Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine

Aug 24, 2015 - This work provides a useful approach to generate lysine-ON riboswitches for C. glutamicum metabolic engineering and demonstrates for th...
10 downloads 4 Views 731KB Size
Download PDF
Research Article pubs.acs.org/synthbio

Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine Production in Corynebacterium glutamicum Li-Bang Zhou and An-Ping Zeng* Institute of Bioprocess and Biosystems Engineering, Hamburg University of Technology, Denickestrasse 15, D-21073 Hamburg, Germany S Supporting Information *

ABSTRACT: Riboswitches are natural RNA elements that regulate gene expression by binding a ligand. Here, we demonstrate the possibility of altering a natural lysine-OFF riboswitch from Eschericia coli (ECRS) to a synthetic lysine-ON riboswitch and using it for metabolic control. To this end, a lysine-ON riboswitch library was constructed using tetA-based dual genetic selection. After screening the library, the functionality of the selected lysine-ON riboswitches was examined using a report gene, lacZ. Selected lysine-ON riboswitches were introduced into the lysE gene (encoding a lysine transport protein) of Corynebacterium glutamicum and used to achieve dynamic control of lysine transport in a recombinant lysine-producing strain, C. glutamicum LPECRS, which bears a deregulated aspartokinase and a lysine-OFF riboswitch for dynamic control of the enzyme citrate synthase. Batch fermentation results of the strains showed that the C. glutamicum LPECRS strain with an additional lysine-ON riboswitch for the control of lysE achieved a 21% increase in the yield of lysine compared to that of the C. glutamicum LPECRS strain and even a 89% increase in yield compared to that of the strain with deregulated aspartokinase. This work provides a useful approach to generate lysine-ON riboswitches for C. glutamicum metabolic engineering and demonstrates for the first time a synergetic effect of lysine-ON and -OFF riboswitches for improving lysine production in this industrially important microorganism. The approach can be used to dynamically control other genes and can be applied to other microorganisms. KEYWORDS: Corynebacterium glutamicum, metabolic control, synthetic lysine-ON riboswitch, tetA dual genetic selection, lysine production

T

thus further improving lysine-producing strains. Of particular interest is self-dynamic control, which uses intracellular molecule(s) related to the biosynthesis itself as an input signal for the control system, for example, the product itself. In this regard, a riboswitch is a promising control element. A riboswitch is a regulatory segment located in the 5′ untranslated region (UTR) of mRNA. It can regulate gene expression by binding a small metabolite.17 In a typical riboswitch, there is an aptamer domain and an expression domain. For decades, there has been great interest in studying riboswitches. For example, a riboswitch-based sensor was constructed to examine coenzyme B12 metabolism and transport in Escherichia coli.18 Riboswitches were also used for developing novel antibiotics.19 In fact, riboswitches are commonly used for controlling gene expression.17,20−22 However, most natural riboswitches function as a negative element in the presence of ligand.18,22,23 In a previous study, we used a natural lysine-OFF riboswitch (ECRS) to repress gene expression of an undesired but essential pathway in lysine production in C. glutamicum.24 To expand the application of lysine riboswitches and to enrich the toolbox of metabolic engineering of C. glutamicum, it is desirable to engineer a lysine-

he important Gram-positive microorganism, Corynebacterium glutamicum, is widely used for commercial industrial applications, such as the production of vitamins, amino acids, and other valuable enzymes and compounds.1,2 Since the discovery of this glutamic acid-accumulating bacterium, a lot of impressive progressive research has been focused on the development of productive strains through both classical mutagenesis and modern molecular microbiology tools.3−6 However, these improvements may also introduce unexpected negative effects into the bacterium.6−9 For example, classical random mutagenesis may cause low productivity resulting from undesired mutations.5 Inducible promoter systems may exhibit higher basal expression, and they can be interfered with in the presence of a high amount of exogenous inducers.7,10 With the development of synthetic biology and metabolic engineering of C. glutamicum, mutants that produce more efficiently and that do not demonstrate side effects were reengineered.6,11,12 It was reported that a lysine hyper-producing strain can be reconstructed via comparative genomic analysis.13 By replacing the native gltA promoter with nine different dapA promoters,14 improved C. glutamicum strains were also developed.15 Furthermore, deregulation of feedback inhibition significantly improved lysine production by rational protein design.16 However, there is still a great demand for developing effective molecular tools for dynamic control of metabolic pathways and © 2015 American Chemical Society

