Subscriber access provided by UNIV OF CAMBRIDGE
Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein Jing Zhu, Haiying Gan, Jie Wu, and Huangxian Ju Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b01217 • Publication Date (Web): 04 Apr 2018 Downloaded from http://pubs.acs.org on April 4, 2018
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein Jing Zhu, Haiying Gan, Jie Wu, and Huangxian Ju* State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023, P. R. China
Keywords: Electrochemical sensor; Signal amplification; Molecular machine; Surface programmatic chain reaction; Proximity-dependent hybridization; Strand displacement
______________________________ * Corresponding author. Phone/Fax: +86-25-89683593. E-mail:
[email protected] 1
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ABSTRACT: A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought electrochemical signal molecule Fc close to the electrode, and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structure of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.
2
ACS Paragon Plus Environment
Page 2 of 25
Page 3 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Inspired by molecular machines in living system, a variety of artificial molecular machines have recently been designed to perform precise cargo transport or biosynthesis. Due to the simplicity and programmable ability of nucleotide assembly, DNA-based molecular machines have well been developed. Different types of DNA molecular machines including DNA walkers,1,2 tweezers,3 spiders,4 and gears5 have been constructed and applied for organic synthesis,6 molecular transporter7,8 and molecular imaging.9 Typically, DNA molecular machines make use of DNA footpaths,6,10 DNA origami,4,8,11 or DNA-Au nanoparticle12,13 tracks to guide their movements following a burnt-bridge mechanism, which leads to programmatic DNA assembly by toehold-mediated strand displacement1,2,8,14,15 or DNAzyme/nuclease-mediated hydrolysis of the fuel strand.12,16,17 Recently, the design of swing arm-based DNA molecular machines has attracted considerable attention in biosensing13,18-20 and intercellular molecular imaging9 fields. In these DNA machines, the DNA tracks are normally constructed on nanoparticle surfaces functionalized with high ratio of signal oligonucleotides and affinity ligands. Through a target-based affinity reaction, the DNA swing arm is brought to the nanoparticle surface and swings autonomously along the surface via enzymatic cleavage13,16 or displacement hybridization21 to circularly release signal oligonucleotides. Swing arm-based DNA machine has also been used to construct sensitive electrochemical aptasensors via specific target binding and endonuclease-powered swing movement on electrode surface.16,22 However, as the swing arm-based DNA machine is tethered on the affinity ligand, it can only swing along a certain area nearby its foothold, which limits sensitivity improvement of electrochemical biosensors. To overcome this drawback, a molecular machine-based amplification has been designed on a three-stranded DNA complexes modified electrode for amplified electrochemical sensing of protein.23 Here a surface programmatic chain reaction (SPCR) triggered with bipedal molecular machine (BMM) via proximity-dependent hybridization 3
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 25
(PDH) is proposed on a sensing surface modified with accurately designed hairpin DNA to develop a novel amplification strategy for highly sensitive electrochemical biosensing. PDH has been extensively used for protein detection24,25 via the recognition of antibody or aptamer to targets to bring the tail DNA pairs into close proximity.26-28 Compared with conventional protein assays, PDH-based assays/biosensors are simpler and faster because they take the simplicity and variousness of DNA assembly to achieve one-step protein detection. In addition, by combining with DNA-based signal amplification strategies, such as polymerase
chain
reaction,29
rolling
amplification,30
circle
exonuclease/endonuclease-mediated cycle amplification,31,32 hybridization chain reaction,33 and catalytic hairpin assembly,34 the sensitivity of these PDH-based assays/biosensors is also guaranteed. Here, the SPCR was achieved on an electrochemical biosensor that was fabricated by the self-assembly of hairpin DNA 1 (H1) on gold electrode surface (Figure 1). Upon the mixing of target protein with two DNA-based affinity probes (P1 and P2), the BMM was firstly formed through aptamer-target specific recognition. The formed BMM could hybridize with the surface-tethered H1 to expose its prelocked toehold domain for subsequent
hybridization
with
ferrocene-labeled
hairpin
DNA
2
(H2-Fc)
via
toehold-mediated strand displacement, resulting in the attachment of H2-Fc on electrode and the release of BMM. The free BMM could then be recycled for continuous operation of SPCR and eventually traverse the sensing surface, along with the introduction of a large number of H2-Fc onto the electrode surface for signal amplification and sensitive detection of target. In principle, the proposed electrochemical sensing protocol was particularly simple due to the one-incubation and enzyme-free design. Different from previous DNA machine-based electrochemical signal-off detection,16,17 the proposed signal-on sensing platform showed superior sensitivity with a detection limit at sub-pM level for thrombin. Moreover, this strategy possessed very good extensibility by using corresponding 4
ACS Paragon Plus Environment
Page 5 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
DNA-based affinity probes to recognize the targets for formation of BMM, indicating its promising application in biosensing.
