Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine

Subscriber access provided by MONASH UNIVERSITY

Article

Engineering lysine-ON riboswitch for metabolic control of lysine production in Corynebacterium glutamicum Li-Bang Zhou, and An-Ping Zeng ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.5b00075 • Publication Date (Web): 24 Aug 2015 Downloaded from http://pubs.acs.org on August 26, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Synthetic Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Engineering

lysine-ON

riboswitch

for

metabolic control of lysine production in Corynebacterium glutamicum Li-Bang Zhou and An-Ping Zeng* Institute of Bioprocess and Biosystems Engineering, Hamburg University of Technology Denickestrasse 15, D-21073 Hamburg, Germany •

Corresponding author

Abstract: Riboswitches are natural RNA elements which regulate gene expression by binding a ligand. Here, we demonstrate the possibility to alter a natural lysine-OFF riboswitch of Eschericia coli (ECRS) to a synthetic lysine-ON riboswitch and to use it for metabolic control. To this end, a lysine-ON riboswitch library was constructed by using tetA-based dual genetic selection. After screening, the functionality of the selected lysine-ON riboswitches was examined by using a report gene lacZ. Selected lysine-ON riboswitches were introduced into the lysE gene encoding a lysine transport protein of Corynebacterium glutamicum and were used to achieve a dynamic control of lysine transport in a recombinant lysine producing strain C. glutamicum LPECRS which bears a deregulated aspartokinase and a lysine-OFF riboswitch for dynamic control of the enzyme citrate synthase. Batch fermentation results of the strains showed that the C. glutamicum LPECRS strain with an additional lysine-ON riboswitch for the control of lysE achieved a 21% increased lysine yield compared to the strain C. glutamicum LPECRS and even a 89% yield increase compared to the strain with the deregulated aspartokinase. This work provides a useful approach to generate lysine-ON riboswitches for C. glutamicum metabolic engineering and demonstrates for the first time a synergetic effect of lysine-ON and lysine-OFF riboswitches for improved lysine production in this industrially important microorganism. The approach can be used to dynamically control other genes and applied to other microorganisms.

Keywords: Corynebacterium glutamicum, metabolic control, synthetic lysine-ON riboswitch, tetA

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

dual genetic selection, lysine production

1. Introduction Corynebacterium glutamicum, an important Gram-positive microorganism, is widely used for commercial industrial applications, such as the production of vitamins, amino acids and other valuable enzymes and compounds.1,2 Since the discovery of this glutamic acid accumulating bacterium, a lot of impressive progressive researches have been focused on the development of productive strains involving both classical mutagenesis and modern molecular microbiology tools.3-6 However, these improvements may also draw unexpected negative effects into the bacterium.6-9 For example, classical random method may cause low productivity resulted by undesired mutations.5 Inducible promoter systems may exhibit higher basal expression and can be interfered by high amount of exogenous inducers.7,10 With the development of synthetic biology and metabolic engineering of C. glutamicum, more efficient producing mutants that avoid side effects were reengineered.6,11,12 It was reported that lysine hyper-producing strain can be reconstructed via a comparative genomic analysis.13 With the replacement of native gltA promoter using nine different dapA promoters,14 an improvement of C. glutamicum strains was also achieved.15 Furthermore, the deregulation of feedback inhibition significantly improved lysine production by rational protein design.16 However, there is still a great demand for developing effective molecular tools for dynamic control of metabolic pathways and thus further improving lysine producing strains. Of particular interest is a self-dynamic control by using intracellular molecule(s) related to the biosynthesis itself as an input signal for the control system, for example the product itself. In this regard, riboswitch is a promising control element.

Riboswitch is a regulatory segment located in the 5’ untranslated region (UTR) of mRNA. It can regulate gene expression by binding a small metabolite.17 In a typical riboswitch, there is an aptamer domain and an expression domain. For decades, there has been great interest in studying riboswitches. For example, a riboswitch-based sensor was constructed to examine coenzyme B12 metabolism and transport in E. coli.18 Riboswitches were also used for developing


Page 2 of 20

Page 3 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


novel antibiotics.19 In fact, riboswitches are commonly used for controlling gene expression.17,20-22 However, most natural riboswitches function as a negative element in the presence of ligand.18,22,23 In a previous study, we used a natural lysine-OFF riboswitch (ECRS) to repress gene expression of undesired but essential pathway in lysine production by C. glutamicum.24 To expand the applications of lysine riboswitch, and also to enrich the toolbox of metabolic engineering of C. glutamicum, it is desirable to engineer a lysine-ON riboswitch and to study the potential synergetic efforts of a combined ON-OFF control.