Received: February 27, 2015 Published: August 24, 2015 1335

DOI: 10.1021/acssynbio.5b00075 ACS Synth. Biol. 2015, 4, 1335−1340

Research Article

ACS Synthetic Biology

To select ON riboswitches in the presence of lysine, the recovered library cells were plated on M9-Amp agar plates supplemented with tetracycline (30 μg/mL) and lysine (0.1 mM) (Figure S3). In the following step, the cells that survived were plated on M9-Amp agar plates supplemented with NiCl2 (0.3 mM) without lysine.27 The dual genetic selection was repeated for two more cycles to enrich the desired riboswitches. After dual selection, 46 colonies picked randomly were confirmed to show lysine-dependent growth on M9 agar plates supplemented with tetracycline (30 μg/mL). Ten riboswitches colonies (out of 46) were sequenced (Table 1). It should be noted that due to limitations of the synthesized primers the length of the randomized sequence was always less than 40.

ON riboswitch and to study the potential synergetic effects of combined ON−OFF control. In this study, we first constructed a lysine-ON riboswitch library using a tetA-based dual selection system that randomizes the sequence of the region between the aptamer and the ribosome binding sites (RBS). TetA encodes the tetracycline efflux protein and has been shown to be a useful marker of dual genetic selection.25 It was successfully applied to alter the natural thiamine pyrophosphate (TPP) OFF riboswitch into a synthetic TPP ON riboswitch.26 After successful screening of an efficient lysine-ON riboswitch, we integrated it into the C. glutamicum chromosome to upregulate the expression of a lysine secretion-related gene, lysE, in response to lysine concentration (Figure 1). Fermentation results showed a

Table 1. Sequences of Selected Lysine-ON Riboswitches ECRS clone

sequence

3 7 16 17 22 28 34 42 59 69

GAAGACCGGAAAGCACATCCGGGATG GCTATCCCCGAAGAAAAGATC GTTTATCGAGGAGCATCGC GGTCCAACCTGCTTACGTAAATCG ATTCAGACGAGAAAGTGTGTG GTTTGAAT CTACCAGCAC AGTCGCTTGAGTCGAACGTGTATGG CTCGTCTCTTGATTAATCGCGATTTTACGC TGTTTACGAACGTGACTACTTCGATTTGGC TTCATATTTATCGAAAG

Characterization of ECRS-ON-lacZ. After sequencing the selected riboswitch clones, the tetA gene was replaced with lacZ. Figure 2B shows β-galactosidase activity for the 10 ECRS-ON clones. An upregulation of β-galactosidase was found in all of the selected ECRS-ON clones in the presence of 0.1 mM lysine. Among them, the lysine-ON riboswitch ECRS#16 showed the highest level of upregulated expression (>18-fold) in the presence of lysine compared to the uninduced conditions. To confirm that the activation was lysine-dependent, one site mutation (G31C) was introduced into the lysine aptamer of pECRS#16-lacZ to generate the mutant pG31ClacZ, in which the efficiency of lysine binding was modulated. This point mutation exhibited a similar basal expression level to that of ECRS#16 without lysine. However, the mutation in the lysine aptamer resulted in a significant reduction of the relative activation in the presence of 0.1 mM lysine (Table S3). As depicted in Figure 2C, the β-galactosidase activity of ECRS#16lacZ was significantly enhanced when the concentration of lysine was increased from 50 to 200 μM. Due to its relatively large dynamic range, the lysine-ON riboswitch ECRS#16 was selected for further work. Lysine-ON Riboswitch for Metabolic Control in C. glutamicum. After verifying the function of the lysine-ON riboswitches, we started to test the feasibility of using them to improve lysine production by controlling the lysine metabolic pathway in C. glutamicum. To achieve this goal, we fused ECRS#16 with an endogenous protein. The lysE gene, which encodes a lysine transporter protein, is responsible for exporting intracellular lysine to the extracellular medium.28,29 In C. glutamicum, due to the null ribosome-binding sites, we integrated ECRS#16 into the region between the transcript initiation site and the start codon of lysE (Figure 3A). To this end, plasmid pK18-ECRS#16-lysE (carrying the upstream segment of lysE, ECRS#16, and the lysE gene) was constructed based on pK18mobsacB (Figure S4). Then, the LPECRS strain,