EXPERIMENTAL SECTION Materials and Reagents. Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), 6-mercapto-1-hexanol (MCH), hexaammineruthenium (III) chloride (RuHex) and thrombin were obtained from Sigma-Aldrich (St. Louis, MO, USA). Carcinoembryonic antigen (CEA), prostate specific antigen (PSA) and α-fetoprotein (AFP) were purchased from Keybiotech Co. Ltd. (Beijing, China). Ultrapure water obtained from a Millipore water purification system (≥ 18 MΩ, Milli-Q, Millipore) was used in the whole assay. Tris-HCl buffer (20 mM, pH 7.4) contained 140 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2. The serum samples were from Jiangsu Cancer Hospital and stored at -20 °C before use. All oligonucleotides were synthesized by Sangon Biotechnology Co. Ltd. (Shanghai, China) and their sequences were listed as following (from 5’ to 3’): H1: HS-GTCAGTGA GCTAGGTTAGATGTCG CCATGTGTAGA CGACATCTAA CCTAGC H2-Fc: AGATGTCG TCTACACATGG CGACATCTAACCTAGC CCATGTGTAGA -Fc P1: GGTTGGTGTGGTTGG (T)n CGACATCTAACCTAGCTCA P2:AGTCCGTGGTAGGGCAGGTTGGGGTGACT (T)n CGACATCTAACCTAGCTCA Here n represents 5, 10, 15 and 20, and the stem regions of H1 and H2-Fc and aptamer bases for thrombin recognition are shown in italics and bold, respectively. Apparatus.
Electrochemical
measurements
were
performed
on
a
CHI
660D
electrochemical workstation (CH Instruments Inc., USA) at room temperature with a conventional three-electrode system composed of a platinum wire as counter, Ag/AgCl as reference and the AuE with 2 mm diameter as working electrodes. Electrochemical impedance spectroscopic (EIS) measurements were carried out on a PGSTAT 12 system 5
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
(Autolab, the Netherlands). Fabrication of Electrochemical Sensor. Gold electrode was treated according to previous procedure.35 Briefly, after it was immersed in freshly prepared piranha solution (H2SO4/H2O2, 3:1) for 30 min and sonicated successively in water, ethanol and water, the electrode was carefully polished with a mirror surface with 0.05 µm diameter alumina slurry. Then this electrode was electrochemically activated by scanning the potential from -0.2 to +1.6 V in 0.5 M H2SO4 at a scan rate of 0.1 V s-1 for 40 cycles. The cleaned electrode was thoroughly washed with water and dried under flowing nitrogen. After H1 (10 µM) was annealed at 95 oC for 5 min and slowly cooled down to room temperature, equal volumes of annealed H1 (10 µM) and TCEP (1 mM) were mixed for 1 h to reduce disulfide bonds, following a dilution with Tris-HCl buffer to get H1 at 0.3 µM. 6 µL of H1 (0.3 µM) was then dropped on electrode surface to incubate at 37 oC for 2 h. After rinsing with 10 mM PBS (pH 7.4, 0.1 M NaCl) and drying with nitrogen, 6 µL of MCH (1 mM) was dropped on electrode to incubate for 1 h for blocking the unmodified sites. After washing with PBS and drying with nitrogen, the electrochemical biosensor was obtained and stored at 4 oC before use. Measurement Procedure. Prior to measurement, a mixture of 50 nM P1, 50 nM P2, 0.8 µM H2-Fc, and various concentrations of thrombin in Tris-HCl buffer was prepared and incubated for 15 min at room temperature. 6 µL of the mixture was dropped on the biosensor surface to incubate for 80 min at room temperature. After washing with 10 mM PBS (pH 7.4), the electrochemical biosensor was immersed in 10 mM PBS (pH 7.4) containing 0.1 M NaClO4 for alternating current voltammetric (ACV) detection from 0 to +0.6 V with a step potential of 4 mV, a frequency of 25 Hz and an amplitude of 25 mV, which was reported to be an efficient method to obtain extremely small voltammetric signal of ferrocene on electrode.36 Chronocoulometric (CC) measurements were carried out at a pulse period of 500 6
ACS Paragon Plus Environment
Page 6 of 25
Page 7 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
ms and pulse width of 700 mV in 10 mM Tris-HCl buffer containing 50 µM RuHex.