In this study, we first constructed a lysine-ON riboswitch library using a tetA based dual selection system which randomizes the sequences of the region between the aptamer and the ribosome binding sites (RBS). TetA encodes the tetracycline efflux protein and has been shown to be a useful marker of dual genetic selection.25 It was successfully applied to alter the natural thiamine pyrophosphate (TPP) OFF riboswitch into a synthetic TPP ON riboswitch.26 After successful screening of an efficient lysine-ON riboswitch, we integrated it into the C. glutamicum chromosome to up-regulate the expression of a lysine secretion related gene lysE in response to lysine concentration (Figure 1). Fermentation results showed significant increase of lysine production and yield in mutants with such a lysine-ON switch mediated metabolic control. To our knowledge, this is the first study to demonstrate the successful development and use of a synthetic lysine-ON riboswitch for improving lysine production in C. glutamicum. We also show that natural lysine-OFF riboswitch and synthetic lysine-ON riboswitch can work together as a convenient and powerful tool for metabolic pathway control.

2. Results and Discussion Dual genetic selection of ECRS-ON-tetA library To construct the lysine-ON riboswitch library, the natural lysine-OFF riboswitch (ECRS) was incorporated into the plasmid pLacthiMtetA to replace the TPP riboswitch (thiM). The generated plasmid pECRS-tetA (Figure S1) was used as a template for constructing a lysine-ON riboswitch



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

library (ECRS-ON-tetA). After PCR, less than 40 degenerate bases were inserted between the lysine aptamer and the ribosome binding sites (RBS) (Figure S2). The library was transformed into E. coli TOP10 cells. Approximately 25000 colonies were collected from M9 agar plates supplemented with ampicillin. To select ON riboswitches in the presence of lysine, the recovered library cells were plated on M9-Amp agar plates supplemented with tetracycline (30μg/mL) and lysine (0.1 mM) (Figure S3). In the following step, the cells that survived were plated on M9-Amp agar plates supplemented with NiCl2 (0.3 mM) without lysine.27 The dual genetic selection was repeated two more cycles to enrich the desired riboswitches. After dual selection, 46 colonies picked randomly were confirmed to show lysine-dependent growth on M9 agar plates supplemented with tetracycline (30μg/mL). 10 riboswitches colonies (out of 46) were sequenced (Table 1). It should be noted that due to the limitation of the synthesized primers, the length of randomized sequence was always shorter than 40.

Characterization of ECRS-ON-lacZ After sequencing, the tetA gene in the riboswitch clones was replaced with lacZ. Figure 2B shows the measurement results of β-galactosidase activity for the 10 ECRS-ON clones. An up-regulation of β-galactosidase was found in all the selected ECRS-ON clones in the presence of 0.1 mM lysine. Among them, the lysine-ON riboswitche ECRS#16 showed the highest up-regulated expression (>18 fold) in the presence of lysine compared to the un-induced conditions. To confirm the lysine-dependent activation, one site mutation (G31C) was introduced into the lysine aptamer of pECRS#16-lacZ to generate the mutant pG31C-lacZ, in which the efficiency of lysine binding was modulated. This point mutation exhibited a similar basal expression level to that of ECRS#16 without lysine. However, the mutation in the lysine aptamer resulted in a significant reduction of the relative activation in the presence of 0.1 mM lysine (Table S3). As depicted in Figure 2C, the β-galactosidaseactivity of ECRS#16-lacZ was significantly over-expressed when the concentration of lysine was increased from 50 μM to 200 μM. Due to its relatively large dynamic range, the lysine-ON riboswitch ECRS#16 was selected for further work.