Figure 1. Simplified illustration of the L-lysine biosynthetic pathway in C. glutamicum. The red line indicates the introduced repression. The green line indicates activation. Abbreviations: RS, riboswitch; lysCM, lysC(Q298G); PEP, phosphoenolpyruvate; PYR, pyruvate; ASP, aspartate; AspP, aspartylphosphate; ASA, aspartyl-semialdehyde; hom, homoserine dehydrogenase; Thr, threonine; Lys, lysine; Lysex, extracellular lysine.

significant increase in lysine production and yield in mutants with metabolic control mediated by such a lysine-ON switch. To our knowledge, this is the first study to demonstrate the successful development and use of a synthetic lysine-ON riboswitch for improving lysine production in C. glutamicum. We also show that a natural lysine-OFF riboswitch and synthetic lysine-ON riboswitch can work together as a convenient and powerful tool for metabolic pathway control.

■

RESULTS AND DISCUSSION Dual Genetic Selection of ECRS-ON-tetA Library. To construct the lysine-ON riboswitch library, the natural lysineOFF riboswitch (ECRS) was incorporated into the plasmid pLacthiMtetA to replace the TPP riboswitch (thiM). The generated plasmid, pECRS-tetA (Figure S1), was used as a template for constructing a lysine-ON riboswitch library (ECRS-ON-tetA). After PCR, less than 40 degenerate bases were inserted between the lysine aptamer and the ribosome binding sites (RBS) (Figure S2). The library was transformed into E. coli TOP10 cells. Approximately 25 000 colonies were collected from M9 agar plates supplemented with ampicillin. 1336

DOI: 10.1021/acssynbio.5b00075 ACS Synth. Biol. 2015, 4, 1335−1340

Research Article

ACS Synthetic Biology

Figure 2. (A) Design of the lysine-ON riboswitch library. (B) Relative β-galactosidase expression of the natural lysine-OFF riboswitch (ECRS, WT) and the selected lysine-ON riboswitch clones measured in the absence and presence of 0.1 mM lysine. (C) Lysine-dependent β-galactosidase expression of ECRS, ECRS#16, and G31C riboswitches as lacZ fusions. All data are the average of three independent experiments.

expression of lysE, enhanced by endogenous lysine, facilitated the increased glucose consumption. Importantly, the production and yield of lysine in LPECRS#16-lysE were significantly higher than those of LPECRS and LP917. As given in Table 2, Table 2. L-Lysine Production by Riboswitch Derivatives of C. glutamicuma strain

lysine yieldb

final growth (OD660)

growth ratec (μ, h−1)

LP917 LPECRS LPECRS#16-lysE

0.141 ± 0.007 0.221 ± 0.002 0.267 ± 0.006

23.15 ± 1.48 18.89 ± 1.10 18.58 ± 1.01

0.176 ± 0.008 0.144 ± 0.003 0.139 ± 0.004

a

The mean values of three independent experiments. bLysine yield: mol lysine per mol glucose consumed. cEstimated for the exponential growth phase.

the yield of lysine produced in the strain LPECRS#16-lysE was 0.267 ± 0.006 mol per mol of glucose consumed, which is 21% higher than that of the strain LPECRS and 89% higher than that of LP917. Clearly, the increased lysine concentration and yield resulted from the upregulation of lysE due to the control of the lysine-ON riboswitch. Therefore, these data demonstrate that a lysine-ON riboswitch can be used as an effective tool to engineer a metabolic pathway. The intracellular lysine concentration in the three strains during batch cultivation was determined and is shown in Figure S6 (Support Information). In the first 6 h, the intracellular lysine concentration in all three strains increased and leveled off after that (data not shown). It is found that the strain LPECRS#16-lysE had the lowest intracellular lysine concentration throughout the fermentation compared to that in the other two strains, although the concentration seems to be beyond the dynamic range of the lysine-ON riboswitch. It should be mentioned that the so-called dynamic range of the lysine-ON riboswitch was determined by adding extracellular lysine and may be considered to be the apparent range of the response to the concentration of extracellular lysine in the experimental design (Figure 2C). It is difficult to determine whether the intracellular concentration of lysine is within the apparent response range that was defined using the extracellular concentration of lysine. Thus, even the measured intracellular concentration of lysine seems to be beyond the apparent