RESULTS AND DISCUSSION Principle of BMM Powered SPCR. This work constructed a sensitive and simple electrochemical biosensing platform for protein detection through the BMM powered SPCR for signal amplification. Two hairpin DNA (H1 and H2-Fc) along with two DNA-based affinity probes (P1 and P2) were used to perform target recognition and signal amplification (Figure 1). H1 was self-assembled on electrode surface through Au–thiol bond for preparation of electrochemical sensing interface, and kinetically locked H2-Fc could not react with H1. Both probes were designed to comprise three functional regions: the aptamer region (Apt15 in P1 and Apt29 in P2) for thrombin binding to form BMM, the T15 poly (T) spacer for avoiding steric hindrance during proximity-dependent hybridization, and the 19-nt tail sequence for BMM hybridization with the surface-tethered H1. Here, P1 and P2 could not open H1 directly because their tail sequences contained only 3 complementary bases longer than the stem fragment of H1. However, in the presence of thrombin, the BMM was formed through the simultaneous binding of P1 and P2 to one thrombin, resulting in the close proximity of the tail sequences to allow the hybridization of BMM with the surface-tethered H1,23,37 which exposed the prelocked toehold domain of H1 for subsequent hybridization with H2-Fc. Through the toehold-mediated displacement reaction, H2-Fc displaced the tail sequence to associate to H1, making the ferrocene label close to electrode surface and “turning on” the electrochemical signal. Meanwhile, the released BMM migrated to the neighboring H1 to perform continuous SPCR. In principle, one BMM could traverse the whole sensing surface and open all H1 on the electrode to associate with H2-Fc via the proposed SPCR. Owning to the one-to-all (one target to all reactants on sensing surface) amplification, a large number of H2-Fc were eventually captured onto the electrode surface 7
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
through the BMM powered SPCR strategy for signal amplification and sensitive detection of target protein. Characterization and Feasibility of Electrochemical Sensing Platform. EIS measurements were performed in 0.1 M KCl containing 5 mM K3Fe(CN)6 and K4Fe(CN)6 to characterize the preparation and assay application of electrochemical biosensor (Figure 2A). The bare electrode showed a relatively small electron transfer resistance (Ret) (curve a) due to its fast charge-transfer process. After its modification with H1, Ret greatly increased (curve b) because negative-charged phosphate skeletons of H1 monolayer repelled [Fe(CN)6]3-/4- from the electrode surface. The surface blocking with MCH further increased the Ret (curve c) owing to the inaccessibility created by MCH, suggesting the successful preparation of the electrochemical biosensor. The Ret slightly changed after the biosensor was incubated with the mixture of P1, P2 and H2-Fc (curve d), indicating neither the tail sequences of P1&P2 nor H2-Fc could hybridize directly with H1. However, in the presence of target protein, Ret was enhanced greatly (curve e) due to the formation of BMM, which triggered the SPCR for hybridization of H2-Fc with H1 on the electrode surface. The feasibility of the electrochemical biosensing of thrombin was demonstrated by measuring ACV responses under different conditions (Figure 2B). When the biosensor was incubated with Tris-HCl buffer, an ideal background was observed (curve a). In the absence of thrombin, either H2-Fc (curve b) or the mixture of P1, P2 and H2-Fc (curve c) showed negligible response, indicating none of H2-Fc, P1 and P2 hybridized directly with H1. However, in the presence of 1 nM thrombin, 10- and 80-min incubation led to significant response (curve d and e), indicating the formation of BMM to trigger the SPCR for the attachment of H2-Fc. Moreover, the response of 80-min reaction (curve e) was much bigger than that of 10-min reaction (curve d), suggesting the BMM successively migrated on the electrode to open H1 and hybridize with H2-Fc. These results indicated that the SPCR could 8
ACS Paragon Plus Environment
Page 8 of 25
Page 9 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
only be triggered by the BMM formed by specific binding of thrombin with P1 and P2 to produce the amplified electrochemical signal for sensitive detection. Optimization of Experimental Conditions. To achieve the best performance of the electrochemical biosensor, some key experimental parameters were optimized. The density of H1 immobilized on the electrode was firstly studied by controlling the concentration of H1 added on the electrode surface. Neither high nor low density was conducive to the hybridization of BMM to H1, because the low density suppressed the proximity-dependent hybridization and the high density produced steric hindrance to inhibit the reaction (Figure 3A). 0.3 µM H1 was selected as the optimized concentration for the fabrication of electrochemical biosensor. The density of H1 immobilized on the sensor surface was estimated via CC measurements using RuHex as a redox marker (Figure 3B). According to Cottrell equation and Faraday's law:38,39 ௧ భ