Page 4 of 20

Page 5 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Lysine-ON riboswitch for metabolic control in C. glutamicum After verifying the function of lysine-ON riboswitches, we started to test the feasibility of using them to improve lysine production by controlling metabolic pathway in C. glutamicum. To achieve that goal, we tried to fuse ECRS#16 with an endogenous protein. lysE gene, which encodes a lysine transporter protein, is responsible for exporting intracellular lysine to extracellular medium.28,29 In C. glutamicum, due to the null of ribosome-binding sites, we integrated ECRS#16 into the region between the transcript initiation site and the start codon of lysE (Figure 3A). To this end, a plasmid pK18-ECRS#16-lysE (carrying the upstream of lysE, ECRS#16, and lysE gene) was constructed based on pK18mobsacB (Figure S4). Then the strain LPECRS with a lysine-OFF riboswitch control of the gltA gene was used to carry out homologous recombination, in which the expression of lysE gene can be enhanced by intracellular lysine. In such a way, we succeeded in engineering a mutant LPECRS#16-lysE in which lysE and gltA (citrate synthase) were under the control of a lysine-ON riboswitch (ECRS#16) and a lysine-OFF riboswitch (ECRS), respectively.

Batch fermentations with enhanced lysine production To investigate whether the lysine-ON riboswtich can improve lysine production in C. glutamicum, we carried out batch fermentations in shake flask. As shown in Figure 3B, the growth rate of the strain LPECRS#16-lysE was similar to that of LPECRS, but was reduced compared to that of LP917, indicating that the control of lysE by ECRS#16 has no additional affect on the cell growth beyond the negative effect of the lysine-OFF riboswitch. However, the glucose consumption rate was increased in LPECRS#16-lysE. It is speculated that the expression of lysE enhanced by endogenous lysine facilitated the glucose consumption. Importantly, the lysine production and yield in LPECRS#16-lysE were significantly higher than that of LPECRS and LP917. As given in Table 2, the yield of produced lysine in the strainLPECRS#16-lysE was 0.267±0.006 mol per mol of glucose consumed, which is 21% higher than that of the strain LPECRS, and 89% higher than that of LP917. Clearly, the increased lysine concentration and yield were resulted from the up-regulation of lysE



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

due to the control of the lysine-ON riboswitch. Therefore, these data demonstrated that a lysine-ON riboswitch can be used as an effective tool to engineer metabolic pathway. The intracellular lysine concentrations in the three strains during batch cultivation were determined and shown in Figure S6 (Support Information). In the first six hours, the intracellular lysine concentration in all the three strains increased and leveled off after that (data not shown). It is found that the strain LPECRS#16-lysE had the lowest intracellular lysine concentration throughout the fermentation compared to the other two strains, though the concentration seems to be beyond the dynamic range of the lysine-ON riboswitch. It should be mentioned that the so-called dynamic range of the lysine-ON riboswitch was determined by adding extracellular lysine concentration and may be considered as “apparent response range of extracellular lysine concentration” in the special experimental design (Figure 2C). We can hardly judge whether the intracellular concentration of lysine is within the “apparent response range” that was defined with extracellular lysine concentration. Thus, even the measured intracellular concentration of lysine seems to be beyond the “apparent response range of extracellular lysine concentration” we cannot exclude a possible dynamic control of the lysine-ON riboswitch in the real fermentation due to the complexity of intracellular environment. We think the key issue is not whether the intracellular concentration of lysine is within the “apparent response range” determined by using extracellular lysine concentration. It is whether there are different performances of the mutant with the lysine-ON riboswitch compared to the control strains. This is well documented by the lysine production and by the measured intracellular lysine concentration.

Furthermore, we show here that in the same organism, the expression of genes could be repressed and simultaneously up-regulated by riboswitches which are responding to the same intracellular molecule. The two riboswitches may have different dynamic range towards lysine. For a consorted control of metabolic pathways, especially under higher concentrations of lysine it is desirable to alter the dynamic ranges of the riboswitches. Recently, Ma et al. succeeded in expanding the ligand response range of the natural lysine-OFF riboswitch (unpublished data) by using a rational approach of mRNA design.30 A similar approach may be also applied to redesign the lysine-ON riboswitch. The dual genetic circuits as demonstrated in this work may be used for


Page 6 of 20

Page 7 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


systematic and dynamic control of metabolic pathways in C. glutamicum and other industrial microorganisms for lysine biosynthesis.