Figure 3. (A) Lysine-ON riboswitch ECRS#16 integrated into the chromosome of C. glutamicum. (B) Batch fermentation results with C. glutamicum LP917, LPECRS, and LPECRS#16-lysE in shake flasks. The data represent mean values of three independent experiments, and the error bars indicate ± SD.

with a lysine-OFF riboswitch controlling the gltA gene, was used to carry out homologous recombination, in which the expression of the lysE gene can be enhanced by intracellular lysine. In this way, we succeeded in engineering a mutant, LPECRS#16-lysE, in which lysE and gltA (citrate synthase) were under the control of a lysine-ON riboswitch (ECRS#16) and a lysine-OFF riboswitch (ECRS), respectively. Batch Fermentations with Enhanced Lysine Production. To investigate whether the lysine-ON riboswtich can improve lysine production in C. glutamicum, we carried out batch fermentations in shake flasks. As shown in Figure 3B, the growth rate of the strain LPECRS#16-lysE was similar to that of LPECRS, but it was reduced compared to that of LP917, indicating that the control of lysE by ECRS#16 has no additional effect on cell growth beyond the negative effect of the lysine-OFF riboswitch. However, the glucose consumption rate was increased in LPECRS#16-lysE. It is speculated that the 1337

DOI: 10.1021/acssynbio.5b00075 ACS Synth. Biol. 2015, 4, 1335−1340

Research Article

ACS Synthetic Biology

(ECRS) was amplified from genomic DNA of E. coli MG1655 using primers ECRS-F/ECRS-R (Table S2). The fragment without the TPP riboswitch (thiM) was amplified using primers LTG-F/LTG-R, with pLacthiMtetA as the template. Then, the two amplified fragments were fused to generate the construct pECRS-tetA (Figure S1) using Gibson assembly master mix (NEB, Frankfurt, Germany). The library was constructed by PCR using primers Lib-F/ Lib-R and pECRS-tetA as the template. After treating the purified PCR product with DpnI, it was phosphorylated with T4 polynucleotide kinase (PNK). The linear DNA was treated using a rapid DNA ligation kit (Thermo Scientific, Germany) and immediately transformed into TOP10 competent cells. The transformed cells were cultured on M9 agar plates containing ampicillin. All colonies were collected and stored in 30% glycerol at −80 °C. Dual Genetic Selection. The dual genetic selection procedure (Figure S3) was carried out according to Nomura and Yokobayashi with minor modifications.26 To enrich the library under the activation of 0.1 mM lysine, the dual genetic selection was repeated three times. After dual genetic selection, cells were plated on M9 plates supplemented with ampicillin and tetracycline with (0.1 mM) or without lysine. Colonies that could grow on the lysine-supplemented plates but not on the lysine-lacking plates were randomly selected and sent for sequencing. Construction of Lysine-ON Riboswitch-lacZ Fusions. A fragment of the lacZ gene was amplified from E. coli MG1655 genomic DNA using primers lacZ-F/lacZ-R. To construct the fusion plasmid pECRS-ON-lacZ, the backbone was amplified from the riboswitch plasmid, which was screened from the lysine riboswitch ON library using primers RGON-F/RGONR. The two fragments were fused to generate the construct pECRS-ON-lacZ using Gibson assembly master mix (NEB, Frankfurt, Germany). The fusion constructs were transformed to TOP10 competent cells. The expression of lacZ was measured using a β-galactosidase enzyme assay kit (ThermoScientific, Germany) in 96-well plates. The measurements were repeated in triplicate. Construction of C. glutamicum Lysine-ON RiboswitchlysE Mutants. In order to assess the potential ability of the lysine-ON riboswitch to improve lysine production in C. glutamicum, we introduced ECRS#16 to control the expression of the lysE gene in C. glutamicum LPECRS in which the expression of citrate synthase (gltA) is under the control of a natural lysine-OFF riboswitch of E. coli (ECRS).24 The suicide vector pK18mobsacB was used to construct pK18-ECRS#16lysE (Figure S4) as follows: the fragment of ECRS#16, the upstream part of lysE, the ORF of the lysE gene, and the backbone of pK18mobsacB were amplified using primers given in Table S2.33 Then, the four fragments were fused to generate pK18-ECRS#16-lysE using Gibson assembly master mix (NEB, Frankfurt, Germany). After confirming the resulting vector, pK18-ECRS#16-lysE, by sequencing, it was used to transform C. glutamicum LPECRS. After homologous recombination, the integration of chromosomal ECRS#16-lysE was verified by PCR and further confirmed by sequencing. The ECRS#16-lysE mutant was designated C. glutamicum LPECRS#16-lysE (Table S1). Fermentation and Analytical Methods. Batch fermentations of C. glutamicum strains were carried out as described previously.24,34 The optical density of cells was measured at 600 nm (E. coli) or 660 nm (C. glutamicum) in 0.1 M HCl using a