Q = 2FnACb( )మ + Qc+ nFA߁ గ
(1)
where F is the Faraday constant (96 487 coulombs per equivalent), n is the number of electrons involved in electrode reaction, A is the electrode area (cm2), Cb is the bulk concentration of RuHex (mol cm-3), D is its diffusion coefficient (cm2 s-1), t is the time (s), Qc is the capacitive charge (coulomb), and ߁ is the quantity of the adsorbed RuHex (mol cm-2). The saturated surface excess of RuHex could be calculated and converted to the surface density of DNA probe: ௭
߁ DNA = ߁ ( ) (NA)
(2)
where ߁ DNA is the probe density (molecules cm-2), m is the number of bases of DNA probe, z is the charge of the redox molecule (for RuHex, z is 3), and NA is Avogadro’s number. The density of H1 on biosensor surface was 2.5×1012 molecules per cm2, and the average intermolecular spacing was calculated to be 6.4 nm. This density of H1 was not high enough 9
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
to produce steric hindrance to inhibit the reaction between BMM and H1.40 The spacer lengths of P1 and P2 were also optimized to gain the best performance of BMM (Figure 3C). They should be longer than the average intermolecular spacing of H1 (6.4 nm). Thus, the current response increased sharply before the spacer length of 10T (according to a freedom of ~6.8 nm for BMM) and reached a maximum value at 15T (according to a freedom of ~10.2 nm for BMM). This result indicated the spacer length of 15T was enough for BMM to avoid steric hindrance and simultaneously hybrid with two H1, which was thus selected for P1 and P2. In principle, one BMM could open all H1 on the electrode to associate with H2-Fc by taking a relatively long reaction time. Thus, the time of BMM powered SPCR was investigated. As shown in Figure 3D, the signal response increased with the prolonging of reaction time and reached a plateau after incubation for 80 min. Therefore, a reaction time of 80 min was chosen for BMM powered SPCR. Furthermore, the concentration of H2-Fc was also optimized to be 0.8 µM for achieving high analytical performance of this sensing system (Figure 3E). Assay Performance. The analytical performance of the proposed electrochemical assay using BMM powered SPCR was investigated under optimal experimental conditions. As shown in Figure 4A, the ACV response rose up as the concentration of thrombin increased. The plot of the response vs the logarithm of thrombin concentration showed good linearity in the range from 2 pM to 20 nM following the linear regression equation of I = 31.58 log C + 8.78 with a correlation coefficient of 0.9968 (Figure 4B). The detection limit was calculated to be 0.76 pM corresponding to the signal of blank plus 3 times standard deviation (SD). Benefitting from the wonderful amplification ability of BMM powered SPCR, this detection limit was superior to those of other electrochemical sensing methods, for example, 130 times lower than the aptasensor using exonuclease for background reduction and hemin for direct 10
ACS Paragon Plus Environment
Page 10 of 25
Page 11 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
electron transfer,41 7 times lower than the electrochemical aptasensor integrating with proximity binding and metal ion-dependent DNAzyme recycling amplification,42 6 times lower than the electrochemical impedimetric sensor based on poly(pyrrole-nitrilotriacetic acid)-aptamer film,43 and 3 times lower than those using swing arm-based DNA machine16 and
proximity
binding-triggered
molecular
machine23
for
electrochemical
signal
amplification. The reproducibility was tested by detecting 1.0 nM thrombin with five biosensors. The relative standard deviation of the five duplicate measurements was 4.2%, suggesting good reproducibility of the proposed electrochemical biosensor. The stability of the biosensor was challenged by storing it in 4 oC for 14 days. The biosensor still retained 94.6% of its initial response to 1 nM thrombin, indicating a robust stability of the biosensor. To evaluate the specificity of the assay, non-target proteins including AFP, CEA, and PSA at 10-fold concentration were employed as interfering substances. As expected, except the target protein thrombin, none of the interferents gave rise to response compared with the blank (Figure 5). This result indicated the proposed assay exhibited excellent detection specificity towards target protein, suggesting the assay possessed good validity and reliability. Furthermore, recovery tests were performed to test the applicability of the biosensor for detecting thrombin in physiological environment. Four different concentrations of thrombin were spiked in 10-fold diluted healthy serum to sever as samples. As listed in Table 1, the range of the recovery for thrombin was from 95.95% to 103.6%, and the RSDs were between 2.96% and 6.20%. These results indicated that the proposed biosensor along with BMM powered SPCR had potential applications for detection of proteins in clinical samples.