3. Methods Bacterial strains, palsmids, media and growth conditions All the strains and plasmids used in this study were listed in Table S1 (Support Information). E. coli Top10 (Invitrogen, Karlsruhe, Germany) was used as the host of the plasmids cloning and expression. C. glutamicum with a feedback-deregulated aspartokinase (LP917) and a natural lysine-OFF riboswitch (LPECRS) was used as a lysine producer and control.16,24 E. coli strains were grown in M9 minimal medium or Luria-Bertani (LB) broth (Carl Roth, Karlsruhe, Germany) at 37 °C. A chemically defined and rich medium without lysine (RDM) was used for the measurement of β-galactosidase enzyme activity.18 C. glutamicum strains were cultured in LB or trypticase soy brothmedium (DSMZ medium no. 535) at 30 °C on a rotary shaker (230 rpm). For the batch fermentations of C. glutamicum, a defined and optimized minimal medium was used as described previously.16 When necessary, antibiotics were added into the medium as follows: for E.coli, ampicillin, 100μg/ml, kanamycin, 50μg/ml,tetracycline, 30μg/ml; and for C.glutamicum, kanamycin, 15 or 25μg/ml.

DNA manipulation Standard protocols were used for DNA extraction, purification and plasmid construction.31 DNA polymerase chain reactions (PCR) were performed according to the manufacturer’s instructions by using Phusion polymerase (Thermo Scientific, Germany).All restriction enzymes were purchased from ThermoFisher Scientific GmbH (Schwerte, Germany). Primers used in this study (SI Table S2) were obtained from Life technology (Karlsruhe, Germany). All sequencing was performed in Seqlab (Göttingen, Germany). Transformation of E. coli was performed by using the CaCl2method.32 The transformation of plasmids into C. glutamicum was carried out by using



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

electroporation as described before.33

Construction of lysine-ON riboswitch library A lysine-ON riboswitch library was constructed based on pLacthiMtetA kindly provided by Dr. Yohei Yokobayashi.26 As described before, the natural lysine-OFF riboswitch of E. coli (ECRS) was amplified from genomic DNA of E. coli MG1655 by using primers ECRS-F/ECRS-R (SI Table S2). The fragment without TPP riboswitch (thiM) was amplified by using primers LTG-F/LTG-R, using pLacthiMtetA as a template. Then, the two amplified fragments were fused to generate the construct pECRS-tetA (Figure S1) by using Gibson Assembly Master Mix (NEB, Frankfurt, Germany). The library was constructed by PCR using primers Lib-F/Lib-R, and pECRS-tetA as a template. After treated by DpnI, the purified PCR product was phosphorylated with T4 polynucleotide kinase (PNK). The linear DNA was treated using Rapid DNA Ligation Kit (Thermo Scientific, Germany) and immediately transformed into TOP10 competent cells. The transformed cells were cultured on M9 agar plates containing ampicillin. All the colonies were collected and stored in 30% glycerol at -80 °C.

Dual genetic selection The procedure of dual genetic selection (Figure S3) was carried out according to Nomura and Yokobayashi with minor modifications.26 To enrich the library under the activation of 0.1 mM lysine, the dual genetic selection was repeated three times. After dual genetic selection, cells were plated on M9 plates supplemented with ampicillin, tetracycline, and with (0.1 mM) or without lysine. Colonies which could grow on the lysine-supplemented plates but not on the lysine-lacking plates were randomly selected and sent for sequencing.


Page 8 of 20

Page 9 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Construction of lysine-ON riboswitch-lacZ fusions A fragment of lacZ gene was amplified from E. coli MG1655 genomic DNA by using primers lacZ-F/lacZ-R. To construct the fusion plasmid pECRS-ON-lacZ, the backbone was amplified from the riboswitch plasmid which was screened from the lysine riboswitch ON library by using primers RGON-F/RGON-R. The two fragments were fused to generate the construct pECRS-ON-lacZ by using Gibson Assembly Master Mix (NEB, Frankfurt, Germany). The fusion constructs were transformed to TOP10 competent cells. The expression of lacZ was measured by using the β-galactosidase enzyme assay kit (ThermoScientific, Germany) in 96-well plates. The measurements were repeated in triplicates.