response range of the extracellular lysine concentration, we cannot exclude the possibility that the dynamic control is mediated by the lysine-ON riboswitch in the real fermentation due to the complexity of the intracellular environment. We think that the key issue is not whether the intracellular concentration of lysine is within the apparent response range determined by using extracellular lysine but whether the performance of the mutant with the lysine-ON riboswitch is different compared to the control strains. This is welldocumented by the lysine production and by the measured intracellular lysine concentration. Furthermore, we show here that in the same organism the expression of genes could be repressed and simultaneously upregulated by riboswitches that are responding to the same intracellular molecule. The two riboswitches may have different dynamic ranges toward lysine. For concerted control of metabolic pathways, especially under higher concentrations of lysine, it is desirable to alter the dynamic ranges of the riboswitches. Recently, Ma et al. succeeded in expanding the ligand response range of the natural lysine-OFF riboswitch (unpublished data) by using a rational mRNA design approach.30 A similar approach may be also applied to redesigning the lysine-ON riboswitch. Dual genetic circuits, as demonstrated in this work, may be used for systematic and dynamic control of metabolic pathways in C. glutamicum and other industrial microorganisms for lysine biosynthesis.

■

METHODS Bacterial Strains, Plasmids, Media, and Growth Conditions. All strains and plasmids used in this study are listed in Table S1 (Support Information). E. coli Top10 (Invitrogen, Karlsruhe, Germany) was used as the host for plasmid cloning and expression. C. glutamicum with a feedbackderegulated aspartokinase (LP917) and a natural lysine-OFF riboswitch (LPECRS) was used as a lysine producer and control.16,24 E. coli strains were grown in M9 minimal medium or Luria−Bertani (LB) broth (Carl Roth, Karlsruhe, Germany) at 37 °C. A chemically defined and rich medium without lysine (RDM) was used for the measurement of β-galactosidase enzyme activity.18 C. glutamicum strains were cultured in LB or trypticase soy broth medium (DSMZ medium no. 535) at 30 °C on a rotary shaker (230 rpm). For the batch fermentations of C. glutamicum, a defined and optimized minimal medium was used as described previously.16 When necessary, antibiotics were added into the medium as follows: for E. coli, ampicillin, 100 μg/mL, kanamycin, 50 μg/mL, tetracycline, 30 μg/mL; and for C. glutamicum, kanamycin, 15 or 25 μg/mL. DNA Manipulation. Standard protocols were used for DNA extraction and purification and plasmid construction.31 Polymerase chain reaction (PCR) was performed according to the manufacturer’s instructions using Phusion polymerase (Thermo Scientific, Germany). All restriction enzymes were purchased from ThermoFisher Scientific GmbH (Schwerte, Germany). Primers used in this study (Table S2) were obtained from Life Technology (Karlsruhe, Germany). All sequencing was performed at Seqlab (Göttingen, Germany). Transformation of E. coli was performed by using the CaCl2 method.32 The transformation of plasmids into C. glutamicum was carried out using electroporation as described previously.33 Construction of the Lysine-ON Riboswitch Library. A lysine-ON riboswitch library was constructed based on pLacthiMtetA kindly provided by Dr. Yohei Yokobayashi.26 As described before, the natural lysine-OFF riboswitch of E. coli 1338