CONCLUSION 11
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
A simple and sensitive electrochemical sensing platform has been developed for protein detection by employing a designed BMM powered SPCR for signal amplification. By means of the proximity-dependent hybridization and toehold-mediated strand displacement, the target-induced BMM operates the SPCR to successively open surface-tethered H1 and capture H2-Fc on electrode surface, generating an amplified electrochemical signal. Theoretically, one BMM can traverse the whole biosensing surface to open all H1, and the one-to-all amplification endows the assay with high detection sensitivity and provides a detection limit down to sub-pM level. In addition, the assay is enzyme-free and uses fully the DNA-based assembly for signal read-out of protein recognition, making it simple and cost-efficient for clinical application. Moreover, the biosensing platform can be conveniently extended to detect a variety of proteins by using corresponding aptamer or antibody-DNA pairs. Overall, the proposed assay integrating the BMM powered SPCR is simple, sensitive, selective and universal for protein detection, indicating potential application in bioanalysis.
AUTHOR INFORMATION Corresponding Authors *Phone/Fax: +86-25-89683593. E-mail:
[email protected]. ORCID Huangxian Ju: 0000-0002-6741-5302 Notes The authors declare no competing financial interest.
ACKNOWLEDGMENTS This work was supported by National Natural Science Foundation of China (21635005, 21575063, and 21361162002). 12
ACS Paragon Plus Environment
Page 12 of 25
Page 13 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
REFERENCES (1) Jung, C.; Allen, P. B.; Ellington, A. D. A Stochastic DNA Walker That Traverses a Microparticle Surface. Nat. Nanotechnol. 2016, 11, 157−163. (2) Shin, J. S.; Pierce, N. A. A Synthetic DNA Walker for Molecular Transport. J. Am. Chem. Soc. 2014, 126, 10834−10835. (3) Liu, M. H.; Fu, J. L.; Hejesen, C.; Yang, Y. H.; Woodhury, N. W.; Gothelf, K.; Liu, Y.; Hao, Y. A DNA Tweezer-Actuated Enzyme Nanoreactor. Nat. Commun. 2013, 4, 2127−2131. (4) Lund, K.; Manzo, A. J.; Dabby, N.; Michelotti, N.; Johnsonbuck, A.; Nangreave, J.; Taylor, S.; Pei, R. J.; Stojanovic, M. N.; Walter, N. G.; Winfree, E.; Yan, H. Molecular Robots Guided by Prescriptive Landscapes. Nature 2010, 465, 206−210. (5) Tian, Y.; Mao, C. D. Molecular Gears: A Pair of DNA Circles Continuously Rolls against Each Other. J. Am. Chem. Soc. 2014, 126, 11410−11411. (6) He, Y.; Liu, D. R. Autonomous Multistep Organic Synthesis in a Single Isothermal Solution Mediated by a DNA Walker. Nat. Nanotechnol. 2010, 5, 778−782. (7) Muscat, R. A.; Bath, J.; Turberfield, A. J. Small Molecule Signals That Direct the Route of a Molecular Cargo. Small 2012, 8, 3593−3597. (8) Wickham, S. F. J.; Endo, M.; Katsuda, Y.; Hidaka, K.; Bath, J.; Sugiyama, H.; Turberfield, A. J. Direct Observation of Stepwise Movement of a Synthetic Molecular Transporter. Nat. Nanotechnol. 2011, 6, 166−169. (9) Peng, H. Y.; Li X. F.; Zhang, H. Q.; Le, X. C. A MicroRNA-Initiated DNAzyme Motor Operating in Living Cells. Nat. Commun. 2017, 8, 14378−14390. (10) Yin, P.; Choi, H. M. T.; Calvert, C. R.; Pierce, N. A. Programming Biomolecular Self-Assembly Pathways. Nature 2008, 451, 318−322. (11) Tomov, T. E.; Tsukanov, R.; Glick, Y.; Berger, Y.; Liber, M.; Avrahami, D.; Gerber, D.; Nir, E. DNA Bipedal Motor Achieves a Large Number of Steps Due to Operation Using 13