Construction of C. glutamicum lysine-ON riboswitch-lysE mutants In order to assess the potential values of lysine-ON riboswitch on improving lysine production in C. glutamicum, we introduced ECRS#16 to control the expression of the lysE gene in C. glutamicum LPECRS in which the expression of citrate synthase (gltA) was under the control of a natural lysine-OFF riboswitch of E. coli (ECRS).24 The suicide vector pK18mobsacB was used to construct pK18-ECRS#16-lysE (Figure S4) as follows: the fragment of ECRS#16, the upstream part of lysE, the ORF of the lysE gene, and the backbone of pK18mobsacB were amplified by using primers given in (SI Table S2), respectively.33 Then, the four fragments were fused to generate pK18-ECRS#16-lysE by using Gibson Assembly Master Mix (NEB, Frankfurt, Germany). After confirming by sequencing, the resulting vector, pK18-ECRS#16-lysE was used for transformation of C. glutamicum LPECRS. After homologous recombination, the integration of chromosomal ECRS#16-lysE was verified by PCR and further confirmed by sequencing. The ECRS#16-lysE mutant was designated as C. glutamicum LPECRS#16-lysE (SI Table S1).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fermentation and analytical methods Batch fermentations of C. glutamicum strains were carried out as described previously.24,34 The optical density of cells was measured at 600 nm (E. coli) or 660 nm (C. glutamicum) in 0.1 M HCl by using a UV spectrophotometer or Multiskan spectrophotometer (Thermo Scientific, Germany). Glucose concentration was measured with the YSI glucose analyzer (YSI, Xylem Inc., USA). The extracellular lysine concentration wasmeasured by using a HPLC method as described before.16

Author Information Corresponding Author: An-Ping Zeng *Tel: +49-40-42878-4183. Fax: +49-40-42878-2909. E-mail: [email protected]. Notes The authors declare no competing financial interest.

Acknowledgments We appreciate the funding of this work from the Deutsche Forschungsgemeinschaft (DFG ZEG542/6-1). LZ thanks the Chinese Scholarship Council (CSC) for a PhD scholarship. We also thank Dr. Yohei Yokobayashi for providing the plasmid. We also thank Dr. Chengwei Ma for helpful reading and suggestions during revision.

Supporting Information This material is available free of charge via the Internet athttp://pubs.acs.org/.