DOI: 10.1021/acssynbio.5b00075 ACS Synth. Biol. 2015, 4, 1335−1340

Research Article

ACS Synthetic Biology

(8) Ikeda, M., and Nakagawa, S. (2003) The Corynebacterium glutamicum genome: features and impacts on biotechnological processes. Appl. Microbiol. Biotechnol. 62, 99−109. (9) Kirchner, O., and Tauch, A. (2003) Tools for genetic engineering in the amino acid-producing bacterium Corynebacterium glutamicum. J. Biotechnol. 104, 287−299. (10) Zhang, Y., Shang, X., Lai, S., Zhang, G., Liang, Y., and Wen, T. (2012) Development and application of an arabinose-inducible expression system by facilitating inducer uptake in Corynebacterium glutamicum. Appl. Environ. Microbiol. 78, 5831−5838. (11) Kumagai, H. (2006) Amino acid production, in The Prokaryotes, pp 756−765, Springer, New York. (12) Keasling, J. D. (2012) Synthetic biology and the development of tools for metabolic engineering. Metab. Eng. 14, 189−195. (13) Ikeda, M., Ohnishi, J., Hayashi, M., and Mitsuhashi, S. (2006) A genome-based approach to create a minimally mutated Corynebacterium glutamicum strain for efficient L-lysine production. J. Ind. Microbiol. Biotechnol. 33, 610−615. (14) Vasicova, P., Patek, M., Nesvera, J., Sahm, H., and Eikmanns, B. (1999) Analysis of the Corynebacterium glutamicum dapA promoter. J. Bacteriol. 181, 6188−6191. (15) van Ooyen, J., Noack, S., Bott, M., Reth, A., and Eggeling, L. (2012) Improved L-lysine production with Corynebacterium glutamicum and systemic insight into citrate synthase flux and activity. Biotechnol. Bioeng. 109, 2070−2081. (16) Chen, Z., Bommareddy, R. R., Frank, D., Rappert, S., and Zeng, A. P. (2014) Deregulation of feedback inhibition of phosphoenolpyruvate carboxylase for improved lysine production in Corynebacterium glutamicum. Appl. Environ. Microbiol. 80, 1388−1393. (17) Winkler, W., and Breaker, R. (2005) Regulation of bacterial gene expression by riboswitches. Annu. Rev. Microbiol. 59, 487−517. (18) Fowler, C. C., Brown, E. D., and Li, Y. (2010) Using a riboswitch sensor to examine coenzyme B12 metabolism and transport in E. coli. Chem. Biol. 17, 756−765. (19) Blount, K. F., and Breaker, R. R. (2006) Riboswitches as antibacterial drug targets. Nat. Biotechnol. 24, 1558−1564. (20) Vitreschak, A., Rodionov, D., Mironov, A., and Gelfand, M. (2004) Riboswitches: the oldest mechanism for the regulation of gene expression? Trends Genet. 20, 44−50. (21) Takemoto, N., Tanaka, Y., Inui, M., and Yukawa, H. (2014) The physiological role of riboflavin transporter and involvement of FMNriboswitch in its gene expression in Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 98, 4159−4168. (22) Serganov, A., and Patel, D. J. (2009) Amino acid recognition and gene regulation by riboswitches. Biochim. Biophys. Acta, Gene Regul. Mech. 1789, 592−611. (23) Breaker, R. R. (2011) Prospects for riboswitch discovery and analysis. Mol. Cell 43, 867−879. (24) Zhou, L. B., and Zeng, A. P. (2015) Exploring lysine riboswitch for metabolic flux control and improvement of L-lysine synthesis in Corynebacterium glutamicum. ACS Synth. Biol. 4, 729−734. (25) Nomura, Y., and Yokobayashi, Y. (2007) Dual selection of a genetic switch by a single selection marker. BioSystems 90, 115−120. (26) Nomura, Y., and Yokobayashi, Y. (2007) Reengineering a natural riboswitch by dual genetic selection. J. Am. Chem. Soc. 129, 13814−13815. (27) Muranaka, N., Sharma, V., Nomura, Y., and Yokobayashi, Y. (2009) An efficient platform for genetic selection and screening of gene switches in Escherichia coli. Nucleic Acids Res. 37, e39. (28) Vrljic, M., Sahm, H., and Eggeling, L. (1996) A new type of transporter with a new type of cellular function: L-lysine export from Corynebacterium glutamicum. Mol. Microbiol. 22, 815−826. (29) Vrljic, M., Garg, J., Bellmann, A., Wachi, S., Freudl, R., Malecki, M. J., Sahm, H., Kozina, V. J., Eggeling, L., Saier, M. H., Jr., Eggeling, L., and Saier, M. H., Jr. (1999) The LysE superfamily: topology of the lysine exporter LysE of Corynebacterium glutamicum, a paradyme for a novel superfamily of transmembrane solute translocators. J. Mol. Microbiol. Biotechnol. 1, 327−336.

