmacol. 59, 513−520. (40) Hattenhauer, O., Traebert, M., Murer, H., and Biber, J. (1999) Regulation of small intestinal Na-P(i) type IIb cotransporter by dietary phosphate intake. Am. J. Physiol. Gastrointest. Liver Physiol. 277, G756−762. (41) Takeda, E., Taketani, Y., Morita, K., Tatsumi, S., Katai, K., Nii, T., Yamamoto, H., and Miyamoto, K. (2000) Molecular mechanisms of mammalian inorganic phosphate homeostasis. Adv. Enzyme Regul. 40, 285−302. (42) Flora, S. J. S. (2011) Arsenic-induced oxidative stress and its reversibility. FRBM 51, 257−281.

453


In Vitro Study of Transporters Involved in Intestinal Absorption of

Recommend Documents