Page 10 of 20

Page 11 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4. References (1) Yukawa, H., and Inui, M. (2013) Corynebacterium glutamicum : biology and biotechnology, Springer, Heidelberg ; New York. (2) Eggeling, L., and Bott, M. (2005) Handbook of Corynebacterium glutamicum, Taylor & Francis, Boca Raton. (3) Anastassiadis, S. (2007) L-lysine fermentation. Recent Pat. Biotechnol.1, 11-24. (4) Eggeling, L., Oberle, S., and Sahm, H. (1998) Improved L-lysine yield with Corynebacterium glutamicum: use of dapA resulting in increased flux combined with growth limitation. Appl. Microbiol. Biotechnol.49, 24-30. (5) Ohnishi, J., Mitsuhashi, S., Hayashi, M., Ando, S., Yokoi, H., Ochiai, K., and Ikeda, M. (2002) A novel methodology employing Corynebacterium glutamicum genome information to generate a new L-lysine-producing mutant. Appl. Microbiol. Biotechnol.58, 217-223. (6) Wittmann, C., and Becker, J. (2007) The L-lysine story: from metabolic pathways to industrial production, in Amino Acid Biosynthesis~ Pathways, Regulation and Metabolic Engineering, pp 39-70, Springer. (7) Patek, M., Nesvera, J., Guyonvarch, A., Reyes, O., and Leblon, G. (2003) Promoters of Corynebacterium glutamicum. J. Biotechnol.104, 311-323. (8) Ikeda, M., and Nakagawa, S. (2003) The Corynebacterium glutamicum genome: features and impacts on biotechnological processes. Appl. Microbiol. Biotechnol.62, 99-109. (9) Kirchner, O., and Tauch, A. (2003) Tools for genetic engineering in the amino acid-producing bacterium Corynebacterium glutamicum. J. Biotechnol.104, 287-299. (10) Zhang, Y., Shang, X., Lai, S., Zhang, G., Liang, Y., and Wen, T. (2012) Development and application of an arabinose-inducible expression system by facilitating inducer uptake in Corynebacterium glutamicum. Appl.Environ.Microbiol.78, 5831-5838. (11) Kumagai, H. (2006) Amino acid production, in The Prokaryotes, pp 756-765, Springer. (12) Keasling, J. D. (2012) Synthetic biology and the development of tools for metabolic engineering. Metab. Eng.14, 189-195. (13) Ikeda, M., Ohnishi, J., Hayashi, M., and Mitsuhashi, S. (2006) A genome-based approach to create a minimally mutated Corynebacterium glutamicum strain for efficient L-lysine production. J. Ind. Microbiol. Biotechnol.33, 610-615. (14) Vasicova, P., Patek, M., Nesvera, J., Sahm, H., and Eikmanns, B. (1999) Analysis of the Corynebacterium glutamicum dapA promoter. J. Bacteriol181, 6188-6191. (15) van Ooyen, J., Noack, S., Bott, M., Reth, A., and Eggeling, L. (2012) Improved L-lysine production with Corynebacterium glutamicum and systemic insight into citrate synthase flux and activity. Biotechnol. Bioeng.109, 2070-2081. (16) Chen, Z., Bommareddy, R. R., Frank, D., Rappert, S., and Zeng, A. P. (2014) Deregulation of feedback inhibition of phosphoenolpyruvate carboxylase for improved lysine production in Corynebacterium glutamicum. Appl.Environ.Microbiol.80, 1388-1393. (17) Winkler, W., and Breaker, R. (2005) Regulation of bacterial gene expression by riboswitches. Annu. Rev. Microbiol.59, 487 - 517. (18) Fowler, C. C., Brown, E. D., and Li, Y. (2010) Using a riboswitch sensor to examine coenzyme B12 metabolism and transport in E. coli. Chem. Biol.17, 756-765.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(19) Blount, K. F., and Breaker, R. R. (2006) Riboswitches as antibacterial drug targets. Nat. Biotechnol.24, 1558-1564. (20) Vitreschak, A., Rodionov, D., Mironov, A., and Gelfand, M. (2004) Riboswitches: the oldest mechanism for the regulation of gene expression? Trends Genet20, 44 - 50. (21) Takemoto, N., Tanaka, Y., Inui, M., and Yukawa, H. (2014) The physiological role of riboflavin transporter and involvement of FMN-riboswitch in its gene expression in Corynebacterium glutamicum. Appl.Microbiol.Biotechnol.98, 4159-4168. (22) Serganov, A., and Patel, D. J. (2009) Amino acid recognition and gene regulation by riboswitches. Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms1789, 592-611. (23) Breaker, R. R. (2011) Prospects for riboswitch discovery and analysis. Mol. Cell.43, 867-879. (24) Zhou, L. B., and Zeng, A. P. (2015) Exploring lysine riboswitch for metabolic flux control and improvement of L-lysine synthesis in Corynebacterium glutamicum. ACS Synth. Biol. (25) Nomura, Y., and Yokobayashi, Y. (2007) Dual selection of a genetic switch by a single selection marker. Biosystems90, 115-120. (26) Nomura, Y., and Yokobayashi, Y. (2007) Reengineering a natural riboswitch by dual genetic selection. J. Am. Chem. Soc.129, 13814-13815. (27) Muranaka, N., Sharma, V., Nomura, Y., and Yokobayashi, Y. (2009) An efficient platform for genetic selection and screening of gene switches in Escherichia coli. Nucleic Acids Res.37, e39. (28) Vrljic, M., Sahm, H., and Eggeling, L. (1996) A new type of transporter with a new type of cellular function: L-lysine export from Corynebacterium glutamicum. Mol. Microbiol.22, 815-826. (29) Vrljic, M., Garg, J., Bellmann, A., Wachi, S., Freudl, R., Malecki, M. J., Sahm, H., Kozina, V. J., Eggeling, L., Saier, M. H., Jr., Eggeling, L., and Saier, M. H., Jr. (1999) The LysE superfamily: topology of the lysine exporter LysE of Corynebacterium glutamicum, a paradyme for a novel superfamily of transmembrane solute translocators. J. Mol. Microbiol. Biotechnol.1, 327-336. (30) Ma, C. W., Zhou, L. B., and Zeng, A. P. (2015) An efficient approach for rational design of riboswitch-based biosensors with expanded response range of small molecules. submitted. (31) Green, M. R., and Sambrook, J. (2012) Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (32) Cohen, S. N., Chang, A. C., and Hsu, L. (1972) Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. U. S. A.69, 2110-2114. (33) Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G., and Puhler, A. (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene145, 69-73. (34) Bommareddy, R. R., Chen, Z., Rappert, S., and Zeng, A. P. (2014) A de novo NADPH generation pathway for improving lysine production of Corynebacterium