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Microfluidics-Based Interface. ACS Nano 2017, 11, 4002−4008. (12) Qu, X. M.; Zhu, D.; Yao, G. B.; Su, S.; Chao, J.; Liu, H. J.; Zuo, X. L.; Wang, L. H.; Shi, J. Y.; Wang, L. H.; Huang, W.; Pei, H.; Fan, C. H. An Exonuclease III-Powered, On-Particle Stochastic DNA Walker. Angew. Chem. Int. Ed. 2017, 56, 1855−1858. (13) Yang, X. L.; Tang, Y. N.; Mason, S. D.; Chen, J. B.; Li, F. Enzyme-Powered Three-Dimensional DNA Nanomachine for DNA Walking, Payload Release, and Biosensing. ACS Nano 2016, 10, 2324−2330. (14) Omabagho, T.; Sha, R. J.; Seeman, N. C. A Bipedal DNA Brownian Motor with Coordinated Legs. Science 2009, 324, 67−71. (15) Wickham, S. F. J.; Bath, J.; Katsuda, Y.; Endo, M.; Hidaka, K.; Sugiyama, H.; Turberfield, A. J. A DNA-Based Molecular Motor That Can Navigate a Network of Tracks. Nat. Nanotechnol. 2012, 7, 169−173. (16) Ji, Y. H.; Zhang, L.; Zhu, L. Y.; Lei, J. P.; Wu, J.; Ju, H. X. Binding-Induced DNA Walker for Signal Amplification in Highly Selective Electrochemical Detection of Protein. Biosens. Bioelectron. 2017, 96, 201−205. (17) Li, C.; Li, X. X.; Wei, L. M.; Liu, M. Y.; Chen, Y. Y.; Li, G. X. Simple Electrochemical Sensing of Attomolar Proteins Using Fabricated Complexes with Enhanced Surface Binding Avidity. Chem. Sci. 2015, 6, 4311−4317. (18) Zhang, H. Q.; Lai, M. D.; Zuehlke, A.; Peng, H. Y.; Li, X. F.; Le, X. C. Binding-Induced DNA Nanomachines Triggered by Proteins and Nucleic Acids. Angew. Chem. Int. Ed. 2015, 54, 14326−14330. (19) Chen, J. B.; Zuehlke, A.; Deng, B.; Peng H. Y.; Hou X. D.; Zhang, H. Q. A Target-Triggered DNAzyme Motor Enabling Homogeneous, Amplified Detection of Proteins. Anal. Chem. 2017, 89, 12888−12895. (20) Feng, C.; Wang, Z. H.; Chen T. S.; Chen, X. X.; Mao, D. S.; Zhao, J.; Li, G. X. A 14
ACS Paragon Plus Environment
Page 14 of 25
Page 15 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Dual-Enzyme-Assisted Three-Dimensional DNA Walking Machine Using T4 Polynucleotide Kinase as Activators and Application in Polynucleotide Kinase Assays. Anal. Chem. 2018, 90, 2810−2815. (21) Liang, C. P.; Ma, P. Q.; Liu, H.; Guo, X. G.; Yin, B. C.; Ye, B. C. Rational Engineering of a Dynamic, Entropy-Driven DNA Nanomachine for Intracellular MicroRNA Imaging. Angew. Chem. Int. Ed. 2017, 56, 9077−9081. (22) Pu, Q. L.; Li, J. L.; Qiu, J. H.; Yang, X. H.; Li, Y.; Yin, D.; Zhang, X. Y.; Tao, Y. Y.; Sheng, S. C.; Xie, G. M. Universal Ratiometric Electrochemical Biosensing Platform Based on Mesoporous Platinum Nanocomposite and Nicking Endonuclease Assisted DNA Walking Strategy. Biosens. Bioelectron. 2017, 94, 719−727. (23) Yang, J. M.; Dou, B. T.; Yuan, R.; Xiang, Y. Aptamer/Protein Proximity Binding-Triggered Molecular Machine for Amplified Electrochemical Sensing of Thrombin. Anal. Chem. 2017, 89, 5138−5143. (24) Li, F.; Zhang, H. Q.; Lai, C.; Li, X. F.; Le, X. C. A Molecular Translator That Acts by Binding-Induced DNA Strand Displacement for a Homogeneous Protein Assay. Angew. Chem. Int. Ed. 2012, 51, 9317−9320. (25) Li, F.; Zhang, H. Q.; Wang, Z. X.; Li, X. K.; Li, X. F.; Le, X. C. Dynamic DNA Assemblies Mediated by Binding-Induced DNA Strand Displacement. J. Am. Chem. Soc. 2013, 135, 2443−2446. (26) Ren, K. W.; Wu, J.; Yan, F.; Ju, H. X. Ratiometric Electrochemical Proximity Assay for Sensitive One-Step Protein Detection. Sci. Rep. 2014, 4, 4360−4365. (27) Ren, K. W.; Wu, J.; Yan, F.; Zhang, Y.; Ju, H. X. Immunoreaction-Triggered DNA Assembly for One-Step Sensitive Ratiometric Electrochemical Biosensing of Protein Biomarker. Biosens. Bioelectron. 2015, 66, 345−349. (28) Zhang, H. Q.; Li, X. F.; Le, X. C. Binding-Induced DNA Assembly and Its Application 15
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 16 of 25
to Yoctomole Detection of Proteins. Anal. Chem. 2012, 84, 877−884. (29) Shu, B.; Zhang, C. S.; Xing, D. A Sample-to-Answer, Real-Time Convective Polymerase Chain Reaction System for Point-of-Care Diagnostics. Biosens. Bioelectron. 2017, 97, 360−368. (30) Huang, J.; Li, X. Y.; Du, Y. C.; Zhang, L. N.; Liu, K. K.; Zhu, L. N.; Kong, D. M. Sensitive
Fluorescent
Detection
of
DNA
Methyltransferase
Using
Nicking
Endonuclease-Mediated Multiple Primers-Like Rolling Circle Amplification. Biosens. Bioelectron. 2017, 91, 417−423. (31) Yang, K. L.; Huo, M.; Guo, Y. H.; Yang, Y. Z.; Wu, J.; Ding, L.; Ju, H. X. Target-Induced Cyclic DNAzyme Formation for Colorimetric and Chemiluminescence Imaging Assay of Protein Biomarkers. Analyst 2017, 142, 3740−3746. (32) Zhou, W. J.; Su, J.; Chai, Y. Q.; Yuan, R.; Xiang, Y. Naked Eye Detection of Trace Cancer Biomarkers Based on Biobarcode and Enzyme-Assisted DNA Recycling Hybrid Amplifications. Biosens. Bioelectron. 2014, 53, 494−498. (33) Dirks, R. M.; Pierce, N. A. Triggered Amplification by Hybridization Chain Reaction. Proc. Natl. Acad. Sci. USA 2004, 101, 15275−15278. (34) Li, B. L.; Ellington, A. D.; Chen, X. Rational, Modular Adaptation of Enzyme-Free DNA Circuits to Multiple Detection Methods. Nucleic Acids Res. 2011, 39, e110. (35) Xiao, Y.; Lai, R. Y.; Plaxco, K. W. Preparation of Electrode-Immobilized, Redox-Modified Oligonucleotides for Electrochemical DNA and Aptamer-Based Sensing. Nat. Protoc. 2007, 2, 2875−2880. (36) Creager, S. E.; Wooster, T. T. A New Way of Using AC Voltammetry to Study Redox Kinetics in Electroactive Monolayers. Anal. Chem. 1998, 70, 4257−4263. (37) Zhang, Y. L.; Huang, Y.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Electrochemical Aptasensor Based on Proximity-Dependent Surface Hybridization Assay for Single-Step, 16
ACS Paragon Plus Environment
Page 17 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Reusable, Sensitive Protein Detection. J. Am. Chem. Soc. 2007, 129, 15448−15449. (38) Yang, H.; Gao, Y.; Wang, S. Q.; Qin, Y.; Xu, L.; Jin, D.; Yang, F.; Zhang, G. J. In Situ Hybridization Chain Reaction Mediated Ultrasensitive Enzyme-Free and Conjugation-Free Electrochemcial Genosensor for BRCA-1 Gene in Complex Matrices. Biosens. Bioelectron. 2016, 80, 450−455. (39) Yao, B.; Liu, Y. C.; Tabata, M.; Zhu, H. T. Z.; Miyahara, Y. J. Sensitive Detection of MicroRNA by Chronocoulometry and Rolling Circle Amplification on a Gold Electrode. Chem. Commun. 2014, 50, 9704−9706. (40) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. The Effect of Surface Probe Density on DNA Hybridization. Nucleic Acids Res. 2001, 29, 5163−5168. (41) Jiang, B. Y.; Wang, M.; Li, C.; Xie, J. Q. Label-Free and Amplified Aptasensor for Thrombin Detection Based on Background Reduction and Direct Electron Transfer of Hemin. Biosens. Bioelectron. 2013, 43, 289−292. (42) Yang, J. M.; Dou, B. T.; Yuan, R.; Xiang, Y. Proximity Binding and Metal Ion-Dependent DNAzyme Cyclic Amplification-Integrated Aptasensor for Label-Free and Sensitive Electrochemical Detection of Thrombin. Anal. Chem. 2016, 88, 8218−8223. (43) Xu, H.; Gorgy, K.; Gondran, C.; Goff, A. L.; Spinelli, N.; Lopez, C.; Defrancq, E.; Cosnier, S. Label-Free Impedimetric Thrombin Sensor Based on Poly(Pyrrole-Nitrilotriacetic Acid)-Aptamer Film. Biosens. Bioelectron. 2013, 41, 90−95.
17
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
FIGURE CAPTIONS Figure 1. Schematic diagram of electrochemical biosensing platform using BMM powered SPCR for signal amplification and sensitive detection of thrombin.
Figure 2. (A) EIS of bare electrode (a), H1 modified electrode (b), the electrochemical biosensor (c), and the biosensor incubated with the mixture of 50 nM P1, 50 nM P2 and 0.8 µM H2-Fc in absence (d) and presence (e) of 1 nM thrombin for 80 min. (B) ACV responses of the electrochemical biosensor incubated with Tris-HCl buffer (a), 0.8 µM H2-Fc (b), and a mixture of 50.0 nM P1, 50.0 nM P2, and 0.8 µM H2-Fc in absence (c) and presence of 1 nM thrombin for 10 min (d) and 80 min (e).
Figure 3. (A) Effect of H1 concentration for biosensor preparation on ACV response. (B) CC curves at MCH modified electrode (a) and biosensor (b) in 10 µM Tris-HCl buffer containing 50 µΜ RuHex. The intercept (t1/2 =0) represents the charge of RuHex adsorbed at the electrode surface. Effects of (C) spacer length of P1 and P2, (D) reaction time and (E) concentration of H2-Fc on ACV response. Error bars represent standard deviations of three parallel experiments.
Figure 4. (A) ACV responses of biosensor to 0, 0.2, 1, 2, 10, 20, 100, 200, 1000, 2000, 10000 and 20000 pM thrombin under optimal conditions (from a to l), and (B) plot of peak current vs logarithm of thrombin concentration. Error bars represent standard deviations of three parallel experiments.
Figure 5. Specificity of the biosensor against 10 nM AFP, CEA, and PSA, 1 nM thrombin and their mixture. Error bars represent standard deviations of three parallel experiments.
18
ACS Paragon Plus Environment
Page 18 of 25
Page 19 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Figure 1
19
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Figure 2
20
ACS Paragon Plus Environment
Page 20 of 25
Page 21 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Figure 3
21
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Figure 4
22
ACS Paragon Plus Environment
Page 22 of 25
Page 23 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Figure 5
23
ACS Paragon Plus Environment
Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 24 of 25
Table 1 Results for thrombin determination in diluted serum samples
a
Samples
Added (pM)
Found (pM)
Recovery (%)
RSDa (%)
1
10
10.25
102.5
6.20
2
200
191.9
95.95
4.63
3
500
488.7
97.74
2.96
4
1000
1036
103.6
3.21
The mean of three measurements.
24
ACS Paragon Plus Environment
Page 25 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
For TOC Only
25
ACS Paragon Plus Environment