UV spectrophotometer or Multiskan spectrophotometer (Thermo Scientific, Germany). Glucose concentration was measured with the YSI glucose analyzer (YSI, Xylem Inc., USA). The extracellular lysine concentration was measured by using a HPLC method as described before.16

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.5b00075. Strains and plasmids used in this study (Table S1); primers used in this study (Table S2); β-galactosidase activities of pECRS-lacZ, pECRS#16-lacZ, and pG31ClacZ (Table S3); plasmid map of pECRS-tetA used as a template to construct the ECRS-ON-tetA library (Figure S1); DNA sequence of the 5′-UTR regulatory region of the ECRS-ON-tetA library (Figure S2); schematic illustration of the dual genetic selection scheme to identify lysine-ON riboswitches (Figure S3); plasmid map of pK18-ECRS#16-lysE (Figure S4); regulatory elements between lysG and lysE (Figure S5); intracellular lysine concentration during the first 6 h from batch cultivation of C. glutamicum LP917, LPECRS, and LPECRS#16-lysE (Figure S6); additional methods (PDF).

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +49-40-42878-4183. Fax: +49-40-42878-2909. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We appreciate the Deutsche Forschungsgemeinschaft (DFG ZEG542/6-1) for funding this work. L.-B.Z. thanks the Chinese Scholarship Council (CSC) for a Ph.D. scholarship. We also thank Dr. Yohei Yokobayashi for providing the plasmid and Dr. Chengwei Ma for helpful suggestions during revision.

■

REFERENCES

(1) Yukawa, H., and Inui, M. (2013) Corynebacterium glutamicum: Biology and Biotechnology, Springer, Heidelberg. (2) Eggeling, L., and Bott, M. (2005) Handbook of Corynebacterium glutamicum, Taylor & Francis, Boca Raton, FL. (3) Anastassiadis, S. (2007) L-lysine fermentation. Recent Pat. Biotechnol. 1, 11−24. (4) Eggeling, L., Oberle, S., and Sahm, H. (1998) Improved L-lysine yield with Corynebacterium glutamicum: use of dapA resulting in increased flux combined with growth limitation. Appl. Microbiol. Biotechnol. 49, 24−30. (5) Ohnishi, J., Mitsuhashi, S., Hayashi, M., Ando, S., Yokoi, H., Ochiai, K., and Ikeda, M. (2002) A novel methodology employing Corynebacterium glutamicum genome information to generate a new Llysine-producing mutant. Appl. Microbiol. Biotechnol. 58, 217−223. (6) Wittmann, C., and Becker, J. (2007) The L-lysine story: from metabolic pathways to industrial production, in Amino Acid Biosynthesis ∼ Pathways, Regulation and Metabolic Engineering (Wendisch, V. F., Ed.) pp 39−70, Springer, Berlin. (7) Patek, M., Nesvera, J., Guyonvarch, A., Reyes, O., and Leblon, G. (2003) Promoters of Corynebacterium glutamicum. J. Biotechnol. 104, 311−323. 1339

DOI: 10.1021/acssynbio.5b00075 ACS Synth. Biol. 2015, 4, 1335−1340

Research Article

ACS Synthetic Biology (30) Ma, C. W.; Zhou, L.-B.; Zeng, A.-P. (2015) An efficient approach for rational design of riboswitch-based biosensors with expanded response range of small molecules, submitted for publication. (31) Green, M. R., and Sambrook, J. (2012) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (32) Cohen, S. N., Chang, A. C., and Hsu, L. (1972) Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. U. S. A. 69, 2110−2114. (33) Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G., and Puhler, A. (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69−73. (34) Bommareddy, R. R., Chen, Z., Rappert, S., and Zeng, A. P. (2014) A de novo NADPH generation pathway for improving lysine production of Corynebacterium glutamicumby rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogenase. Metab. Eng. 25, 30−37.

1340

DOI: 10.1021/acssynbio.5b00075 ACS Synth. Biol. 2015, 4, 1335−1340