Page 12 of 20

Page 13 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


glutamicumby rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogenase. Metab. Eng.25, 30-37.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table 1. Sequences of selected lysine-ON riboswitches ECRS clone

Sequence

3 7 16 17 22 28 34 42 59 69

GAAGACCGGAAAGCACATCCGGGATG GCTATCCCCGAAGAAAAGATC GTTTATCGAGGAGCATCGC GGTCCAACCTGCTTACGTAAATCG ATTCAGACGAGAAAGTGTGTG GTTTGAAT CTACCAGCAC AGTCGCTTGAGTCGAACGTGTATGG CTCGTCTCTTGATTAATCGCGATTTTACGC TGTTTACGAACGTGACTACTTCGATTTGGC TTCATATTTATCGAAAG


Page 14 of 20

Page 15 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2. L-lysine production by riboswitch derivatives of C. glutamicuma Strain

Lysine yieldb

Final growth (OD660)

Growth rateC (µ, h-1)

LP917 LPECRS LPECRS#16-lysE

0.141±0.007 0.221±0.002 0.267±0.006

23.15±1.48 18.89±1.10 18.58±1.01

0.176±0.008 0.144±0.003 0.139±0.004

a

The mean values of three independent experiments. b lysine yield: mol lysine per mol glucose consumed. C Estimated for the exponential growth phase.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figures Figure 1. Simplified illustration of L-lysine biosynthetic pathway in C.glutamicum. The red line means the introduced repression. The green line means the activation. Abbreviation: RS, riboswitch; lysCM, lysC(Q298G); PEP, phosphoenolpyruvate; PYR, pyruvate; ASP, aspartate; AspP, aspartylphosphate; ASA, aspartyl-semialdehyde; hom, homoserine dehydrogenase; Thr, threonine; Lys, lysine; Lysex, extracellular lysine.

Figure 2. (A) Design of the lysine-ON riboswitch library. (B)β-galactosidase relative expression of the natural lysine-OFF riboswitch (ECRS, WT) and the selected lysine-ON riboswitch clones was measured in the absence and presence of 0.1 mM lysine, respectively. (C) Lysine-dependent β-galactosidase expression of ECRS, ECRS#16 and G31C riboswitches as lacZ fusions. All data are averages of three independent experiments.

Figure 3. (A) The lysine-ON riboswitch ECRS#16 integrated into the chromosome of C. glutamicum. (B) Batch fermentation results with C.glutamicum LP917, LPECRS and LPECRS#16-lysE in shake flasks. The data represent mean values of three independent experiments, and the error bars indicate ± s.d.


Page 16 of 20

Page 17 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Engineering lysine-ON riboswitch for metabolic self-control of lysine production in Corynebacterium glutamicum Li-Bang Zhou and An-Ping Zeng 1262x1483mm (72 x 72 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Simplified illustration of L-lysine biosynthetic pathway and dynamic metabolic control in C. glutamicum. Red line means introduced repression; green line means activation. Abbreviation: RS, riboswitch; lysC M, lysC(Q298G). PEP, phosphoenolpyruvate; PYR, pyruvate; ASP, aspartate; AspP, aspartylphosphate; ASA, aspartyl-semialdehyde; hom, homoserine dehydrogenase; Thr, threonine; Lys, lysine; Lysex, extracellular lysine. 1999x1625mm (72 x 72 DPI)


Page 18 of 20

Page 19 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A) Design of the lysine-ON riboswitch library. (B) β-galactosidase relative expression of the natural lysine-OFF riboswitch (ECRS, WT) and the selected lysine-ON riboswitch clones was measured in the absence and presence of 0.1 mM lysine, respectively. (C) Lysine-dependent β-galactosidase expression of ECRS, ECRS#16 and G31C riboswitches as lacZ fusions. All data are averages of three independent experiments. 1901x894mm (72 x 72 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. (A) The lysine-ON riboswitch ECRS#16 integrated into the chromosome of C. glutamicum. (B) Batch fermentation results with C. glutamicum LP917, LPECRS and LPECRS#16-lysE in shake flasks. The data represent mean values of three independent experiments, and the error bars indicate ± s.d. 1620x1402mm (72 x 72 DPI)


Page 20 of 20

Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine

Recommend